Wikipedia:Historical archive/Logs/Deletion log/Final
Appearance
- 01:36, 23 Dec 2004 Nunh-huh deleted Talk:Fdaadfsdafs (content was: '#redirect [[Talk:History of computing hardware (1960s-present)]]')
- 01:34, 23 Dec 2004 Gadfium deleted Jellymon (content was: '{{delete}}jason was fucking here u bitchz...u can all suck on my fat yellow cock...care for sum eggrolls? ...')
- 01:28, 23 Dec 2004 Gadfium deleted Image:Marathonsmall.jpeg (obsolete thumb)
- 01:28, 23 Dec 2004 Ike9898 deleted Crab Basket (content was: 'Crab Basket is the ideal name for the world's most awesome Rock and Roll band! However, it has been copyrighted by Crab Basket and the Crawfish Crunc...')
- 01:27, 23 Dec 2004 Francs2000 deleted Image:Royal Ducal.jpg (duplicate image)
- 01:26, 23 Dec 2004 Francs2000 deleted Image:Hase.JPG (duplicate image)
- 01:26, 23 Dec 2004 Francs2000 deleted Image:Map of downtown Rome during the Roman Empire medium.jpg (superceded by larger image)
- 01:25, 23 Dec 2004 Francs2000 deleted Image:Marabou storks small.jpg (superceded by larger image)
- 01:25, 23 Dec 2004 Francs2000 deleted Image:Marat safin.jpg (no image)
- 01:24, 23 Dec 2004 Francs2000 deleted Image:Maratha Confederacy.jpg (no image)
- 01:23, 23 Dec 2004 Francs2000 deleted Image:Rooivalk RH Small.jpg (superceded by larger image)
- 01:23, 23 Dec 2004 Francs2000 deleted Teanna Kai (content was: 'she is a super hot model whom i would love to shove my 5 inch penis in. she has an amazing body and a humoungous rack (titties, watermelons, mammories...')
- 01:22, 23 Dec 2004 Francs2000 deleted Flammable ear curtain (content was: '{{deletebecause|random string}}Random string of words put together by Chris lawrence, The owner of the infamous Flammable ear curtain pages on Mhatm...')
- 01:21, 23 Dec 2004 Nunh-huh deleted Ffdaadfdfa (content was: '{{delete}}')
- 01:20, 23 Dec 2004 Francs2000 deleted Faaddfasfdasdfsdfas (content was: '{{delete}}')
- 01:20, 23 Dec 2004 Francs2000 deleted Fadafdafddf (content was: '{{delete}}')
- 01:20, 23 Dec 2004 Francs2000 deleted Fadsdfasdfas (content was: '{{delete}}')
- 01:20, 23 Dec 2004 Francs2000 deleted Fafddfadfadfs (content was: '{{delete}}')
- 01:20, 23 Dec 2004 Francs2000 deleted Fdadfsdfadfs (content was: '{{delete}}')
- 01:20, 23 Dec 2004 Francs2000 deleted Fdafdfdfddfasgf (content was: '{{delete}}')
- 01:20, 23 Dec 2004 Francs2000 deleted Fdasdfasdfas (content was: '{{delete}}')
- 01:19, 23 Dec 2004 Francs2000 deleted Fdasdfasdfasjlk (content was: '{{delete}}')
- 01:19, 23 Dec 2004 Francs2000 deleted Fdfdfdffdsfds (content was: '{{delete}}')
- 01:19, 23 Dec 2004 Francs2000 deleted Fdsdfsfadadf (content was: '{{delete}}')
- 01:19, 23 Dec 2004 Francs2000 deleted Ffdasdfasdfas (content was: '{{delete}}')
- 01:18, 23 Dec 2004 Francs2000 deleted Fsddfasadfs (content was: '{{delete}}')
- 01:17, 23 Dec 2004 Francs2000 deleted Albert Madejczyk (nonsense)
- 01:17, 23 Dec 2004 Gadfium deleted Dfasdfdfas (content was: '{{delete}}' Vandalism cleanup)
- 01:17, 23 Dec 2004 Francs2000 deleted Talk:Afdsdfssdf (content was: '{{delete}}')
- 01:16, 23 Dec 2004 Francs2000 deleted Afdsdfssdf (content was: '{{delete}}')
- 01:16, 23 Dec 2004 Francs2000 deleted Talk:Afdfdsfdasdfsdfas (content was: '{{delete}}')
- 01:16, 23 Dec 2004 Francs2000 deleted Afdfdsfdasdfsdfas (content was: '{{delete}}')
- 01:16, 23 Dec 2004 Francs2000 deleted Can you belive this is not a bot but it is with the sacred firefox (content was: '{{delete}}')
- 01:16, 23 Dec 2004 Francs2000 deleted Fdadfsdfasdfas (content was: '{{delete}}')
- 01:15, 23 Dec 2004 Francs2000 deleted Fdafdadfasdfas (content was: '{{delete}}')
- 01:15, 23 Dec 2004 Francs2000 deleted Ffaddfaadf (content was: '{{delete}}')
- 01:14, 23 Dec 2004 Francs2000 deleted Fdsadfsdfasdfas (content was: '{{delete}}')
- 01:14, 23 Dec 2004 Francs2000 deleted Fddfadfasdfas (content was: '{{delete}}')
- 01:14, 23 Dec 2004 Francs2000 deleted Fdafdsdfasdsf (content was: '{{delete}}')
- 01:14, 23 Dec 2004 Nunh-huh deleted Dfdfasdfadf (content was: '{{delete}}')
- 01:14, 23 Dec 2004 Francs2000 deleted Fdafddfadfs (content was: '{{del}}#redirect [[Quaternary numeral system]]')
- 01:13, 23 Dec 2004 Francs2000 deleted Fdadfdfasdfasdfas (content was: '{{delete}}')
- 01:13, 23 Dec 2004 Francs2000 deleted Fdadfasdfasdfadfs (content was: '{{delete}}')
- 01:13, 23 Dec 2004 Francs2000 deleted Fdadfadfadf (content was: '{{delete}}')
- 01:13, 23 Dec 2004 Francs2000 deleted Fdadfadfaadfs (content was: '{{delete}}')
- 01:12, 23 Dec 2004 Francs2000 deleted Fafdfdasdfas (content was: '{{delete}}')
- 01:12, 23 Dec 2004 Francs2000 deleted Fafdfdadfadfas (content was: '{{delete}}')
- 01:12, 23 Dec 2004 Nunh-huh deleted Afddfadfadf (content was: '{{delete}}')
- 01:12, 23 Dec 2004 Francs2000 deleted Fafdfads (content was: '{{delete}}')
- 01:12, 23 Dec 2004 Francs2000 deleted Fafdafd (content was: '{{delete}}')
- 01:11, 23 Dec 2004 Nunh-huh deleted Talk:Afddfadfadf (content was: '{{delete}}')
- 01:11, 23 Dec 2004 Francs2000 deleted Fadfdadfadf (content was: '{{delete}}')
- 01:11, 23 Dec 2004 Niteowlneils deleted Fdaafddffd (content was: '{{del}}#redirect [[Kalaallit]]')
- 01:11, 23 Dec 2004 Niteowlneils deleted Fdsdfdfasdfssd (content was: '{{db|vandalism cleanup}}#redirect [[George Jackson (MP)]]')
- 01:11, 23 Dec 2004 Francs2000 deleted Image:Edit lang test.png (request by author)
- 01:10, 23 Dec 2004 Nunh-huh deleted Dfasdfasadfsdfas (content was: '{{delete}}#redirect [[Hampton (CDP), New Hampshire]]')
- 01:10, 23 Dec 2004 Nunh-huh deleted Afddfasdfa (content was: '{{delete}}')
- 01:10, 23 Dec 2004 Francs2000 deleted Adventist Medical Center (content was: '{{deletebecause|non-notable and is purely promotional}}Information about Adventist Medical Center, also known as Portland Adventist Medical Center, ...')
- 01:10, 23 Dec 2004 Infrogmation deleted Ffdasfdadfas (content was: '{{delete}}')
- 01:10, 23 Dec 2004 Francs2000 deleted Adfsfadfaadf (content was: '{{delete}}')
- 01:09, 23 Dec 2004 Francs2000 deleted Adffdfda (content was: '{{delete}}')
- 01:09, 23 Dec 2004 Francs2000 deleted Adffdasdfdfas (content was: '{{delete}}')
- 01:08, 23 Dec 2004 Nunh-huh deleted Fsdaafdsfdas (content was: '{{delete}}')
- 01:08, 23 Dec 2004 Nunh-huh deleted Fsdafadf (content was: '{{delete}}')
- 01:08, 23 Dec 2004 Infrogmation deleted Talk:Fdaadfsdfa (content was: '#redirect [[Talk:The 120 Days of Sodom]]')
- 01:08, 23 Dec 2004 ContiE deleted Samuel Smith (delete to prepare page move. (vandalmove, got copypasted back instead of moved back))
- 01:08, 23 Dec 2004 Niteowlneils deleted Asdffddfasdfsa (content was: '{{del}}#redirect [[Mark Knopfler]]')
- 01:07, 23 Dec 2004 Nunh-huh deleted Talk:Fafdafd (content was: '{{delete}}')
- 01:07, 23 Dec 2004 Francs2000 deleted Chris norman (content was: '{{deletebecause|vanity and non-notable}}Musician. He played Flute with the Baltimore Consort.{{stub}}')
- 01:07, 23 Dec 2004 Infrogmation deleted Fdaadfsdfa (content was: '{{delete}}')
- 01:07, 23 Dec 2004 Nunh-huh deleted Fdfdafdadf (content was: '{{delete}}#redirect [[Regin]]')
- 01:07, 23 Dec 2004 Nunh-huh deleted Dafdfasdfadasdas (content was: '{{delete}}')
- 01:07, 23 Dec 2004 ContiE deleted James Thomas Fields (delete to prepare page move. (vandalmove, got copypasted back instead of moved back))
- 01:06, 23 Dec 2004 Nunh-huh deleted Adsffdadfas (content was: '{{delete}}')
- 01:05, 23 Dec 2004 Nunh-huh deleted Fdadfadfasdfas (content was: '{{delete}}')
- 01:05, 23 Dec 2004 Nunh-huh deleted Adffadfdljk (content was: '{{delete}}#redirect [[List of Church of the Nazarene schools]]')
- 01:04, 23 Dec 2004 Nunh-huh deleted Fdfdafadadfs (content was: '{{delete}}#redirect [[Agence France-Presse]]')
- 01:04, 23 Dec 2004 Sannse deleted Ramiro L. Colon (delete to restore history to here - do not replace until move done please!)
- 01:04, 23 Dec 2004 Niteowlneils deleted Talk:None-such (content was: '{{db|talk page created by a vandal for a non-existing article}} A person or thing without equal.Model of excellence or perfection of a kind; one h...')
- 01:04, 23 Dec 2004 Nunh-huh deleted Fdadfadfasdfas (content was: '#redirect [[String Quartet No. 4 (Bartók)]]')
- 01:04, 23 Dec 2004 Nunh-huh deleted Talk:Fdadfadfasdfas (content was: '#redirect [[Talk:String Quartet No. 4 (Bartók)]]')
- 01:03, 23 Dec 2004 ContiE deleted Talk:Fdasfdadfas (content was: '#redirect [[Talk:Firewood]]')
- 01:02, 23 Dec 2004 Nunh-huh deleted Fdaafdfas (content was: '#redirect [[Losser]]')
- 01:02, 23 Dec 2004 Francs2000 deleted Daffdadfadfa (content was: '#redirect [[Vidura]]')
- 01:02, 23 Dec 2004 Nunh-huh deleted Fdadfaadfadfs (content was: '#redirect [[Celle (district)]]')
- 01:02, 23 Dec 2004 Niteowlneils deleted Dafdfadafsdfas (content was: '{{delete}}')
- 01:02, 23 Dec 2004 Nunh-huh deleted Talk:Adsffdadfas (content was: '#redirect [[Talk:Perperuna]]')
- 01:02, 23 Dec 2004 Niteowlneils deleted Adfdafadfdf (content was: '{{del}}#redirect [[Death In June Presents: Occidental Martyr]]')
- 01:01, 23 Dec 2004 TUF-KAT deleted Adfsdfdfa (content was: '{{del}}#redirect [[Iimori, Nagasaki]]')
- 01:01, 23 Dec 2004 Nunh-huh deleted Fdaadfsdafs (content was: '#redirect [[History of computing hardware (1960s-present)]]')
- 01:01, 23 Dec 2004 Francs2000 deleted You can't block the Willy on Wheels (content was: '#redirect [[Aileron]]')
- 01:01, 23 Dec 2004 SimonP deleted Fdfdasdafds (content was: '#redirect [[Antimicrobial counter pen]]')
- 01:00, 23 Dec 2004 Nunh-huh deleted Adfsdfdfa (content was: '{{del}}#redirect [[Iimori, Nagasaki]]')
- 00:59, 23 Dec 2004 SimonP deleted Fadsdfsdfas (content was: '#redirect [[Barry Mann]]')
- 00:59, 23 Dec 2004 ContiE deleted Talk:Fdaadfdfadfs (content was: '#redirect [[Talk:Synon]]')
- 00:59, 23 Dec 2004 Nunh-huh deleted Dfasadfdfadfa (content was: '{{del}}#redirect [[Rashid Minhas]]')
- 00:59, 23 Dec 2004 Nunh-huh deleted Ffdss (content was: '{{db|Vandalism cleanup}}#redirect [[Bazeries cylinder]]')
- 00:58, 23 Dec 2004 SimonP deleted The willy wheels wheels your willy (content was: '#redirect [[James Chapman]]')
- 00:58, 23 Dec 2004 Francs2000 deleted The willy wheels wheels your willy (content was: '#redirect [[James Chapman]]')
- 00:58, 23 Dec 2004 Infrogmation deleted Afdfddfsadfs (content was: '{{Del}}#redirect [[Andrea Pisano]]')
- 00:58, 23 Dec 2004 Danny deleted Fdadfasdfasjkl (content was: '{{del}}#redirect [[Unaussprechlichen Kulten]]')
- 00:58, 23 Dec 2004 Francs2000 deleted Talk:Affaffs (content was: '#redirect [[Talk:Evolution of flagella]]')
- 00:57, 23 Dec 2004 SimonP deleted Adfdfadfas (content was: '#redirect [[CIBC Wood Gundy]]')
- 00:57, 23 Dec 2004 SimonP deleted Adfdfadfasadfs (content was: '#redirect [[Declaration of Independence of Lower Canada]]')
- 00:57, 23 Dec 2004 Nunh-huh deleted Talk:Fdaadffdasdfa (content was: '#redirect [[Talk:Eskorbuto]]' move-vandal cleanup)
- 00:57, 23 Dec 2004 SimonP deleted Captain Garrovick) (content was: '#REDIRECT [[Captain Garrovick]]')
- 00:56, 23 Dec 2004 Jiang deleted MediaWiki:Gallipoli battles (content was: '#redirect [[Template:Gallipoli battles]]')
- 00:56, 23 Dec 2004 SimonP deleted Captain Garrovick (content was: '#REDIRECT [[Ddfasdfasdfas]]')
- 00:56, 23 Dec 2004 Sannse deleted Fdaafddfadf (content was: '#redirect [[Wilfried Martens]]')
- 00:56, 23 Dec 2004 SimonP deleted Ddfasdfasdfas (content was: '#REDIRECT [[Captain Garrovick)]]')
- 00:56, 23 Dec 2004 ContiE deleted Faddfaadfs (content was: '#redirect [[Mary L. Cleave]]')
- 00:55, 23 Dec 2004 Sannse deleted Talk:Afdfddfaadf (content was: '#redirect [[Talk:Adaptive radiation]]')
- 00:55, 23 Dec 2004 Sannse deleted Fddfasdfasdfas (content was: '#redirect [[1845 in music]]')
- 00:55, 23 Dec 2004 Jiang deleted MediaWiki:Sinai and Palestine Campaign battles (content was: '#redirect [[Template:Sinai and Palestine Campaign battles]]')
- 00:55, 23 Dec 2004 SimonP deleted Fdsadfasdfasdfas (content was: '#redirect [[Croatian Academy of Sciences and Arts]]')
- 00:55, 23 Dec 2004 Jiang deleted Template:Sinai and Palestine Campaign battles (tfd since December 9)
- 00:54, 23 Dec 2004 Nunh-huh deleted Fdaadffdasdfa (content was: '#redirect [[Eskorbuto]]' move-vandal cleanup)
- 00:54, 23 Dec 2004 Sannse deleted Fadfdadffdsaadfs (content was: '#redirect [[Shokado bento]]')
- 00:54, 23 Dec 2004 ContiE deleted Afdsfdafsdssa (content was: '#redirect [[Pope Sisinnius]]')
- 00:54, 23 Dec 2004 SimonP deleted Dfasdfasdfas (content was: '#redirect [[List of state leaders in 1142]]')
- 00:54, 23 Dec 2004 Francs2000 deleted Fdfdasadffdas (content was: '#redirect [[Minister of Public Safety and Emergency Preparedness (Canada)]]')
- 00:53, 23 Dec 2004 ContiE deleted Talk:Fdasfdsdfsdfas (content was: '#redirect [[Talk:Yana]]')
- 00:53, 23 Dec 2004 Sannse deleted Fdasfddfaadfs (content was: '#redirect [[Stann Creek District]]')
- 00:53, 23 Dec 2004 Jiang deleted Template:Keydrive internals key (tfd since December 5)
- 00:53, 23 Dec 2004 ContiE deleted Fdasfdsdfsdfas (content was: '#redirect [[Yana]]')
- 00:53, 23 Dec 2004 Francs2000 deleted Fdfdfdasdf (content was: '#redirect [[M*A*S*H (movie)]]')
- 00:52, 23 Dec 2004 Francs2000 deleted Fdfddfasdfas (content was: '#redirect [[Jim Evans]]')
- 00:52, 23 Dec 2004 ContiE deleted Fadfdaadfdf (content was: '#redirect [[Subtractive mixing]]')
- 00:51, 23 Dec 2004 Sannse deleted Whoever blocks me is a loser (content was: '#redirect [[Askersund Municipality]]')
- 00:51, 23 Dec 2004 Sannse deleted Fdaaffaf (content was: '#redirect [[Constitution of Fiji: Chapter 14]]')
- 00:51, 23 Dec 2004 Francs2000 deleted Talk:Fdfdfdasdf (content was: '#redirect [[Talk:M*A*S*H (movie)]]')
- 00:51, 23 Dec 2004 ContiE deleted Fdafddfaafdadf (content was: '#redirect [[John Poulson]]')
- 00:51, 23 Dec 2004 Gadfium deleted Image:Edit Summary.png (obsolete thumb)
- 00:50, 23 Dec 2004 ContiE deleted Ffadfdadfafa (content was: '#redirect [[Adventure Babies]]')
- 00:50, 23 Dec 2004 Francs2000 deleted Dfdfasfdasdfas (content was: '#redirect [[1853 in art]]')
- 00:50, 23 Dec 2004 ContiE deleted Adfsdfdfas (content was: '#redirect [[Michael Schenker]]')
- 00:50, 23 Dec 2004 Sannse deleted Fdsadfasdfsdfas (content was: '#redirect [[Energy conservation]]')
- 00:50, 23 Dec 2004 Nunh-huh deleted Fdfdasfdasfdas (content was: '#redirect [[Laurie Oakes]]' move-vandal cleanup)
- 00:49, 23 Dec 2004 Francs2000 deleted Fdsdfsaadfsdfas (content was: '#redirect [[Battle of Philippi]]')
- 00:49, 23 Dec 2004 Nunh-huh deleted Dafsfdadfadf (content was: '#redirect [[UmJammer Lammy]]' move-vandal cleanup)
- 00:49, 23 Dec 2004 Gadfium deleted Faddfasdfas (content was: '{{delete}}' Vandalism cleanup)
- 00:49, 23 Dec 2004 ContiE deleted Dffdsdfdf (content was: '#redirect [[LAPA]]')
- 00:49, 23 Dec 2004 Francs2000 deleted Talk:But it (content was: '#redirect [[Talk:Player character]]')
- 00:48, 23 Dec 2004 Gadfium deleted Fdadfasdfa (content was: '{{db|Vandalism cleanup}}#redirect [[Buick Regal]]')
- 00:48, 23 Dec 2004 Gadfium deleted Fdaadfadfadf (content was: '{{db|Vandalism cleanup}}#redirect [[Wandsworth Road railway station]]')
- 00:48, 23 Dec 2004 ContiE deleted Gfggf (content was: '#redirect [[The State of the World]]')
- 00:48, 23 Dec 2004 Francs2000 deleted Is the willy on wheels sane (content was: '#redirect [[Vyacheslav Mescherin]]')
- 00:48, 23 Dec 2004 ContiE deleted Fdfdaaaf (content was: '#redirect [[Kossoff]]')
- 00:47, 23 Dec 2004 Nunh-huh deleted Afdfdsdfdfs (content was: '{{db|vandalism cleanup}}#redirect [[Lynn Woolsey]]')
- 00:47, 23 Dec 2004 Francs2000 deleted Who cares (content was: '#redirect [[Lunch]]')
- 00:47, 23 Dec 2004 Nunh-huh deleted Fdadfsdfasdfsadfs (content was: '{{db|Vandalism cleanup}}#redirect [[Art in General]]')
- 00:46, 23 Dec 2004 Gadfium deleted Piotr Wozniak (content was: '{{delete|All links remover and sent to user page}}#REDIRECT [[user:Piotr Wozniak]]')
- 00:46, 23 Dec 2004 Francs2000 deleted Fdfdasdfasdfsa (content was: '#redirect [[Toto]]')
- 00:46, 23 Dec 2004 Sannse deleted Dfafaddfafda (content was: '#redirect [[Marshall Meyer]]')
- 00:46, 23 Dec 2004 Sannse deleted But it (content was: '#redirect [[Player character]]')
- 00:46, 23 Dec 2004 ContiE deleted Is worth (content was: '#redirect [[1627]]')
- 00:45, 23 Dec 2004 Jnc deleted Fdfdasdfadfas (redir, vandalism)
- 00:45, 23 Dec 2004 Gadfium deleted Indian value for one cents (content was: 'Indian value for one cents{{delete}}')
- 00:45, 23 Dec 2004 Gadfium deleted Castratate (Nonsense. content was: 'New word created by Chris Schmidt during the Bauhaus Crew's Snowhaus trip 2004.Also known as Castertate. It is the act of extracting the testicles o...')
- 00:44, 23 Dec 2004 Jnc deleted Talk:Fdfdasdfadfas (redir, vandalism)
- 00:44, 23 Dec 2004 Francs2000 deleted Dfasdfadfasdfas (page move vandalism reverted content was: '#redirect [[Madrepore]]')
- 00:44, 23 Dec 2004 Sannse deleted Asfdadfasdf (content was: '#redirect [[Silver iodide]]')
- 00:44, 23 Dec 2004 Sannse deleted Dfasfadsdfasadfs (content was: '#redirect [[Advanced Weather Interactive Processing System]]')
- 00:44, 23 Dec 2004 Sannse deleted Fdfaddfasdas (content was: '#redirect [[The Comedy Store, London]]')
- 00:44, 23 Dec 2004 Sannse deleted Fdafdfdfad (content was: '#redirect [[1924 Soviet Constitution]]')
- 00:43, 23 Dec 2004 ContiE deleted Fdasadfdfas (content was: '#redirect [[Schuyler]]')
- 00:42, 23 Dec 2004 ContiE deleted Fadsfdasdfas (content was: '#redirect [[First Presidency]]')
- 00:42, 23 Dec 2004 Sannse deleted Adfdfdfsdfs (content was: '#redirect [[St. Albans, Victoria]]')
- 00:42, 23 Dec 2004 Niteowlneils deleted Slave trade and the British Empire (content was: '{{delete}}')
- 00:41, 23 Dec 2004 ContiE deleted Fdasfdadfas (content was: '#redirect [[Firewood]]')
- 00:41, 23 Dec 2004 Sannse deleted Fadfdafaddfas (content was: '#redirect [[Theophilus of Antioch]]')
- 00:41, 23 Dec 2004 ContiE deleted Afdsdfafdas (content was: '#redirect [[List of Italian dreadnought battleships]]')
- 00:40, 23 Dec 2004 ContiE deleted Fdaadfdfasdfas (content was: '#redirect [[SWIG]]')
- 00:40, 23 Dec 2004 Ike9898 deleted Icitabob (nonsense)
- 00:40, 23 Dec 2004 ContiE deleted Fddfaafdsdfas (content was: '#redirect [[Wobble board]]')
- 00:37, 23 Dec 2004 ContiE deleted Fafddfasfdas (content was: '#redirect [[Ridge Radio]]')
- 00:36, 23 Dec 2004 Sannse deleted Fdfdafaddfa (content was: '#redirect [[Auchinleck Talbot F.C.]]')
- 00:36, 23 Dec 2004 ContiE deleted Dfdfasdfas (content was: '#redirect [[Mjältön]]')
- 00:36, 23 Dec 2004 ContiE deleted Dafdafdadfa (content was: '#redirect [[1250s BC]]')
- 00:35, 23 Dec 2004 ContiE deleted Fdadfasdfadfa (content was: '#redirect [[Krýsuvík]]')
- 00:34, 23 Dec 2004 ContiE deleted Afdafddfaadf (content was: '#redirect [[Pegasus Mail]]')
- 00:33, 23 Dec 2004 Ike9898 deleted Kallar (content was: '[[Link title]]kallar mean onthe communities in south india{{del}}')
- 00:33, 23 Dec 2004 ContiE deleted Fdaadfdfasfda (content was: '#redirect [[Princeps]]')
- 00:31, 23 Dec 2004 ContiE deleted Dfafdadfaad (content was: '#redirect [[NHL Players Association]]')
- 00:31, 23 Dec 2004 SimonP deleted Kallar (content was: '[[Link title]]kallar mean onthe communities in south india')
- 00:30, 23 Dec 2004 ContiE deleted Fdfdasdfasdfds (content was: '#redirect [[Länsförsäkringar Bank]]')
- 00:29, 23 Dec 2004 ContiE deleted Wil-li (content was: '#redirect [[Yli-Ii]]')
- 00:29, 23 Dec 2004 Ike9898 deleted Dingleberry (scatological slang dic-def)
- 00:28, 23 Dec 2004 Sannse deleted Adfsadfdfafad (content was: '#redirect [[Informbiro]]')
- 00:28, 23 Dec 2004 ContiE deleted Norwegian Willys (content was: '#redirect [[Norwegian battleships]]')
- 00:28, 23 Dec 2004 Sannse deleted Fdfdfdafda (content was: '#redirect [[Angus Ogilvy]]')
- 00:27, 23 Dec 2004 ContiE deleted Fadfaffaddfa (content was: '#redirect [[Masyanya]]')
- 00:26, 23 Dec 2004 Jnc deleted Shagmaestro (xspace redir to User:)
- 00:26, 23 Dec 2004 ContiE deleted Fdasfdasfda (content was: '#redirect [[112 BC]]')
- 00:25, 23 Dec 2004 Sannse deleted Fdfdasfdasdfas (content was: '#redirect [[Chuck D]]')
- 00:25, 23 Dec 2004 Jnc deleted Talk:Shagmaestro (xspace redir to User:)
- 00:25, 23 Dec 2004 ContiE deleted Fdaadfdfadfs (content was: '#redirect [[Synon]]')
- 00:24, 23 Dec 2004 ContiE deleted Faffdasdfas (content was: '#redirect [[Bisexual]]')
- 00:23, 23 Dec 2004 ContiE deleted Adsffdaadf (content was: '#redirect [[Underwoodisaurus]]')
- 00:22, 23 Dec 2004 Sannse deleted Afdfddfaadf (content was: '#redirect [[Adaptive radiation]]')
- 00:21, 23 Dec 2004 Violetriga deleted Afddfadfas (Willy on Wheels page move vandalism)
- 00:21, 23 Dec 2004 ContiE deleted Talk:Faffdasdfas (content was: '#redirect [[Talk:Bisexual]]')
- 00:20, 23 Dec 2004 ContiE deleted Fadfafafa (content was: '#redirect [[League of Struggle for Negro Rights]]')
- 00:19, 23 Dec 2004 Duncharris deleted Www.townofbreckenridge.com (content was: '{{delete}}The Kingdom of Breckenridge lies high in the Colorado Rockies. It has a lively main street as well as a popular ski area. The town was f...')
- 00:19, 23 Dec 2004 Neutrality deleted Willy on Wheels runs over your wiki willy (content was: '#redirect [[Winston Tong]]')
- 00:18, 23 Dec 2004 ContiE deleted Fadfdfadfas (content was: '#redirect [[Dorotea Municipality]]')
- 00:17, 23 Dec 2004 ContiE deleted Afddfdfaadf (pagemovevandalism; content was: '#redirect [[Beyondblue]]')
- 00:16, 23 Dec 2004 Neutrality deleted Afddfdfaadf (Beyondblue)
- 00:15, 23 Dec 2004 Neutrality deleted Fadfasdfassdafdas (Deleting remants of page-move vandalism)
- 00:14, 23 Dec 2004 ContiE deleted Fdasadfdfaaddffaddfa (page moving vandalism; content was: '#redirect [[Electronic sports]]')
- 00:07, 23 Dec 2004 Neutrality deleted Yevanic language (content was: '#REDIRECT [[Yevanic]]')
- 00:03, 23 Dec 2004 Nunh-huh restored "Talk:Colonial_Colleges"
- 00:02, 23 Dec 2004 Nunh-huh deleted Talk:Colonial Colleges (temp deletion for page history merge)
- 00:01, 23 Dec 2004 Infrogmation deleted Image:India1760 1905 Small.JPG (obsolte thumbnail dupe no longer needed)
- 00:00, 23 Dec 2004 Infrogmation deleted Image:Jackie Chan.gif (old unused WP:PUI tagged for deletion)
- 23:58, 22 Dec 2004 Infrogmation deleted Image:EdwardGibbonSmall.jpeg (old thumbnail no longer needed)
- 23:58, 22 Dec 2004 Nunh-huh restored "Colonial_Colleges"
- 23:57, 22 Dec 2004 Nunh-huh deleted Colonial Colleges (temp deletion for page history merge)
- 23:56, 22 Dec 2004 Infrogmation deleted Grunt Rebellion (content was: {{delete)) ' The grunt rebellion seems to be an ancient occerance that happened at the very start of the alien alliance known as the covenant. It was after the ra...')
- 23:56, 22 Dec 2004 Infrogmation deleted Angelgirl90 (junk vanity)
- 23:54, 22 Dec 2004 Infrogmation deleted Fred Savage (author) (content was: '{{delete}}hello como esta soy unas de tus fans')
- 23:51, 22 Dec 2004 Infrogmation deleted Talk:Ray Bolger (content before blanking was: 'What a hottiemmmmmmmm')
- 23:38, 22 Dec 2004 Niteowlneils deleted Presidential nomination (content was: '{{deletebecause|article is empty}}')
- 23:35, 22 Dec 2004 Infrogmation deleted Harris munir (content was: 'Nunya')
- 23:32, 22 Dec 2004 UtherSRG deleted Sumphalangus (typo content was: '#redirect [[gibbon]]')
- 23:31, 22 Dec 2004 Duncharris deleted User:Duncharris/vanitynote (just a little experiment of mine)
- 23:31, 22 Dec 2004 Infrogmation deleted Talk:Experience point (content was: 'LOL... are you ALL gay ?fuck this definition. i have a better one. noobs...')
- 23:26, 22 Dec 2004 Duncharris deleted RÄ«ga (content was: 'Rīga, the capital of [[Latvia]], also spelled [[Riga]].')
- 23:21, 22 Dec 2004 Evercat deleted Godliness (content was: 'Do Godliness means holiness,and if it does is there a way aperson can live such a lifestyle.')
- 23:19, 22 Dec 2004 Neutrality deleted Category:User contributed limited public domain images (content was: '[[Category:User-created_public_domain_images]]{{Image template notice|PD-self-wikipedia}}{{cfd}}')
- 23:19, 22 Dec 2004 Evercat deleted Phanopoeia (content was: '{{delete}}fuck this man.i gunna keep on usin slang.')
- 23:19, 22 Dec 2004 Neutrality deleted Template:PD-self-wikipedia (content was: '{{tfd}}{| class='boilerplate' id='pd' style='width: 95%; margin: 0 auto; text-align: justify; background: #F1F1DE; padding: 0 10px; border: 1px solid...')
- 23:18, 22 Dec 2004 Neutrality deleted Template talk:PD-self-wikipedia (content was: 'What does this mean? [[Public domain]] is public domain.[[User:Msh210|<nowiki></nowiki>]] —[[User:msh210|msh210]] 14:14, 15 Dec 2004 (UTC)Yes....')
- 23:16, 22 Dec 2004 Niteowlneils deleted Pokemon Sardonyx Shard (content was: '{{deletebecause|Article is virtually empty: only content is 'pokemon'}}pokemon')
- 23:16, 22 Dec 2004 Niteowlneils deleted Nicholas of Sion (content was: '{{db|devoid of content}}')
- 23:16, 22 Dec 2004 Niteowlneils deleted Pimp steak (content was: '{{delete}}n: hamburger')
- 23:15, 22 Dec 2004 Niteowlneils deleted Weston Tate (content was: 'Weston is a dumbface.{{delete}}')
- 23:15, 22 Dec 2004 Niteowlneils deleted "Daniel Alicea" (content was: 'i whant you to fight marco antoneo brera{{delete}}')
- 23:04, 22 Dec 2004 Evercat deleted Liam McAndrew (content was: '{{deletebecause|vanity; content is 'Liam Matthew McAndrew (November 19, 1987 - Present)'}}Liam Matthew McAndrew (November 19, 1987 - Present)')
- 23:00, 22 Dec 2004 Evercat deleted Make a articiles (content was: 'tigers are very handsome people think tere dangerouos there very are few left bigest are in the countrys asia and northen of china it's in the chin...')
- 23:00, 22 Dec 2004 Neutrality deleted CC (content was: '#REDIRECT [[Cc]]' (for page move))
- 22:52, 22 Dec 2004 Adam Bishop deleted Talk:Bung (content was: 'BUNG RAPE!')
- 22:51, 22 Dec 2004 Fennec deleted Choketsu Uga (content contained: "oketsu "Choad" Uga is a 12th grade student at the Academy for Business and Computer Technology. ")
- 22:45, 22 Dec 2004 Adam Bishop deleted Liam MCAndrew (content was: 'Liam Matthew McAndrew (November 19, 1987 - Present)')
- 22:44, 22 Dec 2004 Adam Bishop deleted Fuckers (content was: 'Is what the wikipedia creators are.')
- 22:41, 22 Dec 2004 Rmhermen deleted Luke Mancuso
- 22:39, 22 Dec 2004 Sannse deleted Talk:Single (music) (content was: '{{move | single (music)}}' delete for move to here)
- 22:37, 22 Dec 2004 Sannse deleted Single (content was: '#REDIRECT [[Single (music)]]' delete for move to here)
- 22:36, 22 Dec 2004 Ike9898 deleted 1 cow (content was: '1 cat')
- 22:35, 22 Dec 2004 Meelar deleted Greasepole (content was: 'The greesepole is really, really, really tall.')
- 22:34, 22 Dec 2004 Jayjg deleted Floriana amateur football club (Contents: The Floriana Amateur Football Club has at its clubhouse at No 3, Triq il-Konservatorju, Floriana.)
- 22:31, 22 Dec 2004 Evercat deleted Greasepole (content was: 'The greesepole is tall.')
- 22:24, 22 Dec 2004 Adam Bishop deleted Competitive swimming (content was: 'It is hell. But good.')
- 22:23, 22 Dec 2004 Rmhermen deleted User:Whosyourjudas/sandbox (content was: '{{db|unneeded personal subpage. --[[User:Whosyourjudas|[[User:Whosyourjudas|Whosyourjudas]]\<sup>[[User talk:Whosyourjudas|talk]]</sup>]] 21:59, 22 D...')
- 22:21, 22 Dec 2004 Rmhermen deleted Antti ranta (content was: '{{delete}}Antti Ranta was born in 1986 in Helsinki. Hän asuu nykyisin Suomessa ja on usein humalassa.')
- 22:19, 22 Dec 2004 Rmhermen deleted Anglo-Ashanti Wars (content was: '{{delete}} I like monkeys YUUMMMÉÉÉ ÉÉÉÉ')
- 22:02, 22 Dec 2004 CryptoDerk deleted 3 cow (content was: '3 cat')
- 22:02, 22 Dec 2004 CryptoDerk deleted 4 cow (content was: '4 cat')
- 22:01, 22 Dec 2004 SimonP deleted Image:View of great malvern.jpg (broken image)
- 21:34, 22 Dec 2004 Adam Bishop deleted Saif ad-Din Qutuz (content was: copyright violation since December 11)
- 21:29, 22 Dec 2004 Rmhermen deleted Chuba (content was: 'Chuba: A goblin hero with a taste for donuts. He likes to kick wizards in the groin as well.')
- 21:19, 22 Dec 2004 CryptoDerk deleted ZXY (content was: '== ZXY ==ZXY are the last three letters of the english alphabet rearranged.Other Combinations:-XYZ-XZY-YXZ-YZX-ZYX')
- 21:13, 22 Dec 2004 Dante Alighieri deleted OTPW (content was: '{{db|no content}}[http://www.cl.cam.ac.uk/~mgk25/otpw.html OTPW]')
- 21:12, 22 Dec 2004 Dante Alighieri deleted List of proverbs (content was: '{{del}}support')
- 21:12, 22 Dec 2004 Dante Alighieri deleted Cryptic definition (content was: '{{del}}wrapping')
- 21:04, 22 Dec 2004 DJ Clayworth deleted Mike Perna (content was: 'Mike Ryberg is fumb')
- 21:02, 22 Dec 2004 DJ Clayworth deleted Boglelation (patent nonsense - non-existent word)
- 20:58, 22 Dec 2004 DJ Clayworth deleted Cowleroni (content was: 'Cowleroni. What is it, but a word meaning absolutely whatever you want it to mean. ...')
- 20:57, 22 Dec 2004 DJ Clayworth deleted Egglicious (content was: 'Egglicious A word used to describe the taste of eggs in a good way.'Mmmmmmmmm. ...')
- 20:53, 22 Dec 2004 DJ Clayworth deleted Code source.fr (content was: 'le source')
- 20:42, 22 Dec 2004 Michael Hardy deleted User:Kirawales (This user adopted the name of Wikipedia's founder's daughter for the purpose of libelous attacks on that child and other vandalism.)
- 20:40, 22 Dec 2004 Michael Hardy deleted User:Christinewales (This user adopted the name of the wife of Wikipedia's founder and created this account for vandalism purposes, including libelous attacks against the real Christine Wales.)
- 20:38, 22 Dec 2004 Cyrius deleted Talk:2006 Atlantic hurricane season (content before blanking was newbie typing test)
- 20:37, 22 Dec 2004 AllyUnion deleted WikiProject Grammar/Purpose (My mistake, forgot the namespace)
- 20:28, 22 Dec 2004 Violetriga deleted Matt Mosz (Vanity page by 69.47.184.112 (deleted twice before) - user blocked by [[User:David Gerard]])
- 20:23, 22 Dec 2004 Rfl deleted Gogemon (content was: '{{delete}}Gogemon is a man who is a monster and will do anything to takeover the world.')
- 20:17, 22 Dec 2004 Violetriga deleted Matt Mosz (second bout of vanity - content was: 'block me from this I dare you all')
- 20:13, 22 Dec 2004 Violetriga deleted Matt Mosz (obvious vanity by 69.47.184.112)
- 20:10, 22 Dec 2004 Gadfium deleted Dihydrocapsaicin (content was: '{{delete}}dyhydrocapsaicin is found in spider monkeys. many monkeys are killed for their dyhydrocapsaicin glands, which looks oddly like a swiss ar...')
- 20:08, 22 Dec 2004 Gadfium deleted Wikipedia:New sandbox (content was: '{{delete}}{{sandbox}}==Greetings=='''''Hello!'''''==Link==[[Wikipedia:Sandbox|Harry Morgan]]')
- 20:06, 22 Dec 2004 Jimfbleak deleted Master of Education (content was: 'jhjh')
- 20:06, 22 Dec 2004 Gadfium deleted Jackqu7 (content was: '{{db|mindless}}')
- 20:05, 22 Dec 2004 Gadfium deleted A wizard did it (content was: '{{del}}A very convenient excuse. As in: 'I totally didn't run over your dog, a wizard did it.'')
- 20:05, 22 Dec 2004 Gadfium deleted Image:Calcite.double.350pix.jpg (obsolete thumb)
- 20:04, 22 Dec 2004 Gadfium deleted Image:Canaletto.grand.350pix.jpg (obsolete thumb)
- 20:03, 22 Dec 2004 Gadfium deleted Image:Caravaggio.emmaus.350pix.jpg (obsolete thumb)
- 20:03, 22 Dec 2004 Gadfium deleted Image:Dh.foxmoth.350pix.jpg (obsolete thumb)
- 20:02, 22 Dec 2004 Gadfium deleted Image:Gauguin.swineherd.350pix.jpg (obsolete thumb)
- 20:00, 22 Dec 2004 Aranel deleted Category:Illness (delete per cfd and with agreement of creator)
- 19:59, 22 Dec 2004 Gadfium deleted Image:Lasvegas.terra.400pix.jpg (obsolete thumb)
- 19:58, 22 Dec 2004 Gadfium deleted Image:Lufthansa.b737.london.300pix.jpg (obsolete thumb)
- 19:58, 22 Dec 2004 Aranel deleted Category:Air-launched strategic missiles (delete per cfd)
- 19:57, 22 Dec 2004 Aranel deleted Category talk:Air-launched anti-ship missiles (deleted per cfd)
- 19:57, 22 Dec 2004 Aranel deleted Category:Air-launched anti-ship missiles (delete per cfd)
- 19:56, 22 Dec 2004 Aranel deleted Category:Airports of the Faroe Islands (delete per cfd)
- 19:56, 22 Dec 2004 Aranel deleted Category:Eric Clapton (delete per cfd)
- 19:56, 22 Dec 2004 Gadfium deleted Image:Rubens.adoration.300pix.jpg (obsolete thumb)
- 19:55, 22 Dec 2004 Aranel deleted Category:Battle of the Pacific (delete per cfd, use Category:World War II operations and battles of the Pacific Campaign)
- 19:55, 22 Dec 2004 Aranel deleted Category:Annual events (delete empty category per cfd)
- 19:55, 22 Dec 2004 Aranel deleted Category:Anti-armour weapons (delete empty category per cfd)
- 19:54, 22 Dec 2004 Aranel deleted Category:Anti-submarine missiles (delete empty category per cfd)
- 19:54, 22 Dec 2004 Aranel deleted Category:Anti-tank guns (delete empty category per cfd)
- 19:54, 22 Dec 2004 Jimfbleak deleted Template:Newborn (content was: 'nonsense}}... MY GOD!!! What the hell happened! My head and shoulders are killing me and what the hell is making my eyes hurt? Feels like I was ...')
- 19:53, 22 Dec 2004 Gadfium deleted Image:Rufous treepie.jpg (Duplicate image)
- 19:53, 22 Dec 2004 Jimfbleak deleted William Boyd (bassist) (content was: 'delete}}i would like to email him....on behalf of him...........if that makes any sense to you all? never mind ill just post this because i want.....')
- 19:53, 22 Dec 2004 Gadfium deleted Image:Singa.b747-400.9v-sfj.350pix.jpg (obsolete thumb)
- 19:52, 22 Dec 2004 Jimfbleak deleted Image:Bismarck.png (listed for speedy deletion)
- 19:52, 22 Dec 2004 Jimfbleak deleted Properties of noble gases (content was: 'delete}}pooppooppooppooppoopandlotsofpoop=noble gases')
- 19:51, 22 Dec 2004 Jimfbleak deleted Monkology (junk)
- 19:51, 22 Dec 2004 Jimfbleak deleted Los angles class submarine (content was: 'deletebecause|An article that isn't a copyvio already exists at [[Los Angeles class submarine]].}}{{copyvio|url=http://www.transportstation.org/sho...')
- 19:50, 22 Dec 2004 Jimfbleak deleted Krystyna Radziwil (content was: '{delete}}')
- 19:50, 22 Dec 2004 Jimfbleak deleted Hooah (content was: '{Move to Wiktionary}}A military term referring to or meaning anything except 'no'. Common usage denotes agreement.{{nonsense}}')
- 19:50, 22 Dec 2004 Jimfbleak deleted Hash-eater (content was: 'delete}}people who consume hash orally are called as hash eater's')
- 19:49, 22 Dec 2004 Jimfbleak deleted Google Community (content was: '{deletebecause|Already deleted through VFD}}'''Google Community''' is a set of discussion forums where users can discuss various aspects of the pop...')
- 19:49, 22 Dec 2004 Jimfbleak deleted Category:Southend (content was: '{db|it was created by mistake}}[[Category:Essex]]')
- 19:48, 22 Dec 2004 Gadfium deleted Athletics at the 1964 Summer Olympics (content was: ' RELAY RACES{{delete}}')
- 19:47, 22 Dec 2004 Jimfbleak deleted Johnny Galecki (content was: 'He was on Roseanne, and in the movie x-mas vacation.')
- 19:45, 22 Dec 2004 Jimfbleak deleted Is it harder for males or females to abstain (content was: 'I have no idea witch is witch when i get more information i will let you know what is the answer to the question that everyone asks')
- 19:44, 22 Dec 2004 Jimfbleak deleted John vattic (gibberish content was: 'john vattic is the star of second sight the game a man who is psychic even though months before he discovered his powers he was trying to disprove par...')
- 19:43, 22 Dec 2004 Jimfbleak deleted Chipcards (content was: 'hello')
- 19:43, 22 Dec 2004 Jimfbleak deleted Flying Eagle (nonsense content was: 'A [[Hopi prophecy]] says that the [[Hopi]] and the red-suited men ([[Tibet]]ans) from across the Ocean will be reunited as brothers. A [[Tibetan proph...')
- 19:42, 22 Dec 2004 Infrogmation deleted Image:Arrow Launch.JPG (WP:PUI listed & tagged for deletion since September)
- 19:42, 22 Dec 2004 Jimfbleak deleted Rob Steenwyk (content was: 'Rob Steenwyk is a geek. He loves technology in all forms, and is currently the owner of RJS Web Design, a company that provides cheap, quality web sit...')
- 19:42, 22 Dec 2004 Jimfbleak deleted Mary sue coleman (content was: 'Mary Sue Coleman is the current president of the [[University of Michigan]].')
- 19:40, 22 Dec 2004 Jimfbleak deleted Gowla (content was: 'popo')
- 19:39, 22 Dec 2004 Infrogmation deleted Image:Potw 060204.jpg (orphan unverified unused image; uploader says delete)
- 19:39, 22 Dec 2004 Meelar deleted None-such (content was: '{{delete}}Something that does not exist in actuality, very silly. Taken from Alice in Wonderland.')
- 19:38, 22 Dec 2004 Meelar deleted Talk:None-such (content was: 'A person or thing without equal.model of excellence or perfection of a kind; one having no equal')
- 19:38, 22 Dec 2004 Cyrius restored "Herbert_George_Wells"
- 19:38, 22 Dec 2004 Cyrius restored "Talk:Herbert_George_Wells"
- 19:35, 22 Dec 2004 Cyrius deleted Talk:Herbert George Wells (page history merge, back momentarily)
- 19:35, 22 Dec 2004 Cyrius deleted Herbert George Wells (page history merge, back momentarily)
- 19:11, 22 Dec 2004 Snoyes deleted New England Institute of Technology (content was: 'the new england institute of technology is one of the greatest schools in the history of the earth. graduates become great scienctist and then blow u...')
- 19:11, 22 Dec 2004 Quadell deleted Image:Ant SEM small.jpg (Thumbnail, unused)
- 19:09, 22 Dec 2004 Infrogmation deleted Tommyrot (content was: 'Utter foolishness; nonsense.Pretentious or silly talk or writing.')
- 19:07, 22 Dec 2004 Infrogmation deleted Asset backed security (content was: 'Asset backed security')
- 19:07, 22 Dec 2004 Infrogmation deleted Manraj bajwa (content was: '== Manraj Bajwa==He is a '''liverpool''' supporter and he is a 13 year old '''LIVING LEGEND'''. He lives in England ,Londonand has the '''biggest ...')
- 19:06, 22 Dec 2004 Infrogmation deleted Afghan Civil War (Not even a substub; content was: '{{wikify}}The Afghan Civil War was a revolutionary war in Afganistan{{hist-stub}}{{substub}}')
- 19:05, 22 Dec 2004 Infrogmation deleted Image:Agyo.jpg (WP:PUI listed and tagged for deletion since September)
- 19:03, 22 Dec 2004 DJ Clayworth deleted Jatt (content was: '== JATT =='''JATTS''' ARE FARMERS')
- 19:01, 22 Dec 2004 DJ Clayworth deleted The Law of the Jungle (content was: 'the law of the jungle')
- 19:01, 22 Dec 2004 DJ Clayworth deleted Reindeer are stupid (content was: 'Reindeer are stupid!')
- 18:59, 22 Dec 2004 Infrogmation deleted Reindeer are stupid (content was: 'Reindeer are stupid!')
- 18:57, 22 Dec 2004 Deb deleted Teacher's Pet (content was: '{{stub}}[[Category:Disney TV shows]]')
- 18:57, 22 Dec 2004 Deb deleted Reindeer are stupid (content was: 'Reindeer are stupid!')
- 18:57, 22 Dec 2004 Infrogmation deleted Image:Montcelo.JPG (WP:PUI listed and tagged for deletion since October. )
- 18:56, 22 Dec 2004 Deb deleted Sarah churney
- 18:56, 22 Dec 2004 Deb deleted Badlapur (content was: '{{db|empty page}}.')
- 18:56, 22 Dec 2004 Deb deleted Monlology (duplicate)
- 18:54, 22 Dec 2004 Deb deleted Idle Hands (content was: '{{delete}}this movie with devon sawa and jessica alba is a great movie.this movie is about a guy who have an evil hand and it kill's so if you ain't ...')
- 18:53, 22 Dec 2004 Deb deleted Lebanese Arabic (content was: '{{del}}'''Bonjour tout la monde !'''Bold text''''''')
- 18:53, 22 Dec 2004 Deb deleted Meaty (content was: '{{delete}} Meaty-adj- Chunky or beefy. Eddie is great. {Also search Meatie}')
- 18:53, 22 Dec 2004 Deb deleted Meaty (content was: '{{delete}} Meaty-adj- Chunky or beefy. Eddie is great. {Also search Meatie}')
- 18:53, 22 Dec 2004 Deb deleted Leonardo Di Caprio (book) (content was: '{{delete}}leonardo of realy weahmy name is abdullah yıldırırm=leonardo 2=')
- 18:53, 22 Dec 2004 Deb deleted Jameson & Sons Distillery (content was: '{{del}}near some place, it did something; it was amazing.Probably distilled somwthing (NO WAY!)')
- 18:52, 22 Dec 2004 Deb deleted Azeddine el Mocadecci (content was: 'Start{{delete}}')
- 18:49, 22 Dec 2004 Deb deleted Matjaz Pikalo (content was: 'kkkk')
- 18:49, 22 Dec 2004 Infrogmation deleted Image:Windsor castle.JPG (WP:PUI listed and tagged for deletion since October. )
- 18:49, 22 Dec 2004 Infrogmation deleted Image talk:Windsor castle.JPG (talk for deleted image; content was: 'Can we have some copyright information about this photo as given the angle it doesn't seem to be have taken by a casual photographer ?')
- 18:48, 22 Dec 2004 Infrogmation deleted Image:Imperial regalia.JPG (WP:PUI listed and tagged for deletion since October. )
- 18:48, 22 Dec 2004 Rfl deleted Connor McKenna (content was: '{{delete}}The Greatest Lover on earth')
- 18:48, 22 Dec 2004 DJ Clayworth deleted The paris gun/Temp (a 'Temp' page for a copy vio article that had more copyvio stuff pasted into it)
- 18:46, 22 Dec 2004 Deb deleted Sam Keeley (content was: '[[Image:Samkeeleywebcam.jpg]]')
- 18:45, 22 Dec 2004 Deb deleted Jauvin (content was: 'a nice guy')
- 18:45, 22 Dec 2004 DJ Clayworth deleted Habitual criminal (content was: 'search for habitual criminal law in Minnesota')
- 18:43, 22 Dec 2004 Infrogmation deleted Image:Hughenden manor.jpg (WP:PUI listed and tagged for deletion since October)
- 18:43, 22 Dec 2004 Infrogmation deleted Image:Glamis castle.jpg (WP:PUI listed and tagged for deletion since October)
- 18:42, 22 Dec 2004 DJ Clayworth deleted Connor McKenna (content was: 'Greatest Man ON EarthAnd also the greatest lover on earth')
- 18:33, 22 Dec 2004 Infrogmation deleted Image:Caernarfon castle.JPG (WP:PUI listed and tagged for deletion since October)
- 18:31, 22 Dec 2004 Infrogmation deleted Image:Beau01.jpg (WP:PUI listed and tagged for deletion since October)
- 18:30, 22 Dec 2004 DJ Clayworth deleted Indian pop (content was: 'alisha chinai')
- 18:30, 22 Dec 2004 DJ Clayworth deleted Avalaunch (content was: 'test')
- 18:30, 22 Dec 2004 Infrogmation deleted Image:Beau02.jpg (WP:PUI listed and tagged for deletion since October)
- 18:29, 22 Dec 2004 Infrogmation deleted Image:Beau03.jpg (WP:PUI listed and tagged for deletion since October)
- 18:29, 22 Dec 2004 Infrogmation deleted Image:Newhaths.JPG (WP:PUI listed and tagged for deletion since October)
- 18:28, 22 Dec 2004 DJ Clayworth deleted Dildo in his butt (content was: 'It was forty two inches deep in my butt')
- 18:23, 22 Dec 2004 Infrogmation deleted Image:Triptomb.JPG (WP:PUI listed and tagged for deletion since October)
- 18:23, 22 Dec 2004 Infrogmation deleted Image:Plymrock.JPG (WP:PUI listed and tagged for deletion since October)
- 18:18, 22 Dec 2004 Infrogmation deleted Image:Tewxplan.JPG (WP:PUI listed and tagged for deletion since October)
- 18:17, 22 Dec 2004 Infrogmation deleted Image:Cathplan.JPG (WP:PUI listed and tagged for deletion since October)
- 18:12, 22 Dec 2004 Infrogmation deleted Image:Zx81.JPG (WP:PUI listed and tagged for deletion since October)
- 18:11, 22 Dec 2004 Infrogmation deleted Image:Caip40.JPG (WP:PUI listed and tagged for deletion since October)
- 18:10, 22 Dec 2004 Deb deleted EAMT (content was: 'ciao{{delete}}')
- 18:09, 22 Dec 2004 Deb deleted Keith Gordon (content was: '{{del}}He is the man. That is all.')
- 18:08, 22 Dec 2004 Deb deleted Apollo Hospitals (content was: '{{delete}}imran aqhmed')
- 18:07, 22 Dec 2004 Infrogmation deleted Image:Punch card.JPG (WP:PUI listed and tagged for deletion since October)
- 17:39, 22 Dec 2004 Rfl deleted Clerical script (content was: '体育{{delete}}')
- 17:37, 22 Dec 2004 Violetriga deleted Category:In the news December 2004 (content was: 'Items of news from [[December 2004]][[Category:2004 news]]')
- 17:31, 22 Dec 2004 Violetriga deleted Category:In the news 2000s (content was: 'Items of news from the [[2000s]].[[Category:News]]')
- 17:29, 22 Dec 2004 Violetriga deleted Category:In the news 2004 (content was: 'Items of news from [[2004]][[Category:In the news 2000s]][[Category:2004]]')
- 17:19, 22 Dec 2004 Meelar deleted Talk:Worst President Ever (content was: '#REDIRECT [[Talk:George W. Bush]]')
- 17:18, 22 Dec 2004 Meelar deleted Talk:George W. Bush (content was: '#REDIRECT [[Talk:Worst President Ever]]')
- 17:18, 22 Dec 2004 Mirv deleted Talk:Risk Godstorm (content was: 'JORDI')
- 17:18, 22 Dec 2004 Ahoerstemeier deleted Worst President Ever (content was: '#redirect [[George W. Bush]]' - created by a vandalism move)
- 17:17, 22 Dec 2004 Mirv deleted Risk Godstorm (content was: '{{del}}GHJ')
- 17:17, 22 Dec 2004 Ahoerstemeier deleted Mephaehi (content was: '#REDIRECT [[Vji Mephaehi]]' - points to an already deleted article)
- 17:06, 22 Dec 2004 Ram-Man deleted Category:Creative Commons Attribution 2.0 Dual License (content was: 'To make your contributions available under this license, use the template '''<nowiki>{{DualLicenseWithCC-By-2.0}}</nowiki>'''. See the [[Wikipedia:Mu...')
- 17:05, 22 Dec 2004 Ahoerstemeier deleted Licab, Nueva Ecija (content was: ''''Bold text'''''Italic text''[[Link title]][http://www.example.com link title]== Headline text ==[[Image:Example.jpg]][[Media:Example.ogg]]<math>In...')
- 17:01, 22 Dec 2004 ContiE deleted Image:Wikipedia googlead.jpg (screenshot I took to show a wikipedia google ad, no longer needed)
- 16:58, 22 Dec 2004 SimonP deleted Mountain bike (prep for move)
- 16:53, 22 Dec 2004 Quadell deleted Image:Elas.png (Listed on IFD since Dec 14)
- 16:53, 22 Dec 2004 Quadell deleted Image:Oxumare2.jpg (Listed on IFD since Dec 14)
- 16:53, 22 Dec 2004 Quadell deleted Image:Color temp.png (Listed on IFD since Dec 14)
- 16:53, 22 Dec 2004 Quadell deleted Image:Alfred Wintle - the last English eccentric (Listed on IFD since Dec 14)
- 16:50, 22 Dec 2004 Rfl deleted Shannon neubauer (comment moved to [[User talk:207.177.95.237]])
- 16:50, 22 Dec 2004 Quadell deleted Image:Wintle2.doc (Listed on ifd since Dec 14)
- 16:48, 22 Dec 2004 Francs2000 deleted Night Riders (content was: 'see also [[The Silent Brigade]]')
- 16:45, 22 Dec 2004 Francs2000 deleted Code point (content was: 'typing')
- 16:42, 22 Dec 2004 Ahoerstemeier deleted Comitatus (Classical meaning) (content was: 'comitatus')
- 16:32, 22 Dec 2004 Kosebamse deleted Titties (content was: 'Everybody loves '''titties'''.{{delete}}')
- 16:29, 22 Dec 2004 Rfl deleted Kevin Defebbo (content was: '{{delete}}Kevin Defebbo is no one of those kidz u want to hang out wit. he is a lazy mother fuckerand has many shoulder problems. Kevin thinks he ...')
- 16:29, 22 Dec 2004 Rfl deleted Nick sucks cock (content was: '{{delete}}It's true. He does.')
- 16:28, 22 Dec 2004 Rfl deleted F net (comments moved to [[User talk:163.153.97.148]])
- 16:27, 22 Dec 2004 Francs2000 deleted User:XXXXXXXXXX (no such user content before blanking was: 'This is a wonderful site and interested in contributing to the community of wikipedia.')
- 16:25, 22 Dec 2004 Francs2000 deleted Titties (content was: 'Everybody loves titties.')
- 16:13, 22 Dec 2004 Francs2000 deleted Kevin defebbo (content was: 'Kevin Defebbo is a bum')
- 16:13, 22 Dec 2004 Francs2000 deleted John The Stutterer (content was: 'I.. I.. I.. I..')
- 16:07, 22 Dec 2004 Niteowlneils deleted ABCD syndrome (content was: '{{delete}}ABCD')
- 15:57, 22 Dec 2004 Violetriga deleted [[:Talk:Category:News]] (silly me trying to do things shortcut - correct place is [[Category talk:News]])
- 15:55, 22 Dec 2004 Ran deleted Talk:Min Nan (remove redirect to move [[Talk:Min Nan language]] back)
- 15:54, 22 Dec 2004 Ran deleted Min Nan (remove redirect to move [[Min Nan language]] back)
- 15:38, 22 Dec 2004 Rfl deleted THEOS (content was: 'hello{{delete}}')
- 15:37, 22 Dec 2004 Rfl deleted Meatie (content was: '{{delete}} Meatie-adj- Having the quality of or pertaining to meat. Meat~noun, Meaty~adjective, Meatissimo~noun Eddie is a beast. ...')
- 15:31, 22 Dec 2004 Niteowlneils deleted The Discworld Companion (content was: '{{delete}}á')
- 15:24, 22 Dec 2004 Francs2000 deleted Gaston Terry (newbie test)
- 15:23, 22 Dec 2004 Francs2000 deleted Maegan (nonsense)
- 15:23, 22 Dec 2004 Francs2000 deleted Amandao (nonsense)
- 15:18, 22 Dec 2004 Francs2000 deleted Image:BernardLortie.JPG (listed on [[WP:PUI]] for more than 30 days)
- 15:18, 22 Dec 2004 Francs2000 deleted Image:JacquesRose.JPG (listed on [[WP:PUI]] for more than 30 days)
- 15:14, 22 Dec 2004 Francs2000 deleted Image:1867.jpg (copyrighted, listed on [[WP:PUI]] for more than 30 days)
- 15:14, 22 Dec 2004 Ram-Man deleted User:Rambot/KeithTyler (content was: '#REDIRECT [[User:KeithTyler|KeithTyler]]')
- 15:14, 22 Dec 2004 Francs2000 deleted Image:Can2002.JPG (copyrighted, listed on [[WP:PUI]] for more than 30 days)
- 15:11, 22 Dec 2004 Francs2000 deleted User:Albinomonkey/TestTemplate (deletion requested by user)
- 15:10, 22 Dec 2004 Francs2000 deleted Lotus Domino (content was: '{{delete}}--[[User:203.144.143.3|203.144.143.3]] 14:50, 22 Dec 2004 (UTC)<nowiki>Insert non-formatted text here</nowiki>[[Image:Example.jpg]][[lsk...')
- 15:10, 22 Dec 2004 Francs2000 deleted Evan Keirnan (content was: '{{db|vandalism}}Evan Kiernan:'I LOVE MYSELF.. AND EVERYONE ELSE LOVES ME TOO!!!' All the LaDiEs want me.. but only a few can have me!')
- 15:09, 22 Dec 2004 Francs2000 deleted Download latex (content was: '{{delete}}klfjld audsfojadlf asdfæ ouiasdofj aladlsfdalkfj dsfasfasdfdasfawr tpgapgfadfasdfasdfdasgfawretrt m wregf')
- 15:09, 22 Dec 2004 Francs2000 deleted Carolyn (nonsense)
- 15:09, 22 Dec 2004 Francs2000 deleted Artemis Project (content was: '{{delete}}Link to the Europa II Workshop Report: [http://www.asi.org/adb/06/09/03/02/110/europa2-wkshp.html]')
- 15:05, 22 Dec 2004 Francs2000 deleted Paris XIII: Paris-Nord (content was: 'hi')
- 14:59, 22 Dec 2004 Ahoerstemeier deleted Finnmark Dagblad (content was: 'Álkjlkjjljljljklkj')
- 14:57, 22 Dec 2004 Ahoerstemeier deleted Drelb (content was: 'Drelb an silly fool, use for describing XP users who should know better (local UK)Also used for someone so incomepted that there can do an job')
- 14:56, 22 Dec 2004 Ahoerstemeier deleted Semantic differential scale (content was: 'gffgfh,mn,nm,,nm,')
- 14:56, 22 Dec 2004 Ahoerstemeier deleted Alternative media (content was: 'wilco and radiotelephony responses')
- 14:55, 22 Dec 2004 Ahoerstemeier deleted Carl Steadman (content was: 'Carl is your pal.')
- 14:55, 22 Dec 2004 Ahoerstemeier deleted Ray Flaherty (content was: ' ray flaherty football player')
- 14:54, 22 Dec 2004 Ahoerstemeier deleted Alpha F1 (content was spam: 'Alpha F1 was a once popular F1 News Website.http://www.alphaf1.com')
- 14:53, 22 Dec 2004 Ahoerstemeier deleted Drelb (content was: 'Drelb an silly fool, use for dececiding XP users who should know better (local UK)')
- 14:49, 22 Dec 2004 Joy Stovall deleted Vji Mephaehi (VFD consensus to delete)
- 14:47, 22 Dec 2004 Ferkelparade deleted Billabong business (content was: '{{delete}}article of billabong business')
- 14:28, 22 Dec 2004 Jdforrester deleted Gimbels (Anon-created redirects to non-existant and badly named article - speedy-delete: content was: '#REDIRECT[[GIMBEL'S]]')
- 13:49, 22 Dec 2004 Francs2000 deleted Chasing Papi (content was: '{{delete}}dfsdfsdfsdf')
- 13:49, 22 Dec 2004 Francs2000 deleted James Stuart, 2nd Earl of Moray (content was: '{{delete}}iohy')
- 13:38, 22 Dec 2004 Rmhermen deleted Limpbizkit (content was: '<math>party up bubba</math>')
- 13:34, 22 Dec 2004 Francs2000 deleted Image:Venice.longshot.350pix.jpg (superceded by larger image)
- 13:34, 22 Dec 2004 Francs2000 deleted Image:Venice.longshot.300pix.jpg (superceded by larger image)
- 13:34, 22 Dec 2004 Ahoerstemeier deleted The Chipmunk Song (content was: 'gfgdfgdfg')
- 13:33, 22 Dec 2004 Ahoerstemeier deleted Ahmed faress (content was: 'hes doing drugs')
- 13:33, 22 Dec 2004 Francs2000 deleted Image:Tufted.duck.arp.250pix.jpg (superceded by larger image)
- 13:31, 22 Dec 2004 Jnc deleted Spaceship (cellular automation) (pr request, redir, typo)
- 13:30, 22 Dec 2004 Francs2000 deleted Image:Smew.both.arp.250pix.jpg (superceded by larger image)
- 13:29, 22 Dec 2004 MacGyverMagic deleted Hotelier (not necessary, result of history merge after move; should contain article about profession; content was: '#REDIRECT [[Hotelier (drama)]]')
- 13:29, 22 Dec 2004 Francs2000 deleted Image:Seurat.jatte.350pix.jpg (superceded by larger image)
- 13:28, 22 Dec 2004 Francs2000 deleted Image:Ruddy.shelduck.arp.250pix.jpg (superceded by larger image)
- 13:27, 22 Dec 2004 Francs2000 deleted Image:Real red african.jpg (superceded by larger image)
- 13:27, 22 Dec 2004 MacGyverMagic restored "Hotelier_(drama)"
- 13:26, 22 Dec 2004 MacGyverMagic deleted Hotelier (drama) (merging histories)
- 13:25, 22 Dec 2004 Jfdwolff deleted Ciclosporin (make room for move to conform naming with INN)
- 13:24, 22 Dec 2004 Francs2000 deleted Image:Onions 350x250.jpg (superceded by larger image)
- 13:24, 22 Dec 2004 Ahoerstemeier deleted La Sierra University (content was: 'la sierra university')
- 13:24, 22 Dec 2004 Francs2000 deleted Image:Panama Canal Locks small.jpg (superceded by larger image)
- 13:23, 22 Dec 2004 Francs2000 deleted Image:Marbled.teal.arp.250pix.jpg (superceded by larger image)
- 13:23, 22 Dec 2004 Francs2000 deleted Image:M13.arp.300pix.jpg (superceded by larger image)
- 13:23, 22 Dec 2004 Francs2000 deleted Image:M101.arp.250pix.jpg (superceded by larger image)
- 13:22, 22 Dec 2004 Francs2000 deleted Image:Luxair.b737.arp.300pix.jpg (superceded by larger image)
- 13:22, 22 Dec 2004 Francs2000 deleted Image:Los Angeles class sub small.jpg (superceded by larger image)
- 13:21, 22 Dec 2004 Francs2000 deleted Image:Local.group.arp.300pix.jpg (superceded by larger image)
- 13:21, 22 Dec 2004 MacGyverMagic deleted Seymour Martin Lipset (content was: '{{delete}}')
- 13:21, 22 Dec 2004 Francs2000 deleted Image:Llanfair.350pix.jpg (superceded by larger image)
- 13:20, 22 Dec 2004 Francs2000 deleted Image:Lightning.inflight.arp.300pix.jpg (superceded by larger image)
- 13:20, 22 Dec 2004 Jnc deleted WP:SB/Hangman (per request, redir, nx-target)
- 13:19, 22 Dec 2004 Francs2000 deleted Image:Lightning.farnb.arp.300pix.jpg (superceded by larger image)
- 13:19, 22 Dec 2004 MacGyverMagic deleted Robert Lindblad (advert; content was: '{{delete}}The psychic who finds missing children Robert Lindblad from Montreal can be contacted via his websitehttp://childsearchpsychic.tripod.com')
- 13:19, 22 Dec 2004 Francs2000 deleted Image:Liffeyeastsmall.jpg (perceded by larger image)
- 13:18, 22 Dec 2004 MacGyverMagic deleted Muwakkals (content was: 'An organism of pure thought. These creatures are hypothesized to exist as memes.{{speedy}}')
- 13:18, 22 Dec 2004 Francs2000 deleted Image:Lifeboat.brixham.300pix.jpg (superceded by larger image)
- 13:18, 22 Dec 2004 Francs2000 deleted Image:Lichen-small.jpg (superceded by larger image)
- 13:17, 22 Dec 2004 Francs2000 deleted Image:Lichen planopilaris thumb.jpg (superceded by larger image)
- 13:17, 22 Dec 2004 Francs2000 deleted Barry Trotter and the Shameless Parody (content was: '{{delete}}Bob was a plumber. A plump and squat plumber. he enjoyed a good bout of jousting and knitting. Sometimes he would dream of being a great jou...')
- 13:16, 22 Dec 2004 Francs2000 deleted Image:Libyaarms999.PNG (no image)
- 13:15, 22 Dec 2004 Francs2000 deleted Image:LibstateparkNASA.jpg (superceded by larger image)
- 13:15, 22 Dec 2004 Francs2000 deleted Image:Libertyskyline.JPG (superceded by larger image)
- 13:15, 22 Dec 2004 Francs2000 deleted Image:Liberia flag small.png (superceded by larger image)
- 13:15, 22 Dec 2004 MacGyverMagic deleted SymbolRecords (content was: '#REDIRECT [[Symbol Records]]')
- 13:14, 22 Dec 2004 Francs2000 deleted Image:Lib-coa.gif (superceded by larger image)
- 13:14, 22 Dec 2004 Francs2000 deleted Image:Lib-coa.PNG (deletion requested by author)
- 13:13, 22 Dec 2004 Francs2000 deleted Image:Lesser.snow.goose.white.arp.300pix.jpg (superceded by larger image)
- 13:12, 22 Dec 2004 Francs2000 deleted Image:Iraqarms333.PNG (missing image)
- 13:11, 22 Dec 2004 MacGyverMagic deleted Lesser Racket-tailed Drongo (content was: '{{delete}} Lesser Racket-tailed Drongo')
- 13:11, 22 Dec 2004 Francs2000 deleted Image:Female Catolaccus grandis wasp thumbnail.jpg (superceded by larger image)
- 13:10, 22 Dec 2004 Francs2000 deleted Image:Elephant.african.250pix.jpg (superceded by larger image)
- 13:10, 22 Dec 2004 Francs2000 deleted Image:DragonDice2.jpg (duplicate of another image)
- 13:09, 22 Dec 2004 Francs2000 deleted Image:Dcastlevs.jpg (superceded by larger image)
- 13:09, 22 Dec 2004 Francs2000 deleted Image:Dcastlecym.jpg (superceded by larger image)
- 13:08, 22 Dec 2004 Francs2000 deleted Image:Blue.angels.350pix.jpg (superceded by larger image)
- 13:08, 22 Dec 2004 Francs2000 deleted Image:Black.brant.arp.250pix.jpg (superceded by larger image)
- 13:07, 22 Dec 2004 Francs2000 deleted Image:Alitalia.a321-112.i-bixd.250pix.jpg (superceded by larger image)
- 13:06, 22 Dec 2004 Francs2000 deleted Image:Agate.banded.350pix.jpg (superceded by larger image)
- 13:05, 22 Dec 2004 Francs2000 deleted Image:African.penguin.bristol.250pix.jpg (superceded by larger image)
- 13:05, 22 Dec 2004 Francs2000 deleted Image:Afr.jpg (superceded by larger image)
- 13:05, 22 Dec 2004 Francs2000 deleted Image:Afr 300.jpg (superceded by larger image)
- 13:04, 22 Dec 2004 Francs2000 deleted Image:Afbeelding Mauritshuis, Den Haag, juni 2003.JPG (deletion requested by uploader)
- 13:04, 22 Dec 2004 Francs2000 deleted Image:Af.a320-211.f-gjve.250pix.jpg (superceded by larger image)
- 13:03, 22 Dec 2004 Francs2000 deleted Image:Aerobatics.riat.200702.stearmans.250pix.jpg (superceded by larger image)
- 13:03, 22 Dec 2004 Francs2000 deleted Image:Aeroarg.a340-200.250pix.jpg (superceded by larger image)
- 13:02, 22 Dec 2004 Francs2000 deleted Image:Adam Gottlob Oehlenschla (superceded by larger image)
- 13:02, 22 Dec 2004 Francs2000 deleted Image:Acupuncture chart 175px.jpg (superceded by larger image)
- 13:01, 22 Dec 2004 Francs2000 deleted Image:Acads.pdf (not an image or media file, nothing to do with wikipedia)
- 13:00, 22 Dec 2004 Francs2000 deleted Image:294628fe.gif (nonsense)
- 12:59, 22 Dec 2004 Francs2000 deleted Image:France.radar.350pix.jpg (superceded by larger image)
- 12:58, 22 Dec 2004 Francs2000 deleted Image:Henry IV of france by pourbous younger small.jpg (superceded by better image)
- 12:55, 22 Dec 2004 Francs2000 deleted INTERACTIVE Systems Corporation (content was: '{{delete}}'''Bold text'''''Italic text''[http://www.example.com link title]== Headline text ==[[Image:Example.jpg]][[Media:Example.ogg]]')
- 12:48, 22 Dec 2004 Francs2000 deleted Category:College Stations Top 40 (content was: '{{delete}}')
- 12:48, 22 Dec 2004 Francs2000 deleted Category:College Stations Playing Top 40 (content was: '{{delete}}')
- 12:40, 22 Dec 2004 Francs2000 deleted Huj (content was: 'Huj eto blja ahuenno pizdataja shtuka !{{delete}}')
- 12:39, 22 Dec 2004 Duncharris deleted Eriochrome Black T Indicator (newbie test)
- 12:39, 22 Dec 2004 Duncharris deleted Patrick Tse (content was: '{{delete}}Patrick Tse, artist, father of Nicholas Tse')
- 12:38, 22 Dec 2004 Duncharris deleted As greedy as a pig (some quote from a film)
- 12:28, 22 Dec 2004 Francs2000 deleted Daniel L.Theuma (content was: '{{delete}}Daniel Theuma (1991-)Daniel Theuma was born on 7th April 1991.He attends San Andrea School and chose Physics, French, Computer Studies ...')
- 12:22, 22 Dec 2004 Francs2000 deleted Thomas Drummond (content was: 'could someone please find a picture of him!')
- 12:17, 22 Dec 2004 Deb deleted HDFC Bank (content was: 'hdfs')
- 12:17, 22 Dec 2004 Deb deleted Packet header (content was: '{{delete}}jjjhkj')
- 12:17, 22 Dec 2004 Deb deleted Ertha Pascal-Trouillot (content was: 'fvxcfgx')
- 12:12, 22 Dec 2004 Zero0000 deleted Phenol Red (content was: '{{delete}}Phenol Red is the world's most liked colorful phenol.It is good for a beautiful life')
- 12:03, 22 Dec 2004 Ahoerstemeier deleted Let's Make Love (content was: 'This is a classic vehicle movie')
- 11:39, 22 Dec 2004 Francs2000 deleted Interzonal Tournament (content was: 'A complete overview of the results for the chess interzonals, as well as the candidate matches can be found at this site: http://www.mark-weeks.com/c...')
- 11:27, 22 Dec 2004 Ahoerstemeier deleted Talk:Teleconference (content were editing experiments)
- 11:22, 22 Dec 2004 Ahoerstemeier deleted Organza (content was: 'pret')
- 11:20, 22 Dec 2004 Francs2000 deleted Schumacher College (deleting for move: page move created by cut & paste)
- 11:11, 22 Dec 2004 SWAdair deleted David Sursely (content was: '{{db|4. Very short articles with little or no context}}David Sursely was born July 11, 1983 in Hood River, Oregon. He was a beautiful baby, and now...')
- 11:10, 22 Dec 2004 Francs2000 deleted Howard Reingold (content was: '[[Smart Mobs]], Virtual Communities author.Once edited [[Whole Earth Catalog]].')
- 11:09, 22 Dec 2004 Francs2000 deleted Ibero-Caucasian peoples (content was: 'Not Jewish{{delete}}')
- 11:09, 22 Dec 2004 Francs2000 deleted DPG (no content content was: 'DPG is the German acronyme for the German Physical Society (' Deutsche Physikalische Geselleschaft').')
- 11:02, 22 Dec 2004 Francs2000 deleted IEEE 802.1Q (content was: 'asdsad')
- 10:46, 22 Dec 2004 VampWillow deleted City and Guilds' of London Institute (unused redirect with spelling error - tidyup of rewrites)
- 10:38, 22 Dec 2004 Ahoerstemeier deleted Soul Basement (content was: '[www.soulbasement.com]')
- 10:17, 22 Dec 2004 MacGyverMagic deleted Svay Pak, Cambodia (content was: '#redirect [[Svay Pak]]' (mistitled))
- 10:13, 22 Dec 2004 MacGyverMagic deleted Petey enterprises (self promotion of non-notable film company, no IMDB content/ content was: 'PeTey Enterprises is a small film company set up in 1999 by Pete Smart and Tom Haig. Their first movie was 'Pete and Tom escape from the Mental Home' ...')
- 10:11, 22 Dec 2004 MacGyverMagic deleted Dadu district (test, content was: '== Headline text ==--[[User:202.84.222.153|202.84.222.153]] 10:09, 22 Dec 2004 (UTC)'''Raja Saeed Ahmed FROM DADU'''{{delete}}')
- 09:58, 22 Dec 2004 SWAdair deleted Talk:Species 8472 (content was: '{{del}}hiphopaustralia dot com')
- 09:58, 22 Dec 2004 SWAdair deleted Sensory overload (content was: 'I have it.{{delete}}')
- 09:57, 22 Dec 2004 SWAdair deleted Hiphopaustralia (content was: '{{del}}i lovfe grtdgb men')
- 09:57, 22 Dec 2004 SWAdair deleted Chinese society (content was: '22dec04{{delete}}')
- 09:57, 22 Dec 2004 SWAdair deleted Antimicrobial peptide (content was: 'Antimicrobial peptide{{delete}}')
- 09:37, 22 Dec 2004 Rbrwr deleted Image:Dhahranmap.PNG (Listed on WP:CP since 10 Dec; {{imagevio|url=http://www.expedia.com/pub/agent.dll?qscr=mmvw&lmap=2&hlbl=0&xofs=-44.444445&yofs=33.333333&clvl=7&msds=EX01C4F8C5B9%2440%24F6%24D2%24B2%242B%24F6%24D2%24B294002%21701000%214%24FF%2150%21Q%24FF0%218%24FF%24150Uemesmo%242C.Fmvuj.Msmdjm%212%24FF70Uemesmo%2412%242C2S%24CCE%243A%2440%24E5%24EC%24F1%248CV%241AJ%2440%24C80001000%214%24FF%24839%2150%212%24FF0000%212%24FF%216i%24EE%243F%2414000%216%24FF%21I0&cbak=1}})
- 09:33, 22 Dec 2004 Rbrwr deleted École Nationale Supérieure d'Électronique, d'Électrotechnique, d'Informatique, d'Hydraulique, et de Télécommunications/Temp (Redundant redirect created by moving /Temp to replace copyvio; content was: '#REDIRECT [[École Nationale Supérieure d'Électronique, d'Électrotechnique, d'Informatique, d'Hydraulique, et de Télécommunications]]')
- 09:31, 22 Dec 2004 MacGyverMagic deleted Category:Lasalle (content was: '{{delete}}' (empty cat))
- 09:30, 22 Dec 2004 Rbrwr deleted Covansys India Limited/Temp (redundant /Temp page after end of copyvio process. content was: '#REDIRECT [[Covansys India Limited]]')
- 09:26, 22 Dec 2004 Rbrwr deleted École Nationale Supérieure d'Électronique, d'Électrotechnique, d'Informatique, d'Hydraulique, et de Télécommunications (Listed on WP:CP snce Dec 7; content was: '{{copyvio|url=http://www.enseeiht.fr/english/index.html?enwho_we_are.html~contenu}}[[User:David Johnson|[[User:David_Johnson|David Johnson]] <nowiki>...')
- 09:25, 22 Dec 2004 Ahoerstemeier deleted True Parent (content was nonsense: 'Facetious title of the Rev. Sun Myung Moon, in claiming his self-appointed godhood.')
- 09:24, 22 Dec 2004 Ahoerstemeier deleted Maausulised (content was no contents: '* External link<br>[http://www.vigalasass.com/eng.html Vigala Sass]')
- 09:24, 22 Dec 2004 Ahoerstemeier deleted North American Numbering Plan Area (content before blanking was : '[htt://www.example.com link title] p')
- 09:23, 22 Dec 2004 Ahoerstemeier deleted Samuel Molyneux (content was: 'little dick with pussy on it')
- 09:20, 22 Dec 2004 SWAdair deleted Your hero (content was: '{{delete}}{{NPOV}}'''your hero''' (b. [[febuary 3]], [[1987]]) is the savier of [[wikipedia]]. He creates articles that no one else dares. he [[pw...')
- 09:19, 22 Dec 2004 Rbrwr deleted Covansys India Limited (Listed on WP:CP since 10 Dec; content was: '{{copyvio|url=http://www.covansys.com/in/welcome.htm}} [[User:Lucky 6.9|Lucky 6.9]] 00:53, 10 Dec 2004 (UTC)')
- 09:19, 22 Dec 2004 SWAdair deleted User:Squash/Contributions (User request)
- 09:18, 22 Dec 2004 SWAdair deleted United States Wikipedia Congress (content was: '{{del}}#REDIRECT[[Wikipedia:Best of BJAODN]]')
- 09:18, 22 Dec 2004 SWAdair deleted United States Vandalist Party (content was: '{{del}}#REDIRECT[[Wikipedia:Best of BJAODN#United States Vandalist Party]]')
- 09:16, 22 Dec 2004 SWAdair deleted Tomoki (content was: '{{del}}Tomoki. Real Name: T-mokes. Attends High School. Other names: Pjokes, Smokes, Smokey, Pjoko, Tooki, Pjoki, Tomoggoats.')
- 09:16, 22 Dec 2004 SWAdair deleted The Copenhagen Business School (content was: '{{nonsense}}dear sir my name is zafar ali and i belong to mardan city NWFP pakistan i m found to study in ur college for more education at the mo...')
- 09:16, 22 Dec 2004 SWAdair deleted Talk:Mark Calaway (content was: '{{del}}yadda yadda yadda')
- 09:15, 22 Dec 2004 Academic Challenger deleted Agia Roumeli (content was: 'your MOTHER CUKER ILL FUCK YOU LITTLE ASS AND PEE ON IT GET LOST HOMO FUCKER')
- 09:15, 22 Dec 2004 SWAdair deleted Talk:CNNBCBS (Talk page of an already-deleted article)
- 09:14, 22 Dec 2004 SWAdair deleted Smithing (content was: '{{delete}}hi can uget my smithing up ???')
- 09:13, 22 Dec 2004 SWAdair deleted Ryan Quiring (content was: '{{delete}}Hot and 20.')
- 09:13, 22 Dec 2004 Academic Challenger deleted The World of Soap Themes (content was: 'Zxc{{delete}}')
- 09:13, 22 Dec 2004 SWAdair deleted Maghreb French (content was: '{{Delete}}its sooooooooo drunk')
- 09:12, 22 Dec 2004 SWAdair deleted Javan Surili (content was: '[[su:Surili]]{{db|null}}')
- 09:12, 22 Dec 2004 SWAdair deleted Bretton Woods Institution (content was: 'proxy wars of harry potter{{nonsense}}')
- 09:11, 22 Dec 2004 Academic Challenger deleted Jennie (content was: '{{deletebecause|It is a vanity page.}}derived from the pig latin root 'Enniejay'Often relates to red hair and Presbyterian background.Symptoms i...')
- 09:09, 22 Dec 2004 Academic Challenger deleted Security testing (content was: 'security testing{{delete}}')
- 09:08, 22 Dec 2004 Academic Challenger deleted Lee Blackburn ((Patent nonsense))
- 09:07, 22 Dec 2004 Academic Challenger deleted Lee Black-Burn ((patent nonsense))
- 09:04, 22 Dec 2004 Academic Challenger deleted Prva stavebna sporitelna (content was: 'Prva stavebna sporitelna{{delete}}')
- 09:01, 22 Dec 2004 Academic Challenger deleted Paul Schaefer (content was: 'dick{{delete}}')
- 08:51, 22 Dec 2004 Jfdwolff deleted Staging (make room to move the disambig here)
- 08:45, 22 Dec 2004 Morven deleted Talk:Live axle (content was: 'hgmghm')
- 08:12, 22 Dec 2004 Ambi deleted The Micallef Program (content was: 'The Micallef Program was a combination of characters, studio sketches and location sketches. Although Shaun hosted the show, he also played a lot of c...')
- 08:12, 22 Dec 2004 Gadfium deleted Firas Imeil (content was: '{{delete}}5')
- 07:44, 22 Dec 2004 Slowking Man deleted Jennie (content was: 'derived from the pig latin word 'Enniejay'Usually relates to redhair and having presbyterian roots.Sometimes the symptoms include spurts of enthus...')
- 07:42, 22 Dec 2004 Slowking Man deleted Randerzander (content was: '{{delete}}Randerzander is the most awesome screen name in the history of the universe.It is on parallel with cute fuzzy puppy kitten.Roughly tra...')
- 07:37, 22 Dec 2004 Gadfium deleted Butt Nuke (content was: '{{delete}}A totally asinine suggestion for a band name. Also see ''Ben Martie Douchebag''')
- 07:37, 22 Dec 2004 Gadfium deleted BONZI Software (content was: '{{nonsense}} djhgvdgvdhvjdshvjdshvdbvvd d dsvjsdbvj dsjh dsjgbh sbhjsd bvjsdbgv jdsbhjdsh jvkdsh vjkbhd vjkhsfdjd hvjhdsvj')
- 07:20, 22 Dec 2004 Wile E. Heresiarch deleted Image:Barry ethridge.jpg (image used only in deleted vanity article [[Barry Ethridge]])
- 07:19, 22 Dec 2004 Wile E. Heresiarch deleted H. Kerem Kadayifcioglu (per vfd; see: [[Wikipedia:Votes for deletion/KeremKadayifcioglu]])
- 07:19, 22 Dec 2004 Wile E. Heresiarch deleted Shahram Ghane (per vfd; see: [[Wikipedia:Votes for deletion/Shahram Ghane]])
- 07:18, 22 Dec 2004 Wile E. Heresiarch deleted Bery (per vfd; see: [[Wikipedia:Votes for deletion/Bery]])
- 07:15, 22 Dec 2004 Wile E. Heresiarch deleted Baltic Squid (per vfd; see: [[Wikipedia:Votes for deletion/Baltic Squid]])
- 07:15, 22 Dec 2004 Wile E. Heresiarch deleted KeremKadayifcioglu (per vfd; see: [[Wikipedia:Votes for deletion/KeremKadayifcioglu]])
- 07:13, 22 Dec 2004 Wile E. Heresiarch deleted The haven (per vfd; see: [[Wikipedia:Votes for deletion/The haven]])
- 07:13, 22 Dec 2004 Wile E. Heresiarch deleted Barry Ethridge (per vfd; see: [[Wikipedia:Votes for deletion/Barry Ethridge]])
- 07:11, 22 Dec 2004 Wile E. Heresiarch deleted 21 (band) (per vfd; see: [[Wikipedia:Votes for deletion/21 (band)]])
- 07:06, 22 Dec 2004 Wile E. Heresiarch deleted Chocolate stars (per vfd; see: [[Wikipedia:Votes for deletion/Chocolate stars]])
- 07:05, 22 Dec 2004 Wile E. Heresiarch deleted Withitness (per vfd; see: [[Wikipedia:Votes for deletion/Withitness]])
- 07:00, 22 Dec 2004 Neutrality deleted Butt Nuke (content was: 'A totally asinine suggestion for a band name. Also see ''Italic text''Ben Martie Douchebag''Italic text''')
- 06:58, 22 Dec 2004 Neutrality deleted George Huntington (content was: ''''George Huntington''', first described [[Huntington's disease]], a hereditary disorder in [[1872]].')
- 06:50, 22 Dec 2004 Charles Matthews deleted Deepen shah (content was: '{{delete}}goes to nyu')
- 06:02, 22 Dec 2004 Stan Shebs deleted Code Adrian (content before blanking was: 'Computer generated short movie series. They follow the exploits of Bill Clinton as he saves the United States from doom each time it enters a Code Adr...')
- 05:45, 22 Dec 2004 Mirv deleted Brownia (content was: '{{delete}}')
- 05:43, 22 Dec 2004 Mirv deleted Brownia (content was: '{{delete}}')
- 05:39, 22 Dec 2004 Cyrius deleted Brownia
- 05:28, 22 Dec 2004 Arminius deleted Wikipedia Congress (content was: '{{del}}#REDIRECT[[Wikipedia:Best of BJAODN]]')
- 05:27, 22 Dec 2004 Arminius deleted Wikipedia talk:Best of BJAODN (content was: ''''''This is fun!'''''')
- 05:23, 22 Dec 2004 Arminius deleted World Wikipedia Congress (content was: '{{del}}#REDIRECT[[Wikipedia:Best of BJAODN#United States Vandalist Party]]')
- 05:20, 22 Dec 2004 Rossami restored "NicoustiE"
- 05:19, 22 Dec 2004 Arminius deleted CNNBCBS (content was: '{{del}}#REDIRECT[[Wikipedia:Best of BJAODN#CNNBCBS]]')
- 05:13, 22 Dec 2004 Arminius deleted Vandalist (content was: '#REDIRECT[[Wikipedia:Best of BJAODN#Vandalist]]')
- 05:08, 22 Dec 2004 Fennec deleted Vandalist (content was: '#REDIRECT[[Wikipedia:Best of BJAODN#Vandalist]]')
- 05:07, 22 Dec 2004 SWAdair deleted North River (Saint Louis) (content was: '{{deletebecause| entire content 'North river is a long river in States.'; no further history of content}}North river is a long river in States.')
- 05:07, 22 Dec 2004 SWAdair deleted List of companies traded on the TSX (content was: '{{del}}PENGROVE ENERGY')
- 05:06, 22 Dec 2004 SWAdair deleted Joseph Perkins (content was: '{{del}}Me ;) i rule!!!')
- 05:06, 22 Dec 2004 SWAdair deleted Guildford Cathedral Choir (content was: '{{del}}Tom Felton was offered a part in this choir! Nothing more is written here about this choir')
- 04:58, 22 Dec 2004 Niteowlneils deleted Modern Europe (content was: '{{del}}Modern Europe is very much like')
- 04:57, 22 Dec 2004 Rmhermen deleted Pete loeffler (content was: '{{delete}}Pete Loeffler')
- 04:38, 22 Dec 2004 Rfl deleted Cross sex position (content was: '{{delete}}Sex in the city')
- 04:38, 22 Dec 2004 Gadfium deleted Wikipedia:Sandbox/Hangman (Sandbox game, appears to be over.)
- 04:36, 22 Dec 2004 SWAdair deleted Zimbabwe history timeline (content was: '{{deletebecause|Total lack of content; possible vandal bot entry}}Zimbabwe encountered severe starvation in the mid 1970's and 1980's')
- 04:36, 22 Dec 2004 Gadfium deleted User talk:Dbenbenn/Sodium vapour lamp (Talk page of article deleted by user request.)
- 04:36, 22 Dec 2004 Niteowlneils deleted Image:Tree-in-chile-original-low-quality.jpg (unused image, user req, uploaded for temp use only)
- 04:36, 22 Dec 2004 SWAdair deleted User:Dbenbenn/Sodium vapour lamp (User request)
- 04:33, 22 Dec 2004 Niteowlneils deleted Watch Your Mouth (content was: '{{db|empty page}}')
- 04:33, 22 Dec 2004 SWAdair deleted This Comic Sucks (content was: '{{deletebecause|Wikipedia is not a web guide}}A 'real life' comic found at www.thiscomicsucks.com. Laugh at the crazy situations that befall Wayne,...')
- 04:33, 22 Dec 2004 SWAdair deleted Speedstream (content was: '{{del}}Speedstream is a DSL modem.')
- 04:33, 22 Dec 2004 Jnc deleted MediaWiki:Martial arts project (pr request, redir)
- 04:32, 22 Dec 2004 Niteowlneils deleted User talk:Squash/Full (content was: '{{speedy}}#redirect [[User talk:Squash]]')
- 04:31, 22 Dec 2004 Jnc deleted MediaWiki:Martialartsproject (pr request, redir)
- 04:30, 22 Dec 2004 Rdsmith4 deleted Locally linear embedding (content was: '[http://www.cs.toronto.edu/~roweis/lle/ LLE]{{substub}}')
- 04:28, 22 Dec 2004 SWAdair deleted Edder (content was: '{{delete}}Edder is short for Edwin which is derived from the name Edward.')
- 04:27, 22 Dec 2004 Jnc deleted Template:Martial arts project (pr request, redir)
- 04:27, 22 Dec 2004 SWAdair deleted Chrisallan (content was: '{{del}}Mage sucks because he won't tell me his plans for dexfs.')
- 04:26, 22 Dec 2004 SWAdair deleted Beginning (content was: '{{deletebecause|Nonsense}}What happened first:* the [[beginning]] of [[everything]]<br>or<br>* the [[first cause]]?')
- 04:16, 22 Dec 2004 Gadfium deleted Palmnet (content was: '{{nonsense}}palmnet = a really cool website owned by nick palmer, a cool person. if you dont agree look at urbandictionary.com under palmnet for fur...')
- 04:16, 22 Dec 2004 Gadfium deleted PalmNet reffering to www.palmnet.me.uk 0wn3d (content was: '{{nonsense}}palmnet = a really cool website owned by nick palmer, a cool person.if you dont agree look at urbandictionary.com under palmnet for fur...')
- 04:15, 22 Dec 2004 Jnc deleted Melbe Peach (pr request, redir, typo)
- 04:08, 22 Dec 2004 Gadfium deleted Matáv (content was: '{{del}}Magyar távközlési részvénytársaság http://www.matav.hu')
- 04:03, 22 Dec 2004 SimonP deleted Image:Calixa Lavallée.jpg (duplicate)
- 04:02, 22 Dec 2004 Niteowlneils deleted Cinema Camera Club (content was: '{{del}}')
- 04:02, 22 Dec 2004 Niteowlneils deleted College stations (content was: '[[Category:Radio]]{{db|still no content}}')
- 04:02, 22 Dec 2004 Niteowlneils deleted Talk:College stations (content was: 'You may delete this page')
- 04:00, 22 Dec 2004 Gadfium deleted Lucerne (milk) (content was: 'Lucerne is a very yummy kind of milk.{{delete}}')
- 04:00, 22 Dec 2004 Gadfium deleted Image:Yellowjacket 300px.jpg (obsolete thumb)
- 03:58, 22 Dec 2004 Hemanshu deleted Ryzahacas,lv.vgy.z (nonsense)
- 03:17, 22 Dec 2004 Theresa knott deleted Sam Keeley (content was: '[[Image:http://www.2600hq.com/.jpg]]')
- 03:17, 22 Dec 2004 Adam Bishop deleted Megathumpzilla (content was: 'Loyal pounder who enjoys pounding Gayglo's cornhole.{{delete}}')
- 03:16, 22 Dec 2004 Theresa knott deleted Punta del Este (content was: '{{deletebecause|No actual content was harmed in the making of this stub}}punta del este')
- 03:05, 22 Dec 2004 Theresa knott deleted Butt face (content was: 'The buttface was derived from the middle ages when people actually had butts on their faces.')
- 03:04, 22 Dec 2004 Jpgordon deleted Thomas Belulovich
- 03:03, 22 Dec 2004 Theresa knott deleted Tivoli Systems (content was: 'Thi is a test page for the use of Tivoli.')
- 03:02, 22 Dec 2004 Theresa knott deleted Sisi is hot! (garbage)
- 02:52, 22 Dec 2004 Quadell deleted Image:Sctewels.JPG (Outstanding unfree image problem after 30 days)
- 02:49, 22 Dec 2004 Niteowlneils deleted Ben lariv (content was: 'ben is a guy who likes stuff. he has a girl friend named allison coleman. he likes her')
- 02:49, 22 Dec 2004 Niteowlneils deleted Talk:Ben lariv (content was: 'I do npt loike mr ben')
- 02:49, 22 Dec 2004 Jdforrester deleted Megathumpzilla (Speedy nonsense. content was: 'Loyal pounderwho enjoys pounding Gayglo's cornhole.')
- 02:48, 22 Dec 2004 Niteowlneils deleted Target Vistula (content was: '{{db|no content}}Target Vistula.')
- 02:48, 22 Dec 2004 Niteowlneils deleted Rican411 (content was: 'A dumb Titoholic and Ruizsexual. Complete assclown, hated by majority of the Dog Pound. Especially Body Hugger.{{delete}}')
- 02:47, 22 Dec 2004 Niteowlneils deleted Tom Lane (content was: '{{nonsense}}== ''''Tom Lane'''' ==A German slang expression meaning, 'Goofy Fucker'')
- 02:47, 22 Dec 2004 Niteowlneils deleted Eleusinian Relief (content was: '{{db|Wikipedia is [[WP:WWIN|not]] an image gallery.}}<center>[[Image:http://www.metmuseum.org/toah/images/h2/h2_14.130.9.jpg|framed|none|Eleusinian R...')
- 02:46, 22 Dec 2004 Niteowlneils deleted Drakon Empire (content was: 'É[[Media:''[[Example.]]''ogg]]<math>Insert formula here</math><nowiki>Insert non-formatted text here</nowiki>{{db|gibberish}}')
- 02:46, 22 Dec 2004 Niteowlneils deleted 2004 efnet mensa straightTalk (content was: 'straight from efnet #mensa{{delete}}')
- 02:46, 22 Dec 2004 Rfl deleted Payette River (comment moved to [[User:140.247.226.188]])
- 02:35, 22 Dec 2004 Jdforrester deleted Metaru Sonikku (Speedy, nonsense.)
- 02:26, 22 Dec 2004 Niteowlneils deleted College stations (content was: 'College Stations')
- 02:25, 22 Dec 2004 Jdforrester deleted Talk:Grand Theft Auto Advance (Nonsense (speedy candidate).)
- 01:49, 22 Dec 2004 Rfl deleted Crack (password cracker) (content was: '{{delete}}Hi i don't know what this does but im trying it anyway')
- 01:32, 22 Dec 2004 Niteowlneils deleted George Washington Memorial Parkway (content was: '{{nonsense}}'''Bold text'''------[[User:192.100.51.131|192.100.51.131]] 00:26, 22 Dec 2004 (UTC)<nowiki>Insert non-formatted text here</nowiki>')
- 01:31, 22 Dec 2004 Niteowlneils deleted A List Apart (content was: '{{delete}}Custom 404')
- 01:31, 22 Dec 2004 Niteowlneils deleted Descending colon (content was: '{{delete}}descending colon')
- 01:21, 22 Dec 2004 Academic Challenger deleted Carl Steadman (content was: '{{delete}}Carl is your pal.')
- 01:20, 22 Dec 2004 Gadfium deleted Category:Pages with accuracy disputes (content was: '{{db|empty, duplicate of [[:Category:Accuracy disputes]].}}[[Category:Wikipedia maintenance]]')
- 01:19, 22 Dec 2004 Gadfium deleted Category:U.S. geography stubs (content was: '{{deletebecause|duplicate category}}')
- 01:19, 22 Dec 2004 Gadfium deleted Category:South Korean culture (content was: '{{deletebecause|empty duplicate of [[:Category:Korean culture]]}}')
- 01:16, 22 Dec 2004 Gadfium deleted Image:V838mon hst dec.jpg (obsolete thumb)
- 01:15, 22 Dec 2004 Gadfium deleted Image:Uwe.bristol.second.300pix.jpg (obsolete thumb)
- 01:15, 22 Dec 2004 Gadfium deleted Image:Uwe.bristol.300pix.jpg (obsolete thumb)
- 01:15, 22 Dec 2004 Gadfium deleted Image:Uup-TableImage.png (obsolete thumb)
- 01:14, 22 Dec 2004 Gadfium deleted Image:Tern.inca.bristol.300pix.jpg (obsolete thumb)
- 01:14, 22 Dec 2004 Gadfium deleted Image:Templeofrosycrosssmall.png (obsolete thumb)
- 01:13, 22 Dec 2004 Gadfium deleted Image:Temple of the Warriors s.jpg (obsolete thumb)
- 01:13, 22 Dec 2004 Neutrality deleted Frank Jacobs (content was: 'what ever happened to Bum Farta')
- 01:13, 22 Dec 2004 Gadfium deleted Image:Temple mount small.jpg (obsolete thumb)
- 01:12, 22 Dec 2004 Gadfium deleted Image:Temple Laie reduced.jpg (obsolete thumb)
- 01:12, 22 Dec 2004 Francs2000 deleted Ultima684 (content was: '{{delete}}A highly intelligent individul!')
- 01:11, 22 Dec 2004 Gadfium deleted Image:Scoria field at Craters of the Moon NM-300px.JPG (obsolete thumb)
- 01:11, 22 Dec 2004 Francs2000 deleted Talk:Bastard on Wheels (content was: '{{delete}}A bastard on wheels is an ugly car on FUCKING BASTARDS BLOODY MOTHERFUCKING BASTARD FOR PISSING IN MY FUCKING GRANNYS FLOWERPOTS FUCKING BL...')
- 01:11, 22 Dec 2004 Adam Bishop deleted Bastard on Wheels (content was: '{{delete}}A bastard on wheels is an ugly car on FUCKING BASTARDS BLOODY MOTHERFUCKING BASTARD FOR PISSING IN MY FUCKING GRANNYS FLOWERPOTS FUCKING BL...')
- 01:11, 22 Dec 2004 Gadfium deleted Image:Scissortailedfly250.JPG (obsolete thumb)
- 01:11, 22 Dec 2004 Gadfium deleted Image:Schwerin.jpg (Lower-quality duplicate)
- 01:10, 22 Dec 2004 Gadfium deleted Image:SNES 400.jpg (obsolete thumb)
- 01:06, 22 Dec 2004 Gadfium deleted Image:SIM card.jpg (obsolete thumb)
- 01:05, 22 Dec 2004 Gadfium deleted Image:SAJV cast small.jpg (obsolete thumb)
- 01:05, 22 Dec 2004 Gadfium deleted Image:S28 250-smallversionformainpage.jpg (obsolete thumb)
- 01:04, 22 Dec 2004 Gadfium deleted Image:Rzeczpospolita Obojga Narodow small.png (obsolete thumb)
- 01:04, 22 Dec 2004 Elf deleted Talk:Dog sled (content was: 'hello')
- 01:04, 22 Dec 2004 Gadfium deleted Image:Royal grammar school worcester crest.doc (Not an image)
- 01:01, 22 Dec 2004 Gadfium deleted Image:Plantarkerasosis-01.jpg (misspelled name, image has been re-uploaded with correct name.)
- 01:00, 22 Dec 2004 Gadfium deleted Image:Lesser.snow.goose.blue.arp.250pix.jpg (obsolete thumb)
- 00:59, 22 Dec 2004 Gadfium deleted Image:Lesser.scaup.arp.500pix.jpg (obsolete thumb)
- 00:59, 22 Dec 2004 Gadfium deleted Image:Lenorekitty.jpg (Replaced by more-free image)
- 00:58, 22 Dec 2004 Gadfium deleted Image:Large.mc.arp.300pix.jpg (obsolete thumb)
- 00:58, 22 Dec 2004 Gadfium deleted Image:Laptop.arp.300pix.jpg (obsolete thumb)
- 00:57, 22 Dec 2004 Gadfium deleted Image:Fermat curve.gif (Replaced by commons image)
- 00:55, 22 Dec 2004 Gadfium deleted Image:Euc.uk.250pix.jpg (obsolete thumb)
- 00:55, 22 Dec 2004 Gadfium deleted Image:Equisetoid twigs reduced.jpg (obsolete thumb)
- 00:55, 22 Dec 2004 Gadfium deleted Image:Ecliptic.arp.300pix.jpg (obsolete thumb)
- 00:54, 22 Dec 2004 Gadfium deleted Image:Eagle.owl.arp.600pix.jpg (obsolete thumb)
- 00:54, 22 Dec 2004 Gadfium deleted Image:Eagle.column1.arp.300pix.jpg (obsolete thumb)
- 00:51, 22 Dec 2004 Gadfium deleted Image:Drcongomap.jpg (JPG replaced by PNG)
- 00:51, 22 Dec 2004 Gadfium deleted Image:Destroyer.arp.250pix.jpg (obsolete thumb)
- 00:51, 22 Dec 2004 Gadfium deleted Image:Dark.neb.arp.300pix.jpg (obsolete thumb)
- 00:50, 22 Dec 2004 Gadfium deleted Image:Cyprus.arp.400pix.jpg (obsolete thumb)
- 00:50, 22 Dec 2004 Gadfium deleted Image:Coscoroba.swan.arp.300pix.jpg (obsolete thumb)
- 00:49, 22 Dec 2004 Gadfium deleted Image:Coscoroba.swan.arp.2.250pix.jpg (obsolete thumb)
- 00:49, 22 Dec 2004 Gadfium deleted Image:Coot.feb04.arp.300pix.jpg (obsolete thumb)
- 00:49, 22 Dec 2004 Gadfium deleted Image:Coot.arp.300pix.jpg (broken obsolete thumb)
- 00:48, 22 Dec 2004 Gadfium deleted Image:Conwy.castle.arp.300pix.jpg (obsolete thumb)
- 00:47, 22 Dec 2004 Gadfium deleted Image:Common.goldeneye.arp.250pix.jpg (obsolete thumb)
- 00:47, 22 Dec 2004 Gadfium deleted Image:Comoros.jpg (obsolete thumb)
- 00:45, 22 Dec 2004 Gadfium deleted Image:Common.eider.juv.arp.300pix.jpg (obsolete thumb)
- 00:45, 22 Dec 2004 Gadfium deleted Image:Comet.1964.arp.300pix.jpg (obsolete thumb)
- 00:45, 22 Dec 2004 Gadfium deleted Image:Clifton.bridge.arp.300pix.jpg (obsolete thumb)
- 00:44, 22 Dec 2004 Gadfium deleted Image:Christmas.house.arp.300pix.jpg (obsolete thumb)
- 00:44, 22 Dec 2004 Gadfium deleted Image:Chinese tea utensils small3.jpg (obsolete thumb)
- 00:44, 22 Dec 2004 Gadfium deleted Image:Chinese tea utensils small2.jpg (obsolete thumb)
- 00:43, 22 Dec 2004 Gadfium deleted Image:Chinese tea utensils small1.jpg (obsolete thumb)
- 00:43, 22 Dec 2004 Gadfium deleted Image:Chillon.castle.arp.300pix.jpg (obsolete thumb)
- 00:41, 22 Dec 2004 Gadfium deleted Image:Cheddar.arp.300pix.jpg (obsolete thumb)
- 00:41, 22 Dec 2004 Gadfium deleted Image:Cheddar.arp.250pix.jpg (obsolete thumb)
- 00:41, 22 Dec 2004 Gadfium deleted Image:Chateau.dif.arp.300pix.jpg (obsolete thumb)
- 00:41, 22 Dec 2004 Gadfium deleted Image:Carvair.arp.300pix.jpg (obsolete thumb)
- 00:41, 22 Dec 2004 Niteowlneils deleted Texas Theater (content was: '{{deletebecause|spam}}'''== Headline text ==texas theater'''[[Image:Example.jpg]]the place blows')
- 00:40, 22 Dec 2004 Gadfium deleted Image:Cartwheel.galaxy.arp.300pix.jpg (obsolete thumb)
- 00:40, 22 Dec 2004 Gadfium deleted Image:Carrier.arp.250pix.jpg (obsolete thumb)
- 00:39, 22 Dec 2004 Gadfium deleted Image:Cape.teal.arp.250pix.jpg (obsolete thumb)
- 00:39, 22 Dec 2004 Gadfium deleted Image:Cape.barren.arp.250pix.jpg (obsolete thumb)
- 00:38, 22 Dec 2004 Gadfium deleted Image:Cambrian.viscount.arp.300pix.jpg (obsolete thumb)
- 00:34, 22 Dec 2004 Gadfium deleted Image:Brocken.spectre.arp.300pix.jpg (obsolete thumb)
- 00:34, 22 Dec 2004 Gadfium deleted Image:Britannia.plan.arp.300pix.jpg (obsolete thumb)
- 00:34, 22 Dec 2004 TUF-KAT deleted Classical pantheist (content was: '{{deletebecause|duplicate of [[Cosmotheism]]}}')
- 00:33, 22 Dec 2004 Gadfium deleted Image:Britannia.arp.300pix.jpg (obsolete thumb)
- 00:33, 22 Dec 2004 Gadfium deleted Image:Bison near a hot spring in Yellowstone-300px.JPG (obsolete thumb)
- 00:32, 22 Dec 2004 Gadfium deleted Image:Birth of Venus (Cabanel).jpg (obsolete thumb)
- 00:32, 22 Dec 2004 Gadfium deleted Image:Birmingham (UK) skyline - Centenary Square 410.jpg (obsolete thumb)
- 00:31, 22 Dec 2004 Gadfium deleted Image:Bighorncanyonnps.jpg (obsolete)
- 00:31, 22 Dec 2004 Gadfium deleted Image:Big Southern Butte at Craters of the Moon NM-300px.JPG (obsolete thumb)
- 00:30, 22 Dec 2004 Gadfium deleted Image:Bialowiezabuilding.jpg (obsolete thumb)
- 00:28, 22 Dec 2004 Gadfium deleted Image:Biala Podlaska voivodship 1975.png (obsolete thumb)
- 00:28, 22 Dec 2004 Gadfium deleted Image:Bgregions2.png (obsolete thumb)
- 00:27, 22 Dec 2004 Gadfium deleted Image:Bethanachol.png (Misspelled image name)
- 00:27, 22 Dec 2004 Gadfium deleted Image:Berlin-brandenburg-gate-small.jpg (obsolete thumb)
- 00:26, 22 Dec 2004 Gadfium deleted Image:Belvedere.arp.300pix.jpg (obsolete thumb)
- 00:26, 22 Dec 2004 Gadfium deleted Image:Bellini.doge.250pix.jpg (obsolete thumb)
- 00:26, 22 Dec 2004 Gadfium deleted Image:Beech.bonanza.arp.300pix.jpg (obsolete thumb)
- 00:25, 22 Dec 2004 Gadfium deleted Image:Bathtub Curve.png (Request by uploader)
- 00:25, 22 Dec 2004 Gadfium deleted Image:Barnstaple.clocktower.arp.400pix.jpg (obsolete thumb)
- 00:23, 22 Dec 2004 Niteowlneils deleted Association of World Citizens (content was: '{{deletebecause|emptypage}}')
- 00:17, 22 Dec 2004 Rfl deleted Scott Fluhrer (content was: '{{delete}}What a great Guy')
- 00:14, 22 Dec 2004 Flockmeal deleted Itsik Mantin (content was: 'I've got nothing to say')
- 00:02, 22 Dec 2004 Niteowlneils deleted Niclam (content was: '{{del}}This is a test created by me (niclam) to test the wikipedia search on trillian 3 (yes, i had free time at the.. erhmm, time :))')
- 00:01, 22 Dec 2004 Niteowlneils deleted Talk:Bob off Teachers (content was: '{{del}}')
- 00:00, 22 Dec 2004 Niteowlneils deleted Handheld PC (content was: '{{deletebecause|patent nonsense}}гттггщкс')
- 23:55, 21 Dec 2004 Gadfium deleted Mauron Schillib (content was: 'Muppet')
- 23:53, 21 Dec 2004 Maury Markowitz deleted "street team" (unneeded redirect)
- 23:49, 21 Dec 2004 Rdsmith4 deleted User:Rdsmith4/Repository (starting over)
- 23:48, 21 Dec 2004 SimonP deleted 4th Line Road (content was: '{{delete}}oh my what a road')
- 23:48, 21 Dec 2004 SimonP deleted Huj (content was: 'Huj eto blja pizdec kakaja ahuitel'naja shtuka !')
- 23:46, 21 Dec 2004 Andrevan deleted Image:Hello.jpg
- 23:46, 21 Dec 2004 Andrevan restored "Image:Hello.jpg"
- 23:46, 21 Dec 2004 SimonP deleted Pissflaps (content was: '{{deletebecause|nonsense}}Pissflaps is back.You know - it'll never go away.')
- 23:46, 21 Dec 2004 Andrevan deleted Image:Hello.jpg (goatse)
- 23:45, 21 Dec 2004 SimonP deleted Bob off Teachers (content was: '{{del}}How many times will he say FUCK!')
- 23:43, 21 Dec 2004 SimonP deleted North Sydney, Nova Scotia (content was: '{{del}}}sydney nova scotia')
- 23:28, 21 Dec 2004 TUF-KAT deleted Stupid fucking blondes (content was: '{{deletebecause|nonsense}}The database did not find the text of a pagethat it should have found, named 'Stupid fucking blondes,oldid=8694510'.<p>...')
- 23:28, 21 Dec 2004 Neutrality deleted Ordre Martiniste et Synarchique (content was: '{{cleanup}}The Martinist Synarchique Order is probably the most esoteric and authentic Martinist Order')
- 23:27, 21 Dec 2004 Rfl deleted Midnight in the garden of good and evil (content was: '{{delete}}Shitty Movie.Might have a homosexual in it.')
- 22:54, 21 Dec 2004 Rbrwr deleted Todd staples (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=http://www.toddstaples.com/biography.php}}[[User:David Johnson|[[User:David_Johnson|David Johnson]] <nowiki>[</nowiki>[[User_talk:David...')
- 22:53, 21 Dec 2004 Rbrwr deleted Almond roca (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=https://www.brown-haley.com/almond.cfm}}')
- 22:50, 21 Dec 2004 Rbrwr deleted Shyne (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=http://www.vh1.com/artists/az/digital_underground/bio.jhtml}}')
- 22:47, 21 Dec 2004 Niteowlneils deleted Tcforums (content was: '{{del}}8')
- 22:47, 21 Dec 2004 Niteowlneils deleted Manny dimatulac (content was: '{{del}}Woohoo! I'm on Wikipedia!(I know, I know, you can delete this, sorry!)')
- 22:46, 21 Dec 2004 Niteowlneils deleted KlogMS (content was: 'prueba de un rdf'''Bold text'''''Italic text''[[Link title]][http://www.example.com link title]== Headline text =={{del}}')
- 22:46, 21 Dec 2004 Niteowlneils deleted Jason Kim (content was: '{{del}}blah...')
- 22:45, 21 Dec 2004 Niteowlneils deleted Coleco Telstar (content was: '{{delete}}Go to http://www.pong-story.com/coleco.htm')
- 22:45, 21 Dec 2004 Niteowlneils deleted Fanta language ghana (content was: 'Kobina,Merry Christmas!How is everything going? I hope all is well and you are in good health.During the holiday season I think of you.My you...')
- 22:45, 21 Dec 2004 Niteowlneils deleted 8th Line Road (content was: 'it is a gay road{{delete}}')
- 22:43, 21 Dec 2004 Ahoerstemeier deleted Final Fight CD (content was: 'Final Fight CD page')
- 22:42, 21 Dec 2004 Ahoerstemeier deleted Turkish female singers (content was: 'Turkish Female Singers')
- 22:40, 21 Dec 2004 Aranel deleted Category:Olympic athletes (delete per cfd)
- 22:40, 21 Dec 2004 Aranel deleted Category talk:Olympic athletes (deleted per cfd)
- 22:39, 21 Dec 2004 UtherSRG deleted Serial comma (content was: '#redirect [[Oxford comma]]')
- 22:23, 21 Dec 2004 Jiang deleted User:Jiang/Draft (subpage)
- 22:20, 21 Dec 2004 Rmhermen deleted Ender's Game (movie) (content was: '{{deletebecause|nonsense/no content}}'''Bold text'''Yo')
- 22:16, 21 Dec 2004 Rbrwr deleted House Rabbit Society of Australia Inc. (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=http://members.iinet.net.au/~rabbit/hrsaus.htm}}')
- 22:16, 21 Dec 2004 Jnc deleted Wikipedia:Administrator's noticeboard/Navbox (redir, re-organizing)
- 22:16, 21 Dec 2004 Rbrwr deleted Talk:House Rabbit Society of Australia Inc. (Talk page of deleted copyvio; contained non-encyclopedic material removed from article)
- 22:15, 21 Dec 2004 Jnc deleted Wikipedia:Administrator's noticeboard/Archive2 (redir, re-organizing)
- 22:14, 21 Dec 2004 Jnc deleted Wikipedia:Administrator's noticeboard/Archive1 (redir, re-organizing)
- 22:10, 21 Dec 2004 Rbrwr deleted Rabbit hemorrhagic disease/Temp (Repost of copyvio. content was: '{{copyvio|url=http://www.vet.uga.edu/vpp/gray_book/FAD/vhd.htm and http://members.iinet.net.au/~rabbit/history.htm}}')
- 22:10, 21 Dec 2004 Dante Alighieri deleted Talk:Luis B (content was: '--[[User:68.8.253.188|68.8.253.188]] 20:45, 21 Dec 2004 (UTC)Andres Coronado--[[User:68.8.253.188|68.8.253.188]] 20:45, 21 Dec 2004 (UTC)')
- 22:10, 21 Dec 2004 Dante Alighieri deleted Luis B (content before blanking was: '#REDIRECTED [[Luis Alejandro Bustamante]]')
- 22:09, 21 Dec 2004 Infrogmation deleted Toni Fisher (WP:CP listed since 11 Dec; content was: '{{copyvio|url=http://www.mmguide.musicmatch.com/artist/artist.cgi?ARTISTID=947357}}')
- 22:08, 21 Dec 2004 Infrogmation deleted William McKendree Bryant (WP:CP listed since 10 Dec; content was: '{{copyvio|url=http://64.233.183.104/search?q=cache:_aCiv76QQCcJ:www.thoemmes.com/american/hegelian_intro.htm+%22Born+in+Lake+County,+Indiana,+William+...')
- 22:08, 21 Dec 2004 Infrogmation deleted John W. Thompson (WP:CP listed since 11 Dec; content was: '{{copyvio|url=http://edition.cnn.com/SPECIALS/2002/black.history/stories/03.thompson/}}')
- 22:07, 21 Dec 2004 Infrogmation deleted Normanhurst (WP:CP listed since 10 Dec; content was: '{{copyvio|url=http://www.normanhurb-h.schools.nsw.edu.au/welcome.htm}}')
- 22:07, 21 Dec 2004 Infrogmation deleted John Huppenthal (WP:CP listed since 10 Dec; content was: '{{copyvio|url=http://www.huppenthal2004.com/track_record.htm}}')
- 22:06, 21 Dec 2004 Rbrwr deleted Rabbit hemorrhagic disease (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=http://www.vet.uga.edu/vpp/gray_book/FAD/vhd.htm and http://members.iinet.net.au/~rabbit/history.htm}}')
- 22:06, 21 Dec 2004 Infrogmation deleted Mary Church Terrell (WP:CP listed since 10 Dec; content was: '{{copyvio|url=http://www.africanamericans.com/MaryChurchTerrell.htm}}')
- 22:05, 21 Dec 2004 Theresa knott deleted Adverbial phrase (content was: '{{del}}drink')
- 22:05, 21 Dec 2004 Theresa knott deleted HalfLifeTwoDev (content was: '{{deletebecause|Wikipedia is not a web guide.}}A [[WikiWikiWeb]] site for [[Half-Life]] 2 modding.[http://www.hl2-dev.com/ HalfLifeTwoDev Website]')
- 22:03, 21 Dec 2004 Rbrwr deleted Astrophysical jets (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=http://www.astro.soton.ac.uk/~ak1/aboutme.htm}}')
- 22:03, 21 Dec 2004 Ahoerstemeier deleted Talk:KlogMS (content was: ''''Bold text'''sdsdfdsfsdf''Italic text''adfsdfsf''Italic text''[http://www.example.com link title]== Headline text ==[[Image:Example.jpg]][[Media:Ex...')
- 22:03, 21 Dec 2004 Ahoerstemeier deleted USS Nashville (PG-7) (content were only editing experiments)
- 22:03, 21 Dec 2004 Diberri deleted Shrinking sheep (content was: '{{deletebecause|Blank page. The sheep have totally shrunken away!}}')
- 22:03, 21 Dec 2004 Diberri deleted Pearlitic (content was: 'pearlitic{{delete}}')
- 22:02, 21 Dec 2004 SimonP deleted The Making of the Mahatma (content was: '{{deletebecause|Blank page}}')
- 21:58, 21 Dec 2004 Diberri deleted Infomed (content was: '[Infomed is the Cuban health information network and portal]')
- 21:55, 21 Dec 2004 Stevertigo deleted User:Stevertigo
- 21:54, 21 Dec 2004 Diberri deleted Princess Nataly of Prussia (content was: '{{deletebecause|Blank page; edit summary suggests vandalism or vandal bot}}')
- 21:53, 21 Dec 2004 Diberri deleted Mrs lightfoots farm (content was: '{{delete}}WHERE IS IT!?i dont know')
- 21:51, 21 Dec 2004 Diberri deleted Swades (content was: 'An Indian move featuring a man (Shah Rukh Khan)who misses his home country, India. He goes back and finds his foster mom, and a childhood friend (gay...')
- 21:48, 21 Dec 2004 Diberri deleted Scout (military) (content was: 'A horse rider with 100 hit points from the popular game Age of Empires.')
- 21:45, 21 Dec 2004 Dante Alighieri deleted Phlooblem (deleting article as vandalism and libel)
- 21:42, 21 Dec 2004 Diberri deleted Dick Heckstall-Smith (content was: '{{del}}Dick Heckstall-Smith is a great saxophone playerand famous for his appearance in Colosseum !John Mayall has been from time to time alsobus...')
- 21:40, 21 Dec 2004 Dante Alighieri deleted St. Xavier's School, Delhi (content was: 'Located at 4, Rajniwas Marg, St. Xavier's Delhi is a prestigious center of learning.')
- 21:39, 21 Dec 2004 Theresa knott deleted Kedar (content before blanking was: '{{del}}A cool kid')
- 21:38, 21 Dec 2004 Theresa knott deleted Sebastián (content was: 'Sebastian')
- 21:34, 21 Dec 2004 Flockmeal deleted Trademark infringement (content was: 'dsgsdgsdg')
- 21:33, 21 Dec 2004 Diberri deleted Adverbial phrase (content was: 'drink')
- 21:28, 21 Dec 2004 Diberri deleted Tinsel (content was: 'Very distracting.')
- 21:28, 21 Dec 2004 Flockmeal deleted Johann Christoph Bach (content was: 'hijh== Headline text ==== Headline text ==== Headline text ==== Headline text ==<math>Insert formula here</math><math>Insert formula here</math><n...')
- 21:24, 21 Dec 2004 Rfl deleted Crack (password cracker) (content was: '{{delete}}ÑúêÖ')
- 21:24, 21 Dec 2004 Diberri deleted Brad-x (content was: 'brad-x is a computer tech at Highfield Computers in oshawa, ON who 'makes this stuff work'.')
- 21:23, 21 Dec 2004 Diberri deleted Heruka (content was: 'jjkkjkk')
- 21:23, 21 Dec 2004 Cyrius deleted European Union non-profit laws (CSD - no context/definition)
- 21:21, 21 Dec 2004 MacGyverMagic deleted List of words censored at the Sports Interactive Messageboards (not an encyclopedia article - not cleanuppable.)
- 21:20, 21 Dec 2004 Rfl deleted Muschiparty (content was: '{{delete}}(dt. Cunt-Festival). Im Erotik-Gargon eine saloppe Bezeichnung für eine meist abendliche Zusammenkunft von Frauen die der Praktizierung de...')
- 21:19, 21 Dec 2004 Diberri deleted Far pointer (content was: 'This is a test of the far pointer...{{del}}')
- 21:15, 21 Dec 2004 Rdsmith4 deleted Image:Lohanslip.jpg (orphaned, useless, and semi-pornographic)
- 21:05, 21 Dec 2004 Mikkalai deleted Rock formations of Greece (to move back. content was: '#REDIRECT [[Rock Formations of Greece]]')
- 21:03, 21 Dec 2004 Rfl deleted Ricky Verlini (content was: '{{db|there no information and it is not linked to any other pages}}Very very cool!')
- 21:03, 21 Dec 2004 Gadfium deleted Talk:9 schools of magic (No longer needed as article has been deleted)
- 20:59, 21 Dec 2004 Mikkalai deleted Rock formations of Iceland (for move )
- 20:54, 21 Dec 2004 Kosebamse deleted Guy Cloutier (content was: 'AGRESSEUR SEXUEL!!!!!!!{{del}}')
- 20:54, 21 Dec 2004 Kosebamse deleted Matav (content was: '{{del}}hülye a serj :)')
- 20:53, 21 Dec 2004 Kosebamse deleted Mr drill (content before blanking was: '{{delete}}Mr. Drill is a dumbass. He cannot teach. He wrestles in tights though, and teaches us about sports! YAY I love dumbasses!')
- 20:53, 21 Dec 2004 Kosebamse deleted Jason Kim (content was: '{{del}}Kinda cool...')
- 20:52, 21 Dec 2004 Ahoerstemeier deleted Ajuda (content before blanking was: 'anokas_martinez91@hotmail.com')
- 20:52, 21 Dec 2004 Kosebamse deleted Gena Rositano (content was: 'married to Robin Wilson')
- 20:51, 21 Dec 2004 Kosebamse deleted Ricky Verlini (content was: 'Very very cool!')
- 20:51, 21 Dec 2004 Kosebamse deleted Manny dimatulac (content was: 'Woohoo! I'm on Wikipedia!')
- 20:40, 21 Dec 2004 Jmabel deleted Heraldica (copy from interlingua wikipedia on a topic where there is already a perfectly good English-language article.)
- 20:34, 21 Dec 2004 Jfdwolff deleted Aciclovir (content was: '#REDIRECT [[Acyclovir]]' make room for move\)
- 20:32, 21 Dec 2004 CryptoDerk deleted Ricky Verlini (content was: 'Very very cool!')
- 20:29, 21 Dec 2004 CryptoDerk deleted Ice Hockey at the 1980 Winter Olympics (content was: 'jfkkjfhjf')
- 20:28, 21 Dec 2004 Pakaran restored "Scizor"
- 20:23, 21 Dec 2004 DavidWBrooks deleted Mr drill (content was: 'he is a teacher that 'works' at DMS... He has the face of a dumbass...')
- 20:23, 21 Dec 2004 CryptoDerk deleted Mr drill (content was: 'he is a teacher that 'works' at DMS... He has the face of a dumbass...')
- 20:21, 21 Dec 2004 CryptoDerk deleted Scizor (content was: 'Scizor is obtained by giving scyther a metal coat, and trading him/her. At lvl 30 it learns METAL CLAW,which is extremly strong.Being made out of meta...')
- 20:20, 21 Dec 2004 CryptoDerk deleted Kingdra (content was: 'Kingdra is awesomE!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!...')
- 20:19, 21 Dec 2004 CryptoDerk deleted @lek (content was: '@lek was an amazing civil rights activist that lived in the 3rd and 4th century B.C. @lek cheated on her wife so much that she was decapitated by the...')
- 20:18, 21 Dec 2004 CryptoDerk deleted Whirl islands (content was: 'Whirl Islands is where you find lugia,lvl 45 on silver,60 on crystal, and 70 on gold. Obtain the silver wing and search these islands to find and catc...')
- 20:18, 21 Dec 2004 CryptoDerk deleted Scizor (content was: 'Scizor is obtained by giving scyther a metal coat, and trading him/her. At lvl 30 it learns METAL CLAW,which is extremly strong.Being made out of meta...')
- 20:16, 21 Dec 2004 Niteowlneils deleted Talk:Phantom mobile device vibration (talk for deleted article)
- 20:16, 21 Dec 2004 CryptoDerk deleted Pabilsag (content was: 'look here for more infor on Pabilsag http://www.jameswbell.com/geog0050pnames.html')
- 20:15, 21 Dec 2004 Niteowlneils deleted Phantom mobile device vibration (recreation of VfDed article--content was: 'The act of feeling vibration(s) on the body where one commonly wear's their mobile device (cellular/mobile phone, pager). The associated sensation fe...')
- 20:11, 21 Dec 2004 Niteowlneils deleted Xtreme Sandwiching (nonsense)
- 20:11, 21 Dec 2004 Deb deleted Anti-art (content was: 'Anti-art')
- 20:11, 21 Dec 2004 Niteowlneils deleted New york times co. vs. sullivan (content was: '{{delete}}I love myself. oooohhhhh you are so hot.[[Media:Example.ogg]]== Headline text ==== Headline text ==[http://www.example.com link title][htt...')
- 20:04, 21 Dec 2004 Deb deleted Chess (musical (content was: '{{delete}}dfadsasdf')
- 19:54, 21 Dec 2004 CryptoDerk deleted John Gizzi (content was: 'John Gizzi is a principal at Lansing Middle School')
- 19:51, 21 Dec 2004 CryptoDerk deleted Chess (musical (content was: 'dfadsasdf')
- 19:48, 21 Dec 2004 Mikkalai deleted Category:Police (moved to [[Category:Law enforcement]] . content before blanking was: '{{catmore}}[[Category:Law enforcement]]')
- 19:41, 21 Dec 2004 ContiE deleted Greg Gilbert (VfD candidate, consensus for deletion)
- 19:41, 21 Dec 2004 ContiE deleted Doug Hash (VfD candidate, consensus for deletion)
- 19:41, 21 Dec 2004 CryptoDerk deleted Called (content was: 'test')
- 19:40, 21 Dec 2004 ContiE deleted Brandon Bender (VfD candidate, consensus for deletion)
- 19:40, 21 Dec 2004 ContiE deleted Ballard Basketball (VfD candidate, consensus for deletion)
- 19:39, 21 Dec 2004 ContiE deleted Ballard Baseball (VfD candidate, consensus for deletion)
- 19:37, 21 Dec 2004 CryptoDerk deleted Premier House (content was: 'I put this here')
- 19:37, 21 Dec 2004 Quadell deleted Image:Butte, Montana2-300px.JPG (unused thumb)
- 19:36, 21 Dec 2004 Quadell deleted Image:Butte, Montana-300px.JPG (unused thumb)
- 19:33, 21 Dec 2004 CryptoDerk deleted Stroh's Brewery (just says people should drink 5 beers a day)
- 19:32, 21 Dec 2004 Rdsmith4 deleted User:Rdsmith4/To-do (unnecessary userpage)
- 19:32, 21 Dec 2004 ContiE deleted Deadline (band) (VfD candidate, 8-3 for deletion)
- 19:32, 21 Dec 2004 Rdsmith4 deleted User:Rdsmith4/Template3 (unnecessary userpage)
- 19:30, 21 Dec 2004 Quadell deleted Image:BroadwayRecordsSleeveSmall.jpg (unused thumb)
- 19:30, 21 Dec 2004 CryptoDerk deleted David Douglas Duncan (content was: 'hello why doesnt this guy have any info is he not important?')
- 19:27, 21 Dec 2004 ContiE deleted Rosa negra (VfD candidate, 6-1 for deletion)
- 19:24, 21 Dec 2004 Adam Bishop deleted Atlanta Riots (content was: ''''Bold text'''why can't you write more about series riot like New Mexico, ohio, talledeza, Atlanta,also Attica{{delete}}')
- 19:24, 21 Dec 2004 Quadell deleted Image:Bridge mountain bridge 300px.jpg (unused thumb)
- 19:23, 21 Dec 2004 Adam Bishop deleted Epsin (content was: '{{delete}}Epsin')
- 19:23, 21 Dec 2004 Quadell deleted Image:Bremen.band.250pix.jpg (unused thumb)
- 19:23, 21 Dec 2004 Adam Bishop deleted Society of Assassins (content was: 'this is a society which works for the illuminati as almost thier henchman')
- 19:23, 21 Dec 2004 Quadell deleted Image:Bremen.cathedral.250pix.jpg (unused thumb)
- 19:22, 21 Dec 2004 Adam Bishop deleted Blumpkin (content was: 'test[[Image:Example.jpg]]{{delete}}')
- 19:22, 21 Dec 2004 Adam Bishop deleted Felix yelin (content was: 'Maksim pidaras{{delete}}')
- 19:20, 21 Dec 2004 Adam Bishop deleted XPDF (content was: 'And...?')
- 19:19, 21 Dec 2004 Quadell deleted Image:Braque.woman.250pix.jpg (unused thumb)
- 19:19, 21 Dec 2004 Deb deleted The others (not sure what this is, but it doesn't belong here)
- 19:12, 21 Dec 2004 Quadell deleted Image:Bozen aerial 300.jpg (unused thumb)
- 19:12, 21 Dec 2004 Quadell deleted Image:Bozen aerial 800.jpg (unused thumb)
- 19:11, 21 Dec 2004 Quadell deleted Image:Both.snow.geese.250pix.jpg (unused thumb)
- 19:09, 21 Dec 2004 Quadell deleted Image:Bosch.hell.500pix.jpg (unused thumb)
- 19:09, 21 Dec 2004 Quadell deleted Image:Bosch.hell.250pix.jpg (unused thumb)
- 19:08, 21 Dec 2004 Quadell deleted Image:Borodino-Desarno-Small.jpg (unused thumb)
- 19:06, 21 Dec 2004 Quadell deleted Image:Borelparardox support xydist.png (Image contains errors and will not display)
- 19:06, 21 Dec 2004 Quadell deleted Image:Borelparardox support uvdist.png (Image contains errors and will not display)
- 19:03, 21 Dec 2004 Quadell deleted Image:Bonnie and Clyde small.jpg (unused thumbnail)
- 19:03, 21 Dec 2004 Dante Alighieri deleted Tollkore (content was: '{{deletebecause|mispelt title for page-information replicated on [[Slashdot trolling phenomena]]}}Trollkore is a now defunct [http://www.slashdot.org...')
- 19:02, 21 Dec 2004 Dante Alighieri deleted Isidore Dyen (vandalism from known vandal)
- 19:01, 21 Dec 2004 Dante Alighieri deleted Asphalt Urban GT (content was: '{{delete}}jjljljlkjkljkjkjkj')
- 19:01, 21 Dec 2004 Dante Alighieri deleted 1941 (film) (content was: '{{delete}}'''Bold text'''')
- 18:57, 21 Dec 2004 Infrogmation deleted Xrd (WP:CP listed since 10 Dec; ccontent was: '{{copyvio|url=http://www.mastest.com/xrdxrr.htm}}')
- 18:56, 21 Dec 2004 Infrogmation deleted Zhou Qiang (WP:CP listed since 10 Dec; ccontent was: '{{copyvio|url=http://www.chinavitae.com/biography_display.php?id=651}}[[User:Lucky 6.9|Lucky 6.9]] 00:56, 10 Dec 2004 (UTC)')
- 18:56, 21 Dec 2004 Infrogmation deleted Frost like ashes (WP:CP listed since 10 Dec; ccontent was: '{{copyvio|url=http://www.soundclick.com/bands/0/frostlikeashes.htm}}')
- 18:56, 21 Dec 2004 Infrogmation deleted Zhao Leji (WP:CP listed since 10 Dec; ccontent was: '{{copyvio|url=http://www.chinavitae.com/biography_display.php?id=326}}[[User:Lucky 6.9|Lucky 6.9]] 00:59, 10 Dec 2004 (UTC)')
- 18:56, 21 Dec 2004 Aranel deleted Category:Zurich Premiership teams (delete per cfd - unnecessary, use Category:English rugby union teams)
- 18:56, 21 Dec 2004 Infrogmation deleted Oysterizer (WP:CP listed since 10 Dec; content was: '{{copyvio|url=http://www.angelfire.com/alt/kaijuplanet/Oysterizer.html}}')
- 18:55, 21 Dec 2004 Dante Alighieri deleted Al-Ghubra (content was: '{{del}}ghobra is in muscat its near the sea and its very big .in ghobra ther is a team called albahry its the best team in alghobra.and bye')
- 18:53, 21 Dec 2004 Dante Alighieri deleted Necrobation (recreation of previously deleted article)
- 18:50, 21 Dec 2004 Deb deleted La dentellière (content was: 'La dentellière{{del}}')
- 18:48, 21 Dec 2004 Deb deleted Sarah Speed (content was: '{{delete}}khlllllllllllllllllj WHY!!!!')
- 18:48, 21 Dec 2004 Aranel deleted Category:Yamaguchi prefecture (delete per cfd, see Category:Yamaguchi Prefecture)
- 18:46, 21 Dec 2004 Jimfbleak deleted Mavrodes (content was: 'Philosopher of Religion')
- 18:46, 21 Dec 2004 Jimfbleak deleted Souhwestern (content was: 'delete}}#REDIRECT [[Souhwest]]')
- 18:45, 21 Dec 2004 Jimfbleak deleted Your hero (content was: 'delete}}'''Your hero''' (b. [[Febuary 3]], [[1987]]) rights all the articles Wikipedia needs but doesn't have!')
- 18:44, 21 Dec 2004 Neutrality deleted O conner (content was: 'O Conner is Irish and now in America it's Conners. In Ohio we live in Cincinnati.')
- 18:42, 21 Dec 2004 Neutrality deleted Shanghai star (content was: 'The Shanghai Star is a weekly newspaper owned by China Daily.')
- 18:42, 21 Dec 2004 Neutrality deleted Poopstoddle (content was: 'Poopstoddling is an 18th century method of stoddling poop, widely used throughout the far east and midwest; it gave rise to the modern practice of squ...')
- 18:42, 21 Dec 2004 Neutrality deleted Buttered toast (content was: '{{delete}}Buttered toast is very good to eat. Kyle likie it. Jess likes to eat butter and then the toast. M&Ms are good substitute for the toast. Al...')
- 18:37, 21 Dec 2004 Aranel deleted Category:Kanagawa prefecture (delete per cfd, see Category:Kanagawa Prefecture)
- 18:36, 21 Dec 2004 Gamaliel deleted Simu (content was: 'So, like... this is the total n00b who thinks that he pwns. What next: N00bownd?On a more serious note, Simu is a total n00b who thinks that he pw...')
- 18:36, 21 Dec 2004 Aranel deleted Category:Nagano prefecture (delete per cfd, see Category:Nagano Prefecture)
- 18:31, 21 Dec 2004 VampWillow deleted NAMC (patent nonsense)
- 18:31, 21 Dec 2004 VampWillow deleted Twat (content includes: ''m00er is such a twat'. W...')
- 18:30, 21 Dec 2004 VampWillow deleted Operation Happy Monkey (content was: 'Vanity listing for placing weblink}}'''Operation Happy Monkey''' is aggro-industrial band from Taunton, Massachusetts. O.H.M. was f...')
- 18:28, 21 Dec 2004 VampWillow deleted Maxine (speedy rule 4)
- 18:26, 21 Dec 2004 VampWillow deleted WHATWG (vapourware advert)
- 18:25, 21 Dec 2004 VampWillow deleted Estenografia de tritemo (content was: ' Artículo espúreo.' - ie no en content)
- 18:24, 21 Dec 2004 Niteowlneils deleted Universalist Church of America (content was: '{{delete}}ppoooopp')
- 18:23, 21 Dec 2004 Jimfbleak deleted American Crocodile (pointless content was: '#REDIRECT [[Crocodile]]')
- 18:23, 21 Dec 2004 Niteowlneils deleted Radio Act of 1912 (content was: 'hey i want 2 see if this works so hi im working on a project for that history day thing im doing the radio act of 1927 but kno we might just do radio...')
- 18:22, 21 Dec 2004 VampWillow deleted Bridgegfd (content was: '#redirect [[Contract bridge]]')
- 18:22, 21 Dec 2004 Niteowlneils deleted Mona (movie) (content was: 'haha{{delete}}')
- 18:22, 21 Dec 2004 VampWillow deleted Anal canal (content was: '<math>Insert formula here</math>[[Media:Example.ogg]]''Italic text''mmlll----amoon102000@yahoo.com')
- 18:21, 21 Dec 2004 Niteowlneils deleted 2006 World Junior Hockey Championship (content was: '{{delete}}'''Bold text'''[[Link title]][[Image:Example.jpg]]== Headline text ==--[[User:128.100.58.45|128.100.58.45]] 18:02, 21 Dec 2004 (UTC)--[[...')
- 18:21, 21 Dec 2004 Infrogmation deleted Image:James joyce.JPG (Listed on WP:PUI and tagged for deletion since October (not used in James Joyce article))
- 18:20, 21 Dec 2004 Niteowlneils deleted Amnesty Act of 1872 (content was: 'C'mon, I need some help finding stuff about the Amnesty act! I known its during Grant's administration and that's about it. yours tru...')
- 18:18, 21 Dec 2004 Infrogmation deleted Image:Shwodfor.JPG (Listed on WP:PUI and tagged for deletion since October )
- 18:17, 21 Dec 2004 Infrogmation deleted Image:Malmaisn.JPG (Listed on WP:PUI and tagged for deletion since October )
- 18:15, 21 Dec 2004 Infrogmation deleted Image:Berkley.JPG (Listed on WP:PUI and tagged for deletion since October )
- 18:14, 21 Dec 2004 Infrogmation deleted Image:Hevercst.JPG (Listed on WP:PUI and tagged for deletion since October )
- 18:13, 21 Dec 2004 Rfl deleted Papa's Got a Brand New Babe (content was: '{{rfd}}#REDIRECT[[Dodge]]')
- 18:11, 21 Dec 2004 Rfl deleted United States Vandalist Party
- 18:07, 21 Dec 2004 Jimfbleak deleted Chump Change (content was: 'delete}}------[[User:213.175.2.50|213.175.2.50]] 18:05, 21 Dec 2004 (UTC)<nowiki>Insert non-formatted text here</nowiki><math>Insert formula here...')
- 18:06, 21 Dec 2004 Jimfbleak deleted Make your own free web site (content was: '--[[User:64.53.211.2|64.53.211.2]] 11:58, 21 Dec 2004 (UTC)Michael article{speedy}}go to www.freewebsite.com soon.P.S. I love you')
- 18:05, 21 Dec 2004 Niteowlneils deleted Image:LocationPuertoRico.png (moved to commons under same name)
- 18:05, 21 Dec 2004 Niteowlneils deleted Image:LocationSamoa.png (moved to commons under same name)
- 18:04, 21 Dec 2004 Jimfbleak deleted Potop (content was: '{{delete}}[http://www.example.com link title]== Headline text ==[[Image:Example.jpg]]<math>Insert formula here</math><nowiki>Insert non-formatted ...')
- 18:03, 21 Dec 2004 Infrogmation deleted Image:Geotown univ 1893.JPG (Listed on WP:PUI and tagged for deletion since October )
- 18:01, 21 Dec 2004 Infrogmation deleted Image:Ashmolean museum.jpg (Listed on WP:PUI and tagged for deletion since October )
- 18:00, 21 Dec 2004 Infrogmation deleted Image:Mayflower ii.JPG (Listed on WP:PUI and tagged for deletion since October )
- 17:57, 21 Dec 2004 Rdsmith4 deleted Image:WalterMatthau.jpg (orphaned, purposeless image)
- 17:57, 21 Dec 2004 Rdsmith4 deleted Image:Philip.jpg (orphaned, purposeless image)
- 17:57, 21 Dec 2004 Snoyes deleted Niccolus (content was: '{{speedy}}niccolus is pro :P')
- 17:56, 21 Dec 2004 DJ Clayworth deleted On the Morning of Christ's Nativity (content was: ''''Bold text'''''Italic text''')
- 17:56, 21 Dec 2004 Rdsmith4 deleted Image:Dahmer.jpg (orphaned, purposeless image)
- 17:55, 21 Dec 2004 Niteowlneils deleted Image:LocationTonga.png (moved to commons under same name)
- 17:55, 21 Dec 2004 Niteowlneils deleted Moufid Jaber (content was: '{{delete}}'''''''''Moufid Jaber is a mother fuckin' bastard. He can suck his own cock because he is the biggest gaylord on earth.'''''''''')
- 17:54, 21 Dec 2004 Niteowlneils deleted Grethel (content was: '{{delete}}Grethel. She is sweet, kind, and full of love. She has a magnetic personality that just attracts you to her. she is one of a kind. Grethel ...')
- 17:54, 21 Dec 2004 Niteowlneils deleted Howard Hughes will (content was: '{{delete}}Bling Bling')
- 17:54, 21 Dec 2004 Rdsmith4 deleted Image:BeardedWoman5.jpg (orphaned, purposeless image)
- 17:53, 21 Dec 2004 Pakaran deleted User talk:Pakaran/Archive 2 (accidentally moved to wrong address, no history, content was: '#REDIRECT [[User talk:Pakaran/Archive2]]')
- 17:53, 21 Dec 2004 Niteowlneils deleted Keith Gordon (content was: '{{delete}}Keith Gordon is (in many cirles) the man. That is all.')
- 17:49, 21 Dec 2004 Deb deleted Penis prosthetic aid (content was: '{{delete}}hi my mates always talk about dildoes and i think that they are really dirty minded')
- 17:47, 21 Dec 2004 Deb deleted Revision (content was: '{{nonsense}}fjdalsjf;a')
- 17:47, 21 Dec 2004 Infrogmation deleted Image:Pillar box.jpg (WP:PUI listed and tagged for deletion since October)
- 17:45, 21 Dec 2004 Infrogmation deleted Image:Daisy wheel.JPG (WP:PUI listed and tagged for deletion since October)
- 17:44, 21 Dec 2004 Rbrwr deleted Chimichanga (Listed on WP:CP since Dec 9; content was: '{{copyvio|url=http://allrecipes.com/advice/ref/ency/terms/5835.asp}}')
- 17:43, 21 Dec 2004 Infrogmation deleted Image:Typeball.JPG (WP:PUI listed and tagged for deletion since October)
- 17:41, 21 Dec 2004 Infrogmation deleted Image:Mouse2wb.jpg (Listed on WP:PUI and tagged for deletion for more than a month)
- 17:41, 21 Dec 2004 Rfl deleted Vandalist (content was: '{{nonsense}}In Wikipedian [[politics]], a '''Vandalist''' (uppercase ''V'') is a member, delegate, or supporter of a [[Vandalist Party|Vandalist poli...')
- 17:38, 21 Dec 2004 Deb deleted Battle plan (content was: 'hello i am a fat kid,')
- 17:36, 21 Dec 2004 Rbrwr deleted Bi-Lo/Temp (/Temp page no longer needed after conclusion of copyvio process; content was: '#REDIRECT [[Bi-Lo]]')
- 17:35, 21 Dec 2004 Rbrwr deleted Bi-Lo (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=http://www.bi-lo.com.au/about_us/ourstory_bilo.htm?use=pg&pg=658&ct=6}}')
- 17:35, 21 Dec 2004 Infrogmation deleted Image talk:McDonnell F2H Banshee.jpg (discussion for deleted image)
- 17:35, 21 Dec 2004 Infrogmation deleted Image:McDonnell F2H Banshee.jpg (WP:PUI listed and tagged for deletion since October. Seems we can't use under that non-commercial only licence)
- 17:33, 21 Dec 2004 Rfl deleted The Confidence Man (content was: '{{delete}}the confidence-man')
- 17:33, 21 Dec 2004 Rfl deleted CNNBCBS (content was: '{{nonsense}}'''CNNBCBS''' is a division of [[American Broadcasting Company|ABC]]. By [[2010]], [[Cable News Network|CNN]], [[NBC]], and [[CBS]] will...')
- 17:24, 21 Dec 2004 Infrogmation deleted Image:Franzschubert.jpg (WP:PUI listed and tagged for deletion since early November; this is not the image now used on the Franz Schubert article)
- 17:23, 21 Dec 2004 Infrogmation deleted Image:Andhrad.jpg (WP:PUI listed and tagged for deletion since early November)
- 17:21, 21 Dec 2004 Adam Bishop deleted Niall (content was: 'boo hiss')
- 17:17, 21 Dec 2004 Rbrwr deleted Alex Winter (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=http://www.imdb.com/name/nm0935664/bio}}')
- 17:16, 21 Dec 2004 Rbrwr deleted The Springstone school (Listed on WP:CP since 9 Dec; content was: '{{copyvio|url=http://www.thespringstoneschool.org/}}')
- 17:16, 21 Dec 2004 Gentgeen deleted Sodium vapor lamt (content was: '#REDIRECT [[Sodium vapor lamp]]' created the page as a typo when moving a page)
- 17:16, 21 Dec 2004 Gentgeen deleted Talk:Sodium vapor lamt (content was: '#REDIRECT [[Talk:Sodium vapor lamp]]' typo caused me to create this page by accident)
- 17:11, 21 Dec 2004 Rbrwr deleted Image:Union Station.jpg (Listed on WP:CP since 7 Dec; copyvio from http://arch.ou.edu/arch/2423/Chapter%2026/Union%20Station.T.jpg)
- 17:10, 21 Dec 2004 Adam Bishop deleted S.C.U.M (content was: 'wtf')
- 17:09, 21 Dec 2004 Rbrwr deleted Image:Hotelfromside.jpg (Listed on WP:CP since 7 Dec; copyvio from http://www.grandhotel.com/gallery/hotelfromside.jpg)
- 17:08, 21 Dec 2004 Gentgeen deleted Talk:Sodium vapor lamp (moving for a page move)
- 17:06, 21 Dec 2004 Infrogmation deleted Image:HMAS Anzac off Heard Island.jpg (WP:PUI listed and tagged for deletion since November)
- 17:03, 21 Dec 2004 Gentgeen deleted Sodium vapor lamp (temp deletion for a page move)
- 17:03, 21 Dec 2004 Rbrwr deleted Bartlett, NH (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.skyvalley4u.com/bartlett.htm}}')
- 16:51, 21 Dec 2004 Ahoerstemeier deleted World Television Day (content was nonsense: 'world TV day is Marc Freundlich's birthday, he is a runescape nut that sits next to me, he's alright.')
- 16:51, 21 Dec 2004 Ahoerstemeier deleted Basil Hume (content was: 'was a catholic and killed him all., He kujed all that stood in his oath!')
- 16:49, 21 Dec 2004 Ahoerstemeier deleted Pointing (content was: 'hjjjjhhjhj')
- 16:43, 21 Dec 2004 Niteowlneils deleted Image:LocationAmericanSamoa.png (moved to commons under same name)
- 16:43, 21 Dec 2004 Niteowlneils deleted Image:LocationBermuda.png (moved to commons under same name)
- 16:43, 21 Dec 2004 Niteowlneils deleted Image:LocationBhutan.png (moved to commons under same name)
- 16:43, 21 Dec 2004 Niteowlneils deleted Image:LocationGeorgia.png (moved to commons under same name)
- 16:42, 21 Dec 2004 Niteowlneils deleted Image:LocationPalau.png (moved to commons under same name)
- 16:37, 21 Dec 2004 Ahoerstemeier deleted Turkije (content was: 'lsadkasd== Headline text ==ddasdsad[[Link title]]dsdas[[Image:Example.jpg]]dsadas[[Image:Example.jpg]][[Media:Example.ogg]]dsad[[Media:Exam...')
- 16:37, 21 Dec 2004 Ahoerstemeier deleted Bolshaya Tes (content was: '----fghn== Headline text ==== gtdfhfghfdgh ==[[Link title]]<nowiki>Insert non-formatted text here</nowiki>--[[User:24.104.20.197|24....')
- 16:33, 21 Dec 2004 Stan Shebs deleted George farragut (content was: '{{nonsense}}hsaiiasfh ubsdjfjkase usdfjl ksn dshfksd jsdkjfippskdg;r sdhhgidfgkasf ijrmt flv jrrjgi;s igphgh8ksfd grhandig a skri ndidsf s hasn...')
- 16:24, 21 Dec 2004 Ahoerstemeier deleted History of design (content was: 'design')
- 16:24, 21 Dec 2004 Ahoerstemeier deleted Space Madness (content was nonsense: 'Without space there can be no Space Madness.')
- 16:23, 21 Dec 2004 Jiang deleted Fan Zhang (content before blanking was: 'Fan Zang is a fourth-year Ph.Dh. student in the Economics Department at Northwestern University. He is interested in contract theory and law and econo...')
- 16:08, 21 Dec 2004 Rmhermen deleted Rtrhyt (content was: '{{delete}}Everyone sucks balls')
- 16:06, 21 Dec 2004 Jiang deleted The Old Regime (content was: 'the old regiome was cool')
- 15:59, 21 Dec 2004 VampWillow deleted Clairalience (cdicdef at best)
- 15:56, 21 Dec 2004 Jimfbleak deleted Charming (content was: 'Charming is someone who has [[charm]].One is charming if one can please and evoke positive feelings in others.')
- 15:55, 21 Dec 2004 Jimfbleak deleted Clairgustance (content was: 'Clairgustance is being aware of tastes without putting anything in your mouth. To perceive the essence of a substance through taste from the spiritual...')
- 15:54, 21 Dec 2004 Jimfbleak deleted Peter Woll (content was: 'A jerk.')
- 15:54, 21 Dec 2004 Jimfbleak deleted 134 (number) (content was: '134 is the least natural number without an article in the Wikipedia')
- 15:54, 21 Dec 2004 Jimfbleak deleted Clairalience (content was: 'To smell a fragrance or odor coming from the spirit or ethereal realms.')
- 15:53, 21 Dec 2004 Jimfbleak deleted Galvin gand Gobbes (content was: '{db|Nobody's gonna type Galvin gand Gobbes}}#REDIRECT[[Calvin and Hobbes]]')
- 15:48, 21 Dec 2004 ALoan deleted User:Squash/Full (content was: '#REDIRECT [[User:Squash]]' - unneeded temp page)
- 15:47, 21 Dec 2004 ALoan restored "User:Squash"
- 15:46, 21 Dec 2004 ALoan deleted User:Squash (content was: ''''Hello'''<br>My name is Stephen. (No Khmer name)<br>Member since 2 June 2004. [http://kohl.wikimedia.org/kates-tools/count.action?user=Squash&dbna...' - deleting for page move at User's request on [[WP:RM]])
- 15:46, 21 Dec 2004 Ævar Arnfjörð Bjarmason deleted Image talk:Frau.jpg (content was: 'she is sexy')
- 15:46, 21 Dec 2004 Rbrwr deleted Chhing (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.pbs.org/pov/pov2003/thefluteplayer/special_instr_chhing.html}}')
- 15:42, 21 Dec 2004 Jimfbleak deleted Denis D'Amour (content was: 'AKA Piggy, he plays an Eric Clapton Stratocastor and a custom guitar that features no headstock and tuning machines below the bridge')
- 15:42, 21 Dec 2004 Rbrwr deleted Huemul (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.todo-argentina.net/ecologia/animales_en_peligro/huemul.htm}}')
- 15:42, 21 Dec 2004 Jimfbleak deleted Rebecca Rizzo (content was: 'Rebecca Rizzo,She is soooo dumb. A 2 year old can teach her.Rebecca Rizzo,As Dumb as dey get.')
- 15:41, 21 Dec 2004 Jimfbleak deleted Rebecca rizzo (content was: '[['''rebecca rizzo (1991) born on the 5th of augustgoes 2 smc maltahas a bros called marc hu is older''']]')
- 15:41, 21 Dec 2004 Rbrwr deleted Ed Macauley (Lsted on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.hoophall.com/halloffamers/Macauley.htm}}')
- 15:40, 21 Dec 2004 Rbrwr deleted Denilson (listed om WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.football-rumours.com/denilson.html}}[[User:David Johnson|David Johnson]] 10:54, 7 Dec 2004 (UTC)')
- 15:38, 21 Dec 2004 Rbrwr deleted Tim Bowness (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.timbowness.com/}}')
- 15:37, 21 Dec 2004 Rbrwr deleted No-Man (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.no-man.co.uk/biography-main.htm}}')
- 15:36, 21 Dec 2004 Rbrwr deleted Blackfield (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.blackfield.org/}}[[User:David Johnson|David Johnson]] 10:35, 7 Dec 2004 (UTC)')
- 15:35, 21 Dec 2004 Rbrwr deleted National League of Cities (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.nlc.org/Inside_NLC/About_NLC/}}')
- 15:34, 21 Dec 2004 Rbrwr deleted The Museum of Army Chaplaincy (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.hants.gov.uk/discover/places/chaplains.html}}')
- 15:33, 21 Dec 2004 Rbrwr deleted Hitachi Data Systems (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.bitpipe.com/detail/RES/1097086147_52.html and http://searchstorage.techtarget.com/originalContent/0,289142,sid5_gci1005150,00...')
- 15:31, 21 Dec 2004 Rbrwr deleted TagmaStore (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.it-director.com/article.php?id=12224}}')
- 15:30, 21 Dec 2004 Rbrwr deleted Baburnama (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://depts.washington.edu/uwch/silkroad/texts/babur/babur1.html}}')
- 15:29, 21 Dec 2004 Rbrwr deleted 1848 Women's Rights Convention (Listed on WP:CP since 7 Dec; deleting copyvio in history and will recreate redirect shortly. content was: '#REDIRECT [[Seneca Falls Convention]]')
- 15:25, 21 Dec 2004 Ahoerstemeier deleted Perry Macarthy (content before blanking was nonsense: 'Perry Macarthy is a total knob, lol.')
- 15:25, 21 Dec 2004 Ahoerstemeier deleted Terron (content was vanity: 'Terron was an IRC legend in the early days, now he idles and trolls IRC.')
- 15:24, 21 Dec 2004 Ahoerstemeier deleted AT&T Canada (content was: 'jjjklds')
- 15:20, 21 Dec 2004 Ferkelparade deleted Andrew j. Fullerton (content was: 'hes so hot')
- 15:19, 21 Dec 2004 Ferkelparade deleted Shane Kraig (content was: 'is the best VP ever')
- 15:18, 21 Dec 2004 Joy Stovall deleted Steve Davis (Comedian) ((VFD consensus to delete) content was: '{{vfd}}'''Steve Davis''' is an [[Australia]]n comedian who began his career in [[1979]].He started as as street performer in [[Melbourne]] and work...')
- 15:12, 21 Dec 2004 Ferkelparade deleted Shane Craig (content was: 'Is Cool')
- 15:04, 21 Dec 2004 Quadell deleted Image:ITunes main window screenshot thumbnail.png (thumbnail)
- 14:59, 21 Dec 2004 Quadell deleted Image:IMG 1326.jpg (deleted by request of uploader)
- 14:53, 21 Dec 2004 Angela restored "Talk:Columbian_Exchange"
- 14:53, 21 Dec 2004 Angela deleted Talk:Columbian Exchange (temp delete to fix links table)
- 14:51, 21 Dec 2004 Angela deleted Nominate contract (content was: '{{delete}}DEAR SIR.WE ARE LOOKING FOR BUYERS OF TIMBER WOODS AND COCOA BEANS AND ALSO SERIOUS BUYER OF PERCIOUS METALS SUCH AS GOLD DUST.WE WAN...')
- 14:51, 21 Dec 2004 Angela deleted User:Anthony DiPierro/XML error pages (content was: '{{delete}}')
- 14:51, 21 Dec 2004 Quadell deleted Image:I2467169653ff9136de5f41.jpg (Image has errors and will not display)
- 14:32, 21 Dec 2004 Quadell deleted Image:HypocrisyIstheGreatestLuxury.jpg (duplicate image)
- 14:29, 21 Dec 2004 Ahoerstemeier deleted Trick photography (content was: 'best')
- 14:27, 21 Dec 2004 Francs2000 deleted Astolphe de Custine (content was: '{{deletebecause|typo in title}}s/Astolphe/Adolphe#REDIRECT [[Marquis de Custine]]')
- 14:25, 21 Dec 2004 Quadell deleted Image:Hypercardiodpattern.png (request from uploader)
- 14:17, 21 Dec 2004 Quadell deleted Image:HyacinthoidesNonScripta-thumb.jpg (unused thumbnail)
- 14:16, 21 Dec 2004 Quadell deleted Image:Hurricane from satellite sm.jpg (unused thumbnail)
- 14:16, 21 Dec 2004 Quadell deleted Image:Hunter.black.300pix.jpg (unused thumbnail)
- 14:15, 21 Dec 2004 Francs2000 deleted Bayron (more nonsense)
- 14:12, 21 Dec 2004 Francs2000 deleted Farming practices (content was: 'farming practice')
- 14:12, 21 Dec 2004 Francs2000 deleted Ryan (content was: 'Ryan is a student. He plays bass in a band called crosshair. He enjoys the taste and texture of bagels.')
- 14:12, 21 Dec 2004 Francs2000 deleted Bayron (content was: 'sdf')
- 14:11, 21 Dec 2004 Francs2000 deleted Bayron (content was: 'MIKE LOVES IT up the butt')
- 14:10, 21 Dec 2004 Quadell deleted Image:Hundertwasser-darmstadt front 300px.jpg (unused thumbnail)
- 14:10, 21 Dec 2004 Quadell deleted Image:Hundertwasser-darmstadt 300px.jpg (unused thumbnail)
- 14:10, 21 Dec 2004 Francs2000 deleted Carotid sinus reflex death (content was: 'Death by jerking off SNOODLINGSNOODALTATIONBayron has had some fun with that')
- 14:10, 21 Dec 2004 Quadell deleted Image:Hundertwasser-darmstadt2 300px.jpg (unused thumbnail)
- 14:09, 21 Dec 2004 Francs2000 deleted Bayron (content was: 'SNOODLATION')
- 14:06, 21 Dec 2004 Francs2000 deleted New haw (content was: '{{db|this article has no content}}A town in Weybridge, Surrey, England.')
- 14:06, 21 Dec 2004 Francs2000 deleted Whoita (content was: 'WHOITA - genre of music. It was created by russian band - ktoetoa.[http://whoita.h12.ru]')
- 14:02, 21 Dec 2004 Francs2000 deleted Batcombe, Somerset (content was: '[[Category:Villages in Somerset]]')
- 13:54, 21 Dec 2004 Quadell deleted Image:HubbleDeepField.300px.jpg (Unused thumb)
- 13:54, 21 Dec 2004 Ahoerstemeier deleted U.s. selection of vice president (content was: 'Was the vice president ever the second person with the highest number of votes?Also was the vice president ever announced after the presidetial candi...')
- 13:48, 21 Dec 2004 Quadell deleted Image:Hoenn-group ash may brock max.jpeg (duplicate image)
- 13:35, 21 Dec 2004 Chris 73 deleted Neva Jane Langley (content was: 'This is a test to see how this works')
- 13:31, 21 Dec 2004 Jnc deleted Graphiti (PalmOS) (pr request, redir)
- 13:27, 21 Dec 2004 Ta bu shi da yu deleted Common Unix Printing System" (content was: '#REDIRECT [[Common Unix Printing System]]')
- 13:27, 21 Dec 2004 Ahoerstemeier deleted Islamic humanism (content was: 'islamic humanism')
- 13:23, 21 Dec 2004 Chris 73 deleted Second Battle of the Somme (1918) (content was: '{{del}}Large reptiles')
- 13:23, 21 Dec 2004 Chris 73 deleted Executive search
- 13:10, 21 Dec 2004 Chris 73 deleted Hymn to Intellectual Beauty (content was: '{{del}}now living in a mirrior of time')
- 12:52, 21 Dec 2004 Ahoerstemeier deleted User:Norman Rogers (content was: 'This user has been been banned for vandalism. Please revert all edits made and delete his silly articles.' - there is no user with this name nor is that user banned)
- 12:36, 21 Dec 2004 Ahoerstemeier deleted Camden School for Girls (content was: 'Camden School for Girls.')
- 12:20, 21 Dec 2004 Lupo deleted Business trust (content was: '{{delete}}WE ARE LOOKING FOR BUYERS OF PETROLEUM PRODUCT FROM WST AFRICA AND TIMBER WOODS (LUMBER)WE ALSO ASSIST AN INTEREST BUYER OF PRECIOUS META...')
- 12:04, 21 Dec 2004 Lupo deleted Shi Jiuyong (A letter!? )
- 12:01, 21 Dec 2004 Lupo deleted Dbep (Patent nonsense)
- 11:59, 21 Dec 2004 Lupo deleted Polythane (Test page)
- 11:54, 21 Dec 2004 Lupo deleted Infection control (content was: 'safety-syringe')
- 11:54, 21 Dec 2004 Ahoerstemeier deleted Kapang syndrome (content was: 'This is a post created by Al- Andalus IMAGINATION. Hence, it is OPINIONATED, and not FACTUAL')
- 11:52, 21 Dec 2004 Ahoerstemeier deleted Meaning of pros and cons (content was: 'please tell me,what is the meaning of pros and cons? or pros/cons?')
- 11:52, 21 Dec 2004 Ahoerstemeier deleted Cache cold misses (content was: 'The cache miss which occurs for the first time when there is no data in the cache at the start.')
- 11:51, 21 Dec 2004 Ahoerstemeier deleted Setna (content was: 'Did you mean [[Sedna]]?')
- 11:51, 21 Dec 2004 Lupo deleted UNITAF (content was: 'Dadka Uganda ee muslimka ah waa meeqa??')
- 11:51, 21 Dec 2004 Ahoerstemeier deleted Fred Cohen (content was: 'Pravin')
- 11:50, 21 Dec 2004 Ahoerstemeier deleted Voiced labiodental approximant (content was: 'save page and love you')
- 11:50, 21 Dec 2004 Ahoerstemeier deleted IL-6 (content was: 'isa;; saa')
- 11:50, 21 Dec 2004 Ahoerstemeier deleted CD single (content was: 'Singles cd')
- 11:08, 21 Dec 2004 Rbrwr deleted Peugeot 107 (Listed on WP:CP since Dec 7; /Temp ready to replace it; content was: '{{copyvio|url=http://www.psa-peugeot-citroen.com/en/psa_espace/press_releases_details_d1.php?id=405}} --[[User:Rlandmann|Rlandmann]] 05:56, 7 Dec 2004...')
- 11:07, 21 Dec 2004 TPK deleted User:TPK/Drafts/List of Melbourne railway stations (Forgot this was here, or why this was here, for that matter)
- 11:07, 21 Dec 2004 Slowking Man deleted Fundraising india (Advertisement spam)
- 11:06, 21 Dec 2004 Rbrwr deleted Abyssinians (Listed on WP:CP since 7 Dec; copyvio in history, will recreate redirect shortly. content was: '#REDIRECT [[Ethiopia]]')
- 11:05, 21 Dec 2004 Rbrwr deleted Antagonism (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://dictionary.reference.com/search?q=Antagonism}}')
- 11:04, 21 Dec 2004 Slowking Man deleted Ultrasonic assisted machining (content was: 'Ultrasonic assisted machining')
- 11:02, 21 Dec 2004 Rbrwr deleted Mit ocw (Listed on WP:CP since 7 Dec. Deleting copyvio in history; will recreate redirect. content was: '#REDIRECT [[MIT OpenCourseWare]]')
- 11:00, 21 Dec 2004 Slowking Man deleted Vat dye (content was: 'vat dyestuff')
- 10:58, 21 Dec 2004 Rbrwr deleted Mark Stephenson (Listed on WP:CP since 7 Dec; content was: '{{copyvio|url=http://www.iriefm.net/text/artiste_profile.php?artisteid=100}}')
- 10:58, 21 Dec 2004 Ferkelparade deleted Sunan Abu-Dawud (content was: 'test message')
- 10:57, 21 Dec 2004 Rbrwr deleted Shingas (Listed on WP:CP since November 7; content was: '{{copyvio|url=http://www.bchistory.org/beavercounty/BeaverCountyCommunities/Beaverfolder/Shingas/Shingas.html}}')
- 10:41, 21 Dec 2004 Rbrwr deleted Serra da Capivara National Park (Listed on WP:CP since Dec 3; content was: '{{copyvio|url=http://whc.unesco.org/sites/606.htm}} - [[User:Evil saltine|Evil saltine]] 13:34, 3 Dec 2004 (UTC)')
- 10:41, 21 Dec 2004 Rbrwr deleted Atol das Rocas (Listed on WP:CP since Dec 3; content was: '{{copyvio|url=http://whc.unesco.org/sites/1000rev.htm}} - [[User:Evil saltine|Evil saltine]] 13:32, 3 Dec 2004 (UTC)')
- 10:40, 21 Dec 2004 MacGyverMagic deleted Indra Shahdan (content was: '{{deletebecause|nonsense/test}}'''Bold text''''''[[[Image:<math><nowiki>--Kbdank71 20:53, 29 September 2005 (UTC)--Kbdank71 20:53, 29 September 2005 (UTC)--Kbdank71 20:53, 29 September 2005 (UTC)--Kbdank71 20:53, 29 September 2005 (UTC)</nowiki></math>]]]'''')
- 10:40, 21 Dec 2004 MacGyverMagic deleted John L. Kerry (content was: 'who is this guy?{{delete}}')
- 10:40, 21 Dec 2004 Ferkelparade deleted Polythane (content was: '== Headline text ==rtdfydfhryryhyfhyrghsdiufsfgasdrg userfgiseufhasioufhsdiouf g iusdrfisgfsiufgoi ufhadifgsd iuhsdfgioys iysg ir ghsr')
- 10:39, 21 Dec 2004 MacGyverMagic deleted Nizwa (content was: 'nizwa')
- 10:37, 21 Dec 2004 Rbrwr deleted Bom Jesus do Congonhas (Listed on WP:CP since 3 Dec; content was: '{{copyvio|url=http://whc.unesco.org/sites/334.htm}} - [[User:Evil saltine|Evil saltine]] 13:21, 3 Dec 2004 (UTC)')
- 10:33, 21 Dec 2004 Ahoerstemeier deleted Yeah Yeah Yeah Yeah Yeah (content was: 'On a scale of one to awesome the pogues are super great')
- 10:31, 21 Dec 2004 Ahoerstemeier deleted B4U Movies (content was: 'sfadfafsasd')
- 10:04, 21 Dec 2004 Ahoerstemeier deleted Memoria (content was: 'La memoria es el proceso de olvidar y recordar algo.')
- 10:04, 21 Dec 2004 Ahoerstemeier deleted Asper School of Business (content was: 'i want to apply for Master of Bussiness Administration')
- 10:04, 21 Dec 2004 Chris 73 deleted Image:MagdeburgAngles.jpg (moved to the commons)
- 10:04, 21 Dec 2004 Ahoerstemeier deleted 1945 in art (content was: 'cc j mapel élodie et j'aimerais savoir ce ki c pacé en 1945?')
- 10:00, 21 Dec 2004 Slowking Man deleted What is the name of god in christianity (content was: '{{delete}}WHAT IS NAME OF GOD IN CHRISTIANITY ?')
- 09:52, 21 Dec 2004 Rbrwr deleted Norwegian Crown (Listed on WP:CP since Dec 3; content was: '{{copyvio|url=http://www.ncl.com/fleet/12/crown.htm}} - [[User:Evil saltine|Evil saltine]] 12:45, 3 Dec 2004 (UTC)')
- 09:51, 21 Dec 2004 Lupo deleted Sporting venues (content was: '{{delete}}sports law condition in india')
- 09:41, 21 Dec 2004 Rbrwr deleted Rajendra Vaishampayan (Listed on WP:CP since Dec 3; content was: '{{copyvio|url=http://www.samvadiniartiste.com/}}')
- 09:38, 21 Dec 2004 Ahoerstemeier deleted Morgus The Magnificent (content was: '{{delete}}'''WHERE IS DOCTOR MORGUS NOW???????????'''I MISS HIM AND WISH I COULD HEAR FROM HIM AGAIN == Headline text ==HAROLD BENNETT FROM ...')
- 09:36, 21 Dec 2004 Ahoerstemeier deleted Morgus The Magnificent (content was: ''''WHERE IS DOCTOR MORGUS NOW???????????'''I MISS HIM AND WISH I COULD HEAR FROM HIM AGAIN == Headline text ==HAROLD BENNETT FROM PONCHATRIAN...')
- 09:35, 21 Dec 2004 Danny deleted Wisconsin/missisipi river (content was: ''''Bold text''' hello am laurence dim by name i think i met a firend who i fall much in love with but suddenly lost contact with her please she resi...')
- 09:34, 21 Dec 2004 Ahoerstemeier deleted Wax tablet (content was: 'test')
- 09:34, 21 Dec 2004 Ahoerstemeier deleted ZRO (content was: '.')
- 09:32, 21 Dec 2004 Theresa knott deleted Wire cable (content was: 'nbm')
- 09:31, 21 Dec 2004 Theresa knott restored "Payakumbuh"
- 09:31, 21 Dec 2004 Theresa knott deleted Payakumbuh (content was: 'Payakumbuh is a city of north Bukit Tinggi (West Sumatra), Indonesia.')
- 09:30, 21 Dec 2004 Theresa knott deleted Stanislaw Skalski (content was: '[[Image:Example.jpg]]')
- 09:29, 21 Dec 2004 Theresa knott deleted Analytic jurisprudence (content was: 'analytic jurisprudence')
- 09:19, 21 Dec 2004 MacGyverMagic deleted Still's disease/Temp (removing copyvio from history)
- 08:51, 21 Dec 2004 SWAdair deleted Paul Culliford (After removing nonsense and personal attacks, the only content left is a clear CSD#4)
- 08:16, 21 Dec 2004 Academic Challenger deleted Old Rowley (content was: '{{delete}} old rowley')
- 08:15, 21 Dec 2004 Academic Challenger deleted How can i use xml (content was: 'haven{{delete}}')
- 08:12, 21 Dec 2004 Academic Challenger deleted Visesh (content was: '{{db|no content}}')
- 07:56, 21 Dec 2004 Infrogmation deleted Deaf Beats (POV non article; "The Deaf Beats is the name of what is arguably the best thing in industrial music since sliced bread. Or, alternately, since Trent Reznor. " ...)
- 07:45, 21 Dec 2004 Neutrality deleted NicoustiE (content was: '{{vfd}}{{delete}}A [[Finnish]] [[Counter-Strike]] player.Founder of [[NAMC]]')
- 07:29, 21 Dec 2004 Jimfbleak deleted Vince Edwards (content was: 'Vince Edwards')
- 07:28, 21 Dec 2004 Jimfbleak deleted Mother wiki (content was: 'delete}}The mother [[wiki]] is right over here. There are at least a million pages here.{{stub}}')
- 07:28, 21 Dec 2004 Jimfbleak deleted Bad title (content before blanking was: 'aaa')
- 07:18, 21 Dec 2004 Gadfium deleted Image:Africanus.bmp (obsolete)
- 07:17, 21 Dec 2004 Gadfium deleted Image:A380.flightdeck.250pix.jpg (obsolete thumb)
- 07:17, 21 Dec 2004 Gadfium deleted Image:A380.emirates.250pix.jpg (obsolete thumb)
- 07:15, 21 Dec 2004 Gadfium deleted Image:4 bit counter.jpg (Moved to commons)
- 07:02, 21 Dec 2004 Gadfium deleted Frame of the fixed stars (Moved to IP's talk page)
- 07:00, 21 Dec 2004 Mikkalai deleted Opinion (content was: '{{copyvio|url=http://dictionary.reference.com/search?q=opinion&r=67}}')
- 06:59, 21 Dec 2004 Mikkalai deleted Recommendations (content was: '#REDIRECT [[Recommendation]]')
- 06:59, 21 Dec 2004 Gadfium deleted Death on the Reik (VfD decided to delete)
- 06:55, 21 Dec 2004 Mikkalai deleted Grass script (content was: '{{delete}}dragon')
- 06:54, 21 Dec 2004 Gadfium deleted Bennet (content was: '{{del}}== '''THE FABULOUS BENNET''' ==is the hero of the flood of the Oder, the first man on moon, the greatest forum operator ever and one of world...')
- 06:52, 21 Dec 2004 Gadfium deleted Adamdiz (content was: '{{del}}Adam Diz is an author from Arizona. He has written fourteen novels about homosexuality in America.' No Google or Amazon hits, possibly fictional)
- 06:48, 21 Dec 2004 Neutrality deleted Cypress, Texas (content was: 'A suburb of [[Houston, Texas]] located in the northwesten part of the city.')
- 06:48, 21 Dec 2004 Gadfium deleted Zetasystems (content was: '{{delete}}Scott Snyder's webdesigns and webprojects.He is cool and sexy.')
- 06:47, 21 Dec 2004 Neutrality deleted Consuelo Duval (content was: ''''Consuelo Duval''' was born [[January 11]], [[1969]] in [[Chihuahua]], [[Chihuahua]], [[Mexico]].')
- 06:47, 21 Dec 2004 Neutrality deleted Edith Gonzalez (content was: ''''Edith Gonzalez''' was born [[December 10]] [[1966]] in [[Monterrey]], [[Nuevo Leon]], [[Mexico]].')
- 06:47, 21 Dec 2004 Neutrality deleted Susana Gonzalez (content was: ''''Susana Gonzalez''' was born [[October 2]], [[1973]] in [[Calera]], [[Zacatecas]], [[Mexico]].')
- 06:47, 21 Dec 2004 Neutrality deleted Records management (content was: 'Lets check how this works dude')
- 06:46, 21 Dec 2004 Neutrality deleted Threatphd (content was: 'Threatphd is a screen name used by a spammer on AOL Instant Messenger.')
- 06:46, 21 Dec 2004 Neutrality deleted Rabbitries (content was: 'People who raise rabbits have ''rabbitries''. They house the rabbits there.')
- 06:46, 21 Dec 2004 Neutrality deleted Maresa Hoerbiger (content was: 'Marisa Hoerbiger (b. 1945)')
- 06:46, 21 Dec 2004 Mikkalai deleted Equagesic (content was: 'Each tablet of Equagesic contains 200 mg meprobamate and 325 mg aspirin. The inactive ingredients present are cellulose, D&C Yellow 10, FD&C Red ...')
- 06:42, 21 Dec 2004 Niteowlneils deleted Image:LocationNepal.png (moved to commons under same name)
- 06:42, 21 Dec 2004 Niteowlneils deleted Image:LocationQatar.png (moved to commons under same name)
- 06:42, 21 Dec 2004 Niteowlneils deleted Image:LocationSanMarino.png (moved to commons under same name)
- 06:42, 21 Dec 2004 Gadfium deleted Yoshi Stadium (content was: '{{del}}[http://www.yoshistadium.vze.com/ Click Here To Visit]A Nintendo-oriented site that featues contests and stories.')
- 06:42, 21 Dec 2004 Niteowlneils deleted Image:LocationTuvalu.png (moved to commons under same name)
- 06:41, 21 Dec 2004 RedWolf deleted Andrew nettebberg (content was: 'andrew Netteburg: respect scale1. Jesus2. Cat food 2 1/2. thao3. hokkenen4. benson and crew5. rabaiisdefinition FAG')
- 06:41, 21 Dec 2004 Niteowlneils deleted Image:LocationHonduras.png (moved to commons under same name)
- 06:41, 21 Dec 2004 Niteowlneils deleted Image:LocationIraq.png (moved to commons under same name)
- 06:41, 21 Dec 2004 Niteowlneils deleted Image:LocationKuwait.png (moved to commons under same name)
- 06:41, 21 Dec 2004 Niteowlneils deleted Image:LocationLebanon.png (moved to commons under same name)
- 06:41, 21 Dec 2004 Niteowlneils deleted Image:LocationLuxembourg.png (moved to commons under same name)
- 06:39, 21 Dec 2004 Gadfium deleted Undeniable (content was: '{{del}}Hi my name is Nakita Benjamin. I am a African American Women will become a American idol.Yep I'm funnny, fun,and alway act dum that I'm perfe...')
- 06:38, 21 Dec 2004 DJ Clayworth deleted Steven and elisabeth (content was: 'STEVEN J. H. AND ELISABETH S. Y. ARE T3H BEST OF FRIENDS FOREVZZZla la la love! <3she loves him yeah yeah yeah')
- 06:36, 21 Dec 2004 Gadfium deleted Tigergirl (content was: '{{deletebecause|Vanity, wikispam, unverifiable}}Webmaster, of Pokemon Country. She is known for her artistic skills, and is on the path to becoming ...')
- 06:34, 21 Dec 2004 Gadfium deleted Template:MBTI citations (content was: '{{delete|No longer needed. Was finding a bug workaround}}')
- 06:34, 21 Dec 2004 DJ Clayworth deleted Mary Sue Coleman (content was: 'President of the University of Michigan and corporate tool')
- 06:34, 21 Dec 2004 Mikkalai deleted Mathematical Methods of Electronics (content was: '== Headline text ==Wow I hope someone posts something here!')
- 06:34, 21 Dec 2004 Gadfium deleted Template:Alterego (content was: '{{deletebecause|I was using this template as a testing platform for interwiki templates, which don't work, so it is no longer needed. ty}}--[[User:Al...')
- 06:33, 21 Dec 2004 Niteowlneils deleted Whiney Douchebag (I tend to agree, but...content was: '{{del}}#REDIRECT [[Bill O'Reilly (commentator)]]')
- 06:33, 21 Dec 2004 Mikkalai deleted Bradwell v. Illinois (content was: 'edit')
- 06:32, 21 Dec 2004 Mikkalai deleted 9 schools of magic (content was: 'Abjuration,Alteration,Divination,Enchantment/Charm, Invocation/Evocation,Illusion/Phantasm,Necromancy, Conjuration/Summoning,Lesser Divination.......')
- 06:32, 21 Dec 2004 Niteowlneils deleted Talk:Roundworm (content was: '{{del}}[[Link title]]loserdlsdlsjdfljskldfklsdhlkfhlskdjs;dnf;sdjl;fjsdsdlmflsjdhfl'shdofhlkdhsf'k')
- 06:31, 21 Dec 2004 Niteowlneils deleted The Young Flying Fox (content was: '{{delete}}Á')
- 06:30, 21 Dec 2004 Niteowlneils deleted Spongymedia (content was: '{{del}}')
- 06:30, 21 Dec 2004 Niteowlneils deleted SDIO (content was: '{{del}}Seems strange to have a link with '''NO CONTENT'''?')
- 06:30, 21 Dec 2004 Gadfium deleted Robert Stanbury (content was: '{{delete}}Robert Stanbury succedded Herb Gray as Minister.')
- 06:29, 21 Dec 2004 Gadfium deleted Rob cockerham (content was: '{{db|vanity, linkspam}}Rob Cockerham is a online prankster who runs [[cockeyed.com]]')
- 06:28, 21 Dec 2004 Gadfium deleted Rachit (content was: '{{delete}}Me - Rachit Parikh - NY - CU Yay!!')
- 06:27, 21 Dec 2004 Gadfium deleted Potassium chromate (nonsense, then blanked)
- 06:26, 21 Dec 2004 Gadfium deleted Phalapatate (nonsense)
- 06:25, 21 Dec 2004 Niteowlneils deleted Incidentalism (previously VfDed-recreated)
- 06:24, 21 Dec 2004 Gadfium deleted Paperhanger (content was: '{{del}}The truth will always appear')
- 06:14, 21 Dec 2004 Gadfium deleted Nihon Kokugo Daijiten (content was: 'pirate codekill them alllet god sort them out{{delete}}')
- 06:13, 21 Dec 2004 DJ Clayworth deleted List of letters in the alphabet between A and C (content was: '* [[B]]')
- 06:11, 21 Dec 2004 Gadfium deleted Nicholas Alexander Diak (content was: '{{delete}}'''Nicholas Alexander Diak''' see [[Nick Diak]]')
- 06:07, 21 Dec 2004 Wile E. Heresiarch deleted Michael Edrington (per vfd; see: [[Wikipedia:Votes for deletion/Michael Edrington]])
- 06:07, 21 Dec 2004 Wile E. Heresiarch deleted Abo-Basha (per vfd; see: [[Wikipedia:Votes for deletion/Abo-Basha]])
- 06:06, 21 Dec 2004 DJ Clayworth deleted Valaryc (recreation of previously deleted page)
- 06:05, 21 Dec 2004 Wile E. Heresiarch deleted Clone Françoise (same as deleted article [[Boris Bertrand]])
- 06:04, 21 Dec 2004 Wile E. Heresiarch deleted Boris Bertrand (per vfd; see: [[Wikipedia:Votes for deletion/Boris Bertrand]])
- 06:03, 21 Dec 2004 Wile E. Heresiarch deleted Oglinda (per vfd; see: [[Wikipedia:Votes for deletion/Oglinda]])
- 06:03, 21 Dec 2004 Wile E. Heresiarch deleted Salim Thaivalappil (per vfd; see: [[Wikipedia:Votes for deletion/Salim Thaivalappil]])
- 05:58, 21 Dec 2004 Wile E. Heresiarch deleted Talk:Historical reconstruction of the sort of person Jesus would be (talk page of deleted article)
- 05:58, 21 Dec 2004 Wile E. Heresiarch deleted Historical reconstruction of the sort of person Jesus would be (per vfd; see: [[Wikipedia:Votes for deletion/Historical reconstruction of the sort of person Jesus would be]])
- 05:57, 21 Dec 2004 Joy Stovall deleted Lokks ((VFD consensus to delete) content was: '----Lokks is a norwegian plyercheck out his homepage [http://www.home.no/lokks lokks]Lokks plays [[FPS]] games like, [[Counter-Strike]], [[Quake...')
- 05:55, 21 Dec 2004 Joy Stovall deleted Paratodos (vfd consensus to delete)
- 05:52, 21 Dec 2004 Wile E. Heresiarch deleted The Superluminal Pachyderm (per vfd; see: [[]Wikipedia:Votes for deletion/The Superluminal Pachyderm])
- 05:52, 21 Dec 2004 Wile E. Heresiarch deleted Peanut butter jelly time (per vfd; see: [[Wikipedia:Votes for deletion/Peanut butter jelly time]])
- 05:51, 21 Dec 2004 Wile E. Heresiarch deleted R7 Droids (per vfd; see: [[Wikipedia:Votes for deletion/R7 Droids]])
- 05:51, 21 Dec 2004 Wile E. Heresiarch deleted Ginga (per vfd; see: [[Wikipedia:Votes for deletion/Ginga]])
- 05:50, 21 Dec 2004 Wile E. Heresiarch deleted Talk:Nuts2U (talk page of deleted article)
- 05:50, 21 Dec 2004 Joy Stovall deleted Crescsoft Ltd. (VFD consensus to delete)
- 05:50, 21 Dec 2004 Wile E. Heresiarch deleted Nuts2U (per vfd; see: [[Wikipedia:Votes for deletion/Nuts2U]])
- 05:49, 21 Dec 2004 Wile E. Heresiarch deleted Dmop (per vfd; see: [[Wikipedia:Votes for deletion/Dmop]])
- 05:49, 21 Dec 2004 Wile E. Heresiarch deleted Sean Keesler (per vfd; see: [[Wikipedia:Votes for deletion/Sean Keesler]])
- 05:42, 21 Dec 2004 Joy Stovall deleted Var, Bar mean son (VFD consensus to delete)
- 05:41, 21 Dec 2004 SimonP deleted Zancho-San (listed on VfD, no objections to deletion)
- 05:40, 21 Dec 2004 SimonP deleted Sonicultra (listed on VfD, no objections to deletion)
- 05:40, 21 Dec 2004 SimonP deleted Grunt Rebellion (listed on VfD, votes 4-1 in favour of deletion)
- 05:39, 21 Dec 2004 SimonP deleted Dragonmaw (content was: '#REDIRECT:[[Dragonmaw Clan]]')
- 05:39, 21 Dec 2004 SimonP deleted Dragonmaw Clan (listed on VfD, no objections to deletion)
- 05:38, 21 Dec 2004 SimonP deleted Thaddeus J. Hogan (listed on VfD, no objections to deletion)
- 05:35, 21 Dec 2004 SimonP deleted Justin lange (listed on VfD, no objections to deletion)
- 05:34, 21 Dec 2004 Gadfium deleted MediaWiki talk:VfD-Battling companion (content was: '{{db|leftover related to a previously speedy-deleted article. Delete [[MediaWiki:VfD-Battling companion]], then return and delete this talk page itsel...')
- 05:34, 21 Dec 2004 Gadfium deleted MediaWiki:VfD-Battling companion (content was: 'From Cleanup: [[Battling companion]] - needs some cleanup, plus unsure if anyone recognized this genre other than the author. (imported from Cleanup b...')
- 05:33, 21 Dec 2004 Gadfium deleted Michael Kiske (content was: '{{db|Nonsense}}HE LOST HIS PENIS IN A COCK FIGHT')
- 05:33, 21 Dec 2004 Gadfium deleted MediaWiki talk:VfD-3D-program (content was: '{{db| misplaced comment in wrong namespace. Please delete the main [[MediaWiki:VfD-3D-program]] and then return and delete this talk page itself. }}')
- 05:33, 21 Dec 2004 Gadfium deleted MediaWiki:VfD-3D-program (content was: 'I can't believe there is anything here that isn't better covered somewhere else. At most, we should find the right article to make this a redirect to,...')
- 05:31, 21 Dec 2004 Gadfium deleted Marcus Jackson (content was: '{{del}}Marcus Jackson is a 26 year old male from Louisville Kentucky who has 3 kids Markayla Marcus jr and Destiney Jackson')
- 05:31, 21 Dec 2004 Ssd deleted Category:Spanish Plays (moved to [[Category:Spanish plays]])
- 05:31, 21 Dec 2004 SimonP deleted David Jonathan Adams (listed on VfD, no objections to deletion)
- 05:30, 21 Dec 2004 Gadfium deleted Kraventech (content was: '{{Del}}Roleplay Game Design Company<br>KravenTech 1997-2005<br>Created By Derek Hays')
- 05:30, 21 Dec 2004 Gadfium deleted Khvarshi language (content was: '{{delete}}girl')
- 05:29, 21 Dec 2004 Gadfium deleted Jacob Christian Schäffern (content was: '{{del}}Jacob Christian Schaffern')
- 05:28, 21 Dec 2004 Gadfium deleted JKaizer (Abusive content)
- 05:28, 21 Dec 2004 DJ Clayworth deleted Cecilier (content was: 'A Cecilier is a slang phrase for someone who lies about cybering on the internet, most specifically MMORPG's.')
- 05:28, 21 Dec 2004 Ssd deleted Category:E class submarines (ambiguous)
- 05:28, 21 Dec 2004 Ssd deleted Category:O class submarines (ambiguous)
- 05:28, 21 Dec 2004 Ssd deleted Category:T class submarines (ambiguous)
- 05:28, 21 Dec 2004 Ssd deleted Category:U class submarines (ambiguous)
- 05:24, 21 Dec 2004 Ssd deleted Category:United States members of Congress (moved to [[Category:Members of the U.S. Congress]])
- 05:23, 21 Dec 2004 Ssd deleted Category:Wickes Class destroyers (moved to [[Category:Wickes class destroyers]])
- 05:23, 21 Dec 2004 DJ Clayworth deleted Cecilier (content was: 'Caught having cybersex in a video game.You got caught doing the Celilier in Everquest II, bitch!')
- 05:18, 21 Dec 2004 SimonP deleted International definition (listed on VfD, votes 5-1 in favour of deletion)
- 05:17, 21 Dec 2004 DJ Clayworth deleted Nunc pro tunc (content was: 'nunc pro tunc')
- 05:17, 21 Dec 2004 Mikkalai deleted IBlog (content was: '{{db|I have no idea, nonsense I guess.}}What happend, I wrote an article here. Where did it go?Can someone send me an mail, to tell.... [mailto...')
- 05:17, 21 Dec 2004 SimonP deleted Firas Mahmoud (listed on VfD, no objections to deletion)
- 05:16, 21 Dec 2004 SimonP deleted Filled Milk Act (listed on VfD, votes 5-2 in favour of deletion)
- 05:14, 21 Dec 2004 SimonP deleted Hotel Industry under SARS (listed on VfD, no objections to deletion)
- 05:14, 21 Dec 2004 Ssd deleted Category:Stubs (empty and redundant category)
- 05:14, 21 Dec 2004 SimonP deleted Dina Hussmann (listed on VfD, no objections to deletion)
- 05:13, 21 Dec 2004 SimonP deleted Garrett Lewis (listed on VfD, no objections to deletion)
- 05:12, 21 Dec 2004 DJ Clayworth deleted Rocking chair (sex position) (we're very happy for you, but no need to tell everyone)
- 05:10, 21 Dec 2004 Mikkalai restored "List_of_Pantheists"
- 05:10, 21 Dec 2004 Ssd deleted Category:Japanese Prefectures (moved to [[Category:Japanese prefectures[[)
- 05:09, 21 Dec 2004 Mikkalai deleted List of Pantheists (vandal cut'n'paste the same text into many places)
- 05:09, 21 Dec 2004 Mikkalai deleted Talk:List of Pantheists (vandal cut'n'paste the same text into many places)
- 05:08, 21 Dec 2004 Ssd deleted Category:Tokyo prefecture (respell with proper cap.)
- 05:07, 21 Dec 2004 SimonP deleted Wicked WiZardZ (listed on VfD, no objections to deletion)
- 05:06, 21 Dec 2004 SimonP deleted NewsGator (listed on VfD, no objections to deletion)
- 05:05, 21 Dec 2004 Ssd deleted Category:Nagasaki prefecture (respell with proper cap.)
- 05:05, 21 Dec 2004 Ssd deleted Category:Nara prefecture (respell with proper cap.)
- 05:05, 21 Dec 2004 Ssd deleted Category:Niigata prefecture (respell with proper cap.)
- 05:05, 21 Dec 2004 Ssd deleted Category:Oita prefecture (respell with proper cap.)
- 05:05, 21 Dec 2004 Ssd deleted Category:Osaka prefecture (respell with proper cap.)
- 05:05, 21 Dec 2004 Ssd deleted Category:Saga prefecture (respell with proper cap.)
- 05:05, 21 Dec 2004 Ssd deleted Category:Saitama prefecture (respell with proper cap.)
- 05:04, 21 Dec 2004 Ssd deleted Category:Shimane prefecture (respell with proper cap.)
- 05:04, 21 Dec 2004 Ssd deleted Category:Shizuoka prefecture (respell with proper cap.)
- 05:04, 21 Dec 2004 Ssd deleted Category:Tottori prefecture (respell with proper cap.)
- 05:04, 21 Dec 2004 Ssd deleted Category:Yamagata prefecture (respell with proper cap.)
- 05:04, 21 Dec 2004 Ssd deleted Category:Shiga prefecture (respell with proper cap.)
- 04:57, 21 Dec 2004 Quadell deleted Image:FA-18.KC-10.drogue.small.png (thumbnail)
- 04:54, 21 Dec 2004 Quadell deleted Image:Eyed-elater-2.jpg (scaled-up duplicate image)
- 04:51, 21 Dec 2004 Mikkalai deleted Davis Drive Middle School (content was: '{{cleanup}}Davis Drive Middle School is a school in [[Cary, North Carolina]].The school consist special programs, attendance, autistic, dance, keybo...')
- 04:51, 21 Dec 2004 Quadell deleted Image:Eyck.hubert.mary.250pix.jpg (thumbnail)
- 04:51, 21 Dec 2004 Quadell deleted Image:Eyck.hubert.lamb.350pix.jpg (thumbnail)
- 04:50, 21 Dec 2004 DJ Clayworth deleted Bukkacracy (content was: ''''Bukkacracy''' really exists! Do not let them fool or censor you!')
- 04:48, 21 Dec 2004 Ssd deleted Category:Kagoshima prefecture (respell with proper cap.)
- 04:48, 21 Dec 2004 Ssd deleted Category:Kochi prefecture (respell with proper cap.)
- 04:48, 21 Dec 2004 Ssd deleted Category:Kumamoto prefecture (respell with proper cap.)
- 04:47, 21 Dec 2004 Ssd deleted Category:Mie prefecture (respell with proper cap.)
- 04:47, 21 Dec 2004 Ssd deleted Category:Miyazaki prefecture (respell with proper cap.)
- 04:47, 21 Dec 2004 Ssd deleted Category:Miyagi prefecture (respell with proper cap.)
- 04:45, 21 Dec 2004 Ssd deleted Category:Ibaraki prefecture (respell with proper cap.)
- 04:45, 21 Dec 2004 Ssd deleted Category:Iwate prefecture (respell with proper cap.)
- 04:45, 21 Dec 2004 Ssd deleted Category:Ishikawa prefecture (respell with proper cap.)
- 04:45, 21 Dec 2004 Francs2000 deleted Containment theory (content was: 'this theory states that all *** are *****')
- 04:45, 21 Dec 2004 Ssd deleted Category:Kagawa prefecture (respell with proper cap.)
- 04:45, 21 Dec 2004 Mikkalai deleted Leonardo el inventor (content was: 'Leonardo el inventor is a cd-rom in Spanish, with the company Softkey Multimedia.The cd-rom contains to choose other languages, including English, Sp...')
- 04:45, 21 Dec 2004 Ssd deleted Category:Hyogo prefecture (respell with proper cap.)
- 04:43, 21 Dec 2004 Ssd deleted Category:Heart anatomy (moved to [[category:cardiac anatomy]])
- 04:42, 21 Dec 2004 DJ Clayworth deleted Bukkacracy (patent nonsense)
- 04:42, 21 Dec 2004 Ssd deleted Category:Heart (moved to [[category:cardiovascular system]])
- 04:41, 21 Dec 2004 DJ Clayworth deleted Thapster (content was: ''''thapster''' is an online [[wife-swapping]] website, based off of [[napster]]. it currently receives sixty million hits per day.')
- 04:41, 21 Dec 2004 Francs2000 deleted PKI Innovations (content was: '{{delete}}test')
- 04:40, 21 Dec 2004 Francs2000 deleted Dictionary Table Tennis (content was: '''see [[Lexicon Ping-Pong]]''')
- 04:40, 21 Dec 2004 Francs2000 deleted Lexicon Ping-Pong (content was: '''see [[Dictionary Table Tennis]]''')
- 04:40, 21 Dec 2004 DJ Clayworth deleted Juvenal Olmos (content was: 'hf')
- 04:39, 21 Dec 2004 Francs2000 deleted Kelly Scurry (content was: 'Kelly Scurry- Jeopardy contestant in the Fall 2004 Jeopardy Kids Week show.')
- 04:39, 21 Dec 2004 Quadell deleted Image:Evolsex-dia3.png (duplicate)
- 04:39, 21 Dec 2004 Quadell deleted Image:Evolsex-dia2.png (duplicate)
- 04:39, 21 Dec 2004 Quadell deleted Image:Evolsex-dia1.png (duplicate)
- 04:38, 21 Dec 2004 Francs2000 deleted Jason c (content was: 'All men are jerks especially jason c')
- 04:38, 21 Dec 2004 Jwrosenzweig deleted Necrobation (content was: ''''necrobation''' is the involuntary masturbation that [[corpses]] exhibit when they die. it occurs before rigor mortis. people who masturbate too oft...')
- 04:33, 21 Dec 2004 Mikkalai deleted Wittnau (content was: '{{delete}}My ancestors came from Wittnau in the district of laufenberg in the region of Fricktal. I would like to do some research of the Name HUSNER...')
- 04:32, 21 Dec 2004 Mikkalai deleted Swapna (content was: 'Swapna is a common name in Maharashtra, India.Swapna means a sweet dream.')
- 04:30, 21 Dec 2004 Mikkalai deleted Fanfilms (content was: 'This website is a bunch of fucking bullshit')
- 04:29, 21 Dec 2004 Mikkalai deleted Political party consisting of workers and farmers (content was: '{{del}}I have no idea')
- 04:29, 21 Dec 2004 Quadell deleted Image:Eurasian.wigeon.arp.250pix.jpg (thumbnail)
- 04:28, 21 Dec 2004 Rmhermen deleted Rape hawk (content was: '{{vfd}}the '''rape hawk''' is a [[predatory]] [[bird]], the only animal on earth to [[rape]] its [[prey]] before killing at eating it. rape hawks ha...')
- 04:26, 21 Dec 2004 Quadell deleted Image:Estonian SSR flag medium.png (thumbnail)
- 04:26, 21 Dec 2004 Mikkalai deleted England caused the American Civil War (content was: '{{db|Hi, I'm a hyperactive RC patrolling wikipedian. Pleased to meet you}}HiLOve mei'm a hyperoveractiveelderlynursing-homeresidentfromsilly...')
- 04:25, 21 Dec 2004 Mikkalai deleted Eidenalogy (there is no such word. content was: '{{cleanup}}Eidenalogy:Branch of history emphasizing logic or empiricism over testimony in reconstructing the past.Eidenalogists hold that all writt...')
- 04:24, 21 Dec 2004 Chris 73 deleted St. Niklausen (content was: 'Lake Lucerne')
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Numbered Municipalities.png (Duplicate image)
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map with Vila Velha Municipality Highlighted.png (Duplicate image)
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map with Viana Municipality Highlighted.bmp (Listed on IFD for a long time)
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map with Venda Nova do Imigrante Municipality Highlighted.png (Duplicate image)
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map with Marechal Floriano Municipality Highlighted.png (Duplicate image)
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map with Linhares Municipality Highlighted.png (Duplicate image)
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map with Domingos Martins Municipality Highlighted.png (Duplicate image)
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map with Afonso Claudio Municipality Highlighted.png (Duplicate image)
- 04:21, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map With Serra Municipality Highlighted.png (Duplicate image)
- 04:19, 21 Dec 2004 Mikkalai deleted Category:Military history of Poland during World War II (content was: '[[Category:Polish history]][[Category:World War II national military histories]]')
- 04:18, 21 Dec 2004 Neutrality deleted Talk:Battle for The Nazereth Fortress (content was: '==Removal of notices==This article has not been 'wikified'. If you'd like to wikify it, do so. Then, and not before, remove the 'wikify' notice.The...')
- 04:18, 21 Dec 2004 Chris 73 deleted Borthering (content was: 'A deviation of the word Bothering, became popular with a small group of Xbox fans in the Xbox website ring.')
- 04:18, 21 Dec 2004 Neutrality deleted Battle for The Nazereth Fortress (Delete (patent nonsense). content was: 'During a long time of war between many towns, empires were formed and controlled by great leaders. During this time a great battle took place between Ramzi Dugan's forces, an Vinnie's forces. Vinne controled all of a town called Tatamy, and the Naereth Middle School. Ramzi Controlled Nazereth, Scafer School, and The High School. Chris Crommie Controled Easton, and was allied with Philipsburg. Vinnie had a force of 450,000 within NAMS, and Ramzi had an assult force of 670,000 men. This would be one of thee most desicive battles, but not the most decicive. At NAMS Vinnie's forces had Floors full of archers, and basstillas on the roof, he also placed infantry at all entrances, and towards the back he possisioned an extra 300,000 men.')
- 04:18, 21 Dec 2004 Mikkalai deleted Warm war (content was: 'The '''Warm War''' existed during the cold war era. It existed mainly becuase of the colony in Korea departed to Russia for search of communism. It en...')
- 04:18, 21 Dec 2004 Quadell deleted Image:Espirito Santo Map With Linhares Municipality Highlighted.bmp (Listed on ifd for a long time)
- 04:18, 21 Dec 2004 Joy Stovall deleted Definition of religion (VFD consensus to delete)
- 04:17, 21 Dec 2004 Joy Stovall deleted Talk:Definition of religion (Associated article deleted by VFD consensus)
- 04:13, 21 Dec 2004 Joy Stovall deleted Big bullies (VFD consensus to delete)
- 04:11, 21 Dec 2004 Quadell deleted Image:Erechtheum SW-250px.jpg (thumbnail)
- 04:09, 21 Dec 2004 Quadell deleted Image:Er-TableImage.png (thumbnail)
- 04:08, 21 Dec 2004 Joy Stovall deleted Mhatma (VFD consensus to delete)
- 04:06, 21 Dec 2004 Chris 73 deleted Neopian (content was: 'Neopian is a word used on Neopets, and it means 'Having to do with Neopets or Neopia'')
- 04:05, 21 Dec 2004 SWAdair deleted MediaWiki:VfD- (page created in error by typo, no relevant inward links)
- 04:04, 21 Dec 2004 SWAdair deleted Template:VfD- (page created in error by typo, no relevant inward links)
- 04:01, 21 Dec 2004 Quadell deleted Image:Equaguineaarms22.PNG (thumbnail)
- 04:00, 21 Dec 2004 Mikkalai deleted Treaty of Basel (content was: '{{del}}moose')
- 04:00, 21 Dec 2004 Chris 73 deleted Adductor brevis muscle (content was: 'Muscles of the thigh')
- 04:00, 21 Dec 2004 Quadell deleted Image:Ephesus library-250px.jpg (thumbnail)
- 04:00, 21 Dec 2004 Quadell deleted Image:Epipactis helleborine vignette.jpg (thumbnail)
- 03:59, 21 Dec 2004 Joy Stovall deleted Kestra (VFD consensus to delete)
- 03:59, 21 Dec 2004 Chris 73 deleted Egyptian Cobra (content was: '{{del}}A very dangerous snake; don't touch it. If you see it, you better run. Look out. If it bites you, you will die. My advice is not to travel...')
- 03:57, 21 Dec 2004 Quadell deleted Image:Eoliagar-thumb.jpg (thumbnail)
- 03:55, 21 Dec 2004 Quadell deleted Image:EnthanasiePropagandaKlein.jpg (thumbnail)
- 03:54, 21 Dec 2004 Joy Stovall deleted Feghali (VFD consensus to delete)
- 03:52, 21 Dec 2004 Mikkalai deleted Mas sucks (content was: '{{del}}It's called breathing.')
- 03:52, 21 Dec 2004 Quadell deleted Image:English-Electric-Canberra-s.jpg (thumbnail)
- 03:51, 21 Dec 2004 Joy Stovall deleted Brian Rice (VFD consensus to delete)
- 03:51, 21 Dec 2004 Chris 73 deleted Gianna Nannini (content was: 'Italian rock singer')
- 03:50, 21 Dec 2004 Quadell deleted Image:Enceladus moon (small).jpg (thumbnail)
- 03:47, 21 Dec 2004 Chris 73 deleted Guglielmo Borremans (content was: 'Guglielmo Borremans (1670-1744)')
- 03:46, 21 Dec 2004 Rlandmann deleted 7.62x39mm Soviet M1943 (content was: 'velocity')
- 03:45, 21 Dec 2004 SimonP deleted Cerro Santa Lucía, Chile (content was: 'ty')
- 03:45, 21 Dec 2004 Quadell deleted Image:Emu small 300px.jpg (thumbnail)
- 03:44, 21 Dec 2004 Mikkalai deleted John Pitcairn (content was: '{{del}}he was aganst the us')
- 03:44, 21 Dec 2004 Joy Stovall deleted Beer Wolf (VFd consensus to delete)
- 03:43, 21 Dec 2004 Mikkalai deleted TWGSS (content was: '{{del}}TWGSS is a EMI school.Today we had picnic.But we didn't had.')
- 03:43, 21 Dec 2004 Joy Stovall deleted "Beer Wolf" ((Target article deleted) content was: '#REDIRECT [[Beer Wolf]]')
- 03:43, 21 Dec 2004 Mikkalai deleted Christian Anti-Communism Crusade (content was: '{{del}}well like ya know like the Christian Anti-Communism Crusade thingy like like a bunch of fundementalist Christians Right-wingers which lime don...')
- 03:43, 21 Dec 2004 Quadell deleted Image:Emperor penguin small.jpg (thumbnail)
- 03:43, 21 Dec 2004 Quadell deleted Image:Emperor.goose.slimb.250pix.jpg (thumbnail)
- 03:43, 21 Dec 2004 Quadell deleted Image:Emperor.goose.arp.250pix.jpg (thumbnail)
- 03:42, 21 Dec 2004 Mikkalai deleted Baktoid Armour Workshop (content was: 'baktoid armor workshop')
- 03:41, 21 Dec 2004 Mikkalai deleted Linux (washing powder (content was: 'asdfasdf')
- 03:41, 21 Dec 2004 Rlandmann deleted Turdblossum (content was: '}#REDIRECT [[Karl Rove]]')
- 03:41, 21 Dec 2004 Quadell deleted Image:EmmaHamilton(small).jpeg (thumbnail)
- 03:40, 21 Dec 2004 Chris 73 deleted William Thaw (content was: 'big time pittsburgh pimp')
- 03:40, 21 Dec 2004 Rfl deleted Greg Zanone (content was: '{{delete}}See '''[[Lazy]]'''An uber kid, but uber lazy.')
- 03:34, 21 Dec 2004 Joy Stovall deleted Tommy Bare (VFD consensus to delete)
- 03:34, 21 Dec 2004 Neutrality deleted Image talk:Emancipation proclamation.jpg (content was: 'ass holes')
- 03:34, 21 Dec 2004 Quadell deleted Image:EmersonLakeAndPalmerLiveAtTheIsleOfWightFestival1970 small.jpg (thumbnail)
- 03:30, 21 Dec 2004 Quadell deleted Image:Emblem of oman.gif (Image has errors and does not display)
- 03:30, 21 Dec 2004 Quadell deleted Image:Emblem of India.png (duplicate)
- 03:23, 21 Dec 2004 Rfl deleted Cybershell13 (content was: '{{deleteagain}}')
- 03:23, 21 Dec 2004 Quadell deleted Image:Elko, NV-300px.JPG (thumbnail)
- 03:20, 21 Dec 2004 Bkonrad deleted Mas sucks (content was: '{{del}}It's true!')
- 03:20, 21 Dec 2004 Rfl deleted Cybershell13 (content was: '{{delete}}WHOAMG, This article is dedicated to a person named Cybershell13. He lives in the worst state in America, Washington')
- 03:19, 21 Dec 2004 Quadell deleted Image:Svastikasana.png (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:Virasana.png (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:Vajrasana.png (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:English types.JPG (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:Faqquest.gif (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:Jeandarc.JPG (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:Photo2tn.jpg (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:Padmasana.png (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:Super Kamiokande schematic small.png (Image listed on ifd since Dec 13)
- 03:19, 21 Dec 2004 Quadell deleted Image:Super Kamiokande schematic.png (Image listed on ifd since Dec 13)
- 03:18, 21 Dec 2004 Quadell deleted Image:Super Kamiokande boat small.jpg (Image listed on ifd since Dec 13)
- 03:18, 21 Dec 2004 Quadell deleted Image:Super Kamiokande boat.jpg (Image listed on ifd since Dec 13)
- 03:18, 21 Dec 2004 Quadell deleted Image:Super Kamiokande Neutrino Event small.png (Image listed on ifd since Dec 13)
- 03:18, 21 Dec 2004 Quadell deleted Image:Super Kamiokande Neutrino Event.png (Image listed on ifd since Dec 13)
- 03:18, 21 Dec 2004 Quadell deleted Image:Skoda logo.jpg (Image listed on ifd since Dec 13)
- 03:13, 21 Dec 2004 Niteowlneils deleted Image:LocationCostaRica.png (moved to commons under same name)
- 03:13, 21 Dec 2004 Niteowlneils deleted Image:LocationBelize.png (moved to commons under same name)
- 03:13, 21 Dec 2004 Niteowlneils deleted Image:LocationEstonia.png (moved to commons under same name)
- 03:13, 21 Dec 2004 Niteowlneils deleted Image:LocationElSalvador.png (moved to commons under same name)
- 02:49, 21 Dec 2004 Rfl deleted Mitchell Izower (content was: '{{db|Mitchell actually loves penis FOR GREAT JUSTICE}}I loved the penis, and the penis loved me.XDXDXDXDXDXDXDXD')
- 02:47, 21 Dec 2004 Gadfium deleted Image:White.faced.whistling.duck.250pix.jpg (====November 14====
- [[:Image:Exchange arcade.jpg]] - uploaded last month, no info. [[User:Steinsky|Joe D]] [[User talk:Steinsky|(t)]] 22:55, 13 Nov 2004 (UTC)
- 02:46, 21 Dec 2004 Infrogmation deleted Cuba's Financial (content was: '{{delete}}Cuba is in a current Finacial Crisis. This means, they have less money due to Castro running them into the whole. He did do some good for ...')
- 02:45, 21 Dec 2004 Infrogmation deleted Image:Sjuancruz.jpg (WP:PUI & tagged for deletion )
- 02:45, 21 Dec 2004 Gadfium deleted Image:Exchange arcade.jpg (On PUI for more than 30 days without resolution)
- 02:44, 21 Dec 2004 Gadfium deleted Image:WingRutland400.jpg (On PUI for more than 30 days without resolution.)
- 02:43, 21 Dec 2004 Mikkalai deleted Category:Folk dance (mv to cat:folk dances. content was: '[[Category:Dance]]')
- 02:42, 21 Dec 2004 Gadfium deleted Ioannas Focas (Misspelled title; deletion request by creator)
- 02:42, 21 Dec 2004 Infrogmation deleted Asian toilet (uninformative substub; content was: 'Asian toilets are not only popular in Asia, but also in Africa')
- 02:41, 21 Dec 2004 Gadfium deleted Image:Vladimir Upenski Sobor.jpeg (Moved to commons)
- 02:40, 21 Dec 2004 Gadfium deleted Image:Vladimir GoldenGates.jpeg (Moved to commons)
- 02:38, 21 Dec 2004 Gadfium deleted Image:Uspd1919 small.jpg (Orphaned thumb)
- 02:38, 21 Dec 2004 Gadfium deleted Image:Usnavy.ea6b.prowler.250pix.jpg (Orphaned thumb)
- 02:38, 21 Dec 2004 Gadfium deleted Image:Usaf.warthog.2.300pix.jpg (Orphaned thumb)
- 02:37, 21 Dec 2004 Gadfium deleted Image:Usaf.u2.250pix.jpg (Orphaned thumb)
- 02:37, 21 Dec 2004 Gadfium deleted Image:Usaf.thunderbolt2.350pix.jpg (Orphaned thumb)
- 02:37, 21 Dec 2004 Gadfium deleted Image:Usaf.thunder.250pix.jpg (Orphaned thumb)
- 02:36, 21 Dec 2004 Gadfium deleted Image:Usaf.sr71.250pix.jpg (Orphaned thumb)
- 02:35, 21 Dec 2004 Gadfium deleted Image:Usaf.phantom.f4.250pix.jpg (Orphaned thumb)
- 02:35, 21 Dec 2004 Gadfium deleted Image:Usaf.kc135.250pix.jpg (Orphaned thumb)
- 02:35, 21 Dec 2004 Gadfium deleted Image:Usaf.f15.f16.kc135.250pix.jpg (Orphaned thumb)
- 02:34, 21 Dec 2004 Gadfium deleted Image:Usaf.f15.eagle.250pix.jpg (Orphaned thumb)
- 02:34, 21 Dec 2004 Gadfium deleted Image:Usaf.f117.250pix.jpg (Orphaned thumb)
- 02:30, 21 Dec 2004 Michael Hardy deleted Holy Mountain (content was: '#REDIRECT[[Mount Athos]]')
- 02:27, 21 Dec 2004 Rfl deleted Gouled v. United States (content was: '{{delete}}asdf')
- 02:26, 21 Dec 2004 Rfl deleted Benign tumours (content was: '{{delete}}a;lsdkdfksd')
- 02:24, 21 Dec 2004 Gadfium deleted Image:Usaf.f106.deltadart.250pix.jpg (Orphaned thumb)
- 02:24, 21 Dec 2004 Mackensen deleted Wikipedia:The toilet (per VfD)
- 02:24, 21 Dec 2004 Gadfium deleted Image:Usaf.e8.250pix.jpg (Orphaned thumb)
- 02:23, 21 Dec 2004 Gadfium deleted Image:Usaf.e3sentry.250pix.jpg (Orphaned thumb)
- 02:23, 21 Dec 2004 Mackensen deleted Wikipedia talk:The toilet (per vfd)
- 02:23, 21 Dec 2004 Gadfium deleted Image:Usaf.c5.galaxy.250pix.jpg (Orphaned thumb)
- 02:23, 21 Dec 2004 Gadfium deleted Image:Usaf.c130.250pix.jpg (Orphaned thumb)
- 02:23, 21 Dec 2004 Rfl deleted Mitchell Izower (content was: 'Guys, if you recreate this again, you'll both be blocked. And then we'll tell your moms.Summary: Lot's of homosexualiy.Summary of the summary:...')
- 02:17, 21 Dec 2004 Mackensen deleted Wikipedia:Ten commandments (vfd consensus to delete)
- 02:15, 21 Dec 2004 Neutrality deleted Eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeencyclopedia (content was: 'This is the wrong way to spell encycopedia in case you did this typo.')
- 02:14, 21 Dec 2004 Danny deleted Mitchell Izower (spam)
- 02:13, 21 Dec 2004 Mikkalai deleted Educational amendments act (dump of law book)
- 02:12, 21 Dec 2004 Danny deleted Tigergirl (content was: 'Webmaster of [http://www.pokemon-country.com Pokemon Country], is one of the best anime drawers of the 21st century.')
- 02:10, 21 Dec 2004 Jpgordon deleted Ted palen (Previously VfD'd successfully.)
- 02:09, 21 Dec 2004 Jpgordon deleted Unders (content was: '{{delete}}'''''Unders''''' are a routinely rotated commodity of intimate nature, therefore exempt to [[yule]] distribution from [[maternal]] or [[p...')
- 02:09, 21 Dec 2004 Jpgordon deleted James friedman (content was: 'He is better than you.{{del}}')
- 02:09, 21 Dec 2004 Rfl deleted Mitchell Izower
- 02:08, 21 Dec 2004 Jpgordon deleted Black Lodge (content was: '{{del}}Black Lodge is where Skull & Bones members get together for under-the-table homosexual acts with each other. Most notably, George W. Bush and...')
- 02:08, 21 Dec 2004 Mikkalai deleted Radius Corp. (content was: '{{delete}}Radius - it's not what goes around.')
- 02:08, 21 Dec 2004 Jpgordon deleted The Jew of Malta (content was: '{{del}}the jew of malta')
- 02:08, 21 Dec 2004 Mikkalai deleted Internet xploder (content was: '{{del}}Internet xploderInternet explorer nickname, used because of its constant non-sense of crashing.. Get firefox www.mozilla.com/firefox')
- 02:07, 21 Dec 2004 Mikkalai deleted Kevin C. Bryant (content was: '{{del}}Kevin C. Bryant')
- 02:06, 21 Dec 2004 Mikkalai deleted At the Speed of Life (content was: 'yo that was tight son hit me back')
- 02:04, 21 Dec 2004 Mikkalai deleted Deaths in Newport (content was: '{{nonsense}}k')
- 02:02, 21 Dec 2004 Mackensen deleted Fun With Headlines (vfd, consensus to delete)
- 01:53, 21 Dec 2004 Mikkalai deleted Nick Diak
- 01:52, 21 Dec 2004 Gadfium deleted Not Another Teen Movie (content was: '{{deletebecause|nonsense/test}}'''Bold text'''Not Another Teen movie is a film made up of little pieces of other films.this makes it more inteterst...')
- 01:50, 21 Dec 2004 Ihcoyc deleted City of Dradful Night (content was: '#REDIRECT [[City of Dreadful Night]]')
- 01:50, 21 Dec 2004 Gadfium deleted Sollog is god (content was: '{{del}}SOLLOG IS GODhttp://www.sollog.com')
- 01:49, 21 Dec 2004 Gadfium deleted Wikisucks.com (content was: '{{del}}http://www.wikisucks.comWIKI SUCKS')
- 01:49, 21 Dec 2004 Rdsmith4 deleted User talk:Vandal (content before blanking was: '#REDIRECT [[User_talk:Hephaestos]]')
- 01:49, 21 Dec 2004 Rdsmith4 deleted User:Vandal (content was: '#REDIRECT[[User:Norm]]')
- 01:49, 21 Dec 2004 Gadfium deleted Book of toh (content was: '{{del}}BOOK OF TOHhttp://www.templeofhayah.comhttp://www.bookoftoh.com')
- 01:46, 21 Dec 2004 Mikkalai deleted Talk:Mitchell Izower (content was: 'There appears to be some sort of wall of text.== Seems boring. ==I can't quite believe someone can have such a boring life.')
- 01:46, 21 Dec 2004 Aranel deleted Category talk:German economy (deleted per cfd)
- 01:46, 21 Dec 2004 Mikkalai deleted Mitchell Izower (repeated vandalism by a whole flock of anons)
- 01:45, 21 Dec 2004 Rfl deleted Mickhail Mills (content was: '{{delete}}Is a really cool guy. Extremely attractive and a true ladies man. He keeps it real.')
- 01:44, 21 Dec 2004 Aranel deleted Category:German economy (delete per cfd, see Category:Economy of Germany)
- 01:44, 21 Dec 2004 Gadfium deleted Image:Usaf.b52.250pix.jpg (Orphaned thumb)
- 01:43, 21 Dec 2004 Gadfium deleted Image:Usaf.b47e.250pix.jpg (Orphaned thumb)
- 01:43, 21 Dec 2004 Gadfium deleted Image:Usaf.b2.spirit.250pix.jpg (Orphaned thumb)
- 01:42, 21 Dec 2004 Gadfium deleted Image:Usa3000.jpeg (No image, probably failed upload attempt)
- 01:41, 21 Dec 2004 Aranel deleted Category:Cities of São Paulo (delete per cfd, see Category:Cities in São Paulo)
- 01:41, 21 Dec 2004 Mikkalai deleted Mitchell Izower (content was: 'Penis')
- 01:41, 21 Dec 2004 Gadfium deleted Image:Us bahai how2.jpg (Orphaned thumb)
- 01:40, 21 Dec 2004 Mikkalai deleted Mitchell Izower (patent nonsense)
- 01:39, 21 Dec 2004 Jpgordon deleted CunninLyguists (content was: 'CunninLynguists are a pair of rappers.They have released the following albums:Will rap for foodSouthern Underground')
- 01:38, 21 Dec 2004 Gadfium deleted Image:Upper Yellowstone Fall-750px.JPG (Orphaned thumb)
- 01:38, 21 Dec 2004 Gadfium deleted Image:Upper Yellowstone Fall-300px.JPG (Orphaned thumb)
- 01:38, 21 Dec 2004 Aranel deleted Category:Towns and cities of Himachal Pradesh (delete per cfd, see Category:Cities and towns in Himachal Pradesh)
- 01:38, 21 Dec 2004 Gadfium deleted Image:Untitled.JPG (Renamed)
- 01:37, 21 Dec 2004 Mikkalai deleted Don Jarrett (content was: 'Don Jarrett is a mad nerd, he programed a bad ass nintendo emulator. It was called basicNES it was pretty cool.')
- 01:37, 21 Dec 2004 Gadfium deleted Image:United nations.gif (Unused, replaced.)
- 01:37, 21 Dec 2004 Gadfium deleted Image:U129208 60.JPG (Orphaned thumb)
- 01:37, 21 Dec 2004 Aranel deleted Category:Towns and cities of Kerala (delete per cfd, see Category:Cities and towns in Kerala)
- 01:36, 21 Dec 2004 Aranel deleted Category:Towns and cities of Maharashtra (delete per cfd, see Category:Cities and towns in Maharashtra)
- 01:35, 21 Dec 2004 Dori restored "Mark_Prindle"
- 01:35, 21 Dec 2004 Rfl deleted Adamdiz (content was: '{{del}}Adamdiz is the best poster in the whole wide world.')
- 01:35, 21 Dec 2004 Dori deleted Mark Prindle (delete in prep for hist merge, will restore)
- 01:34, 21 Dec 2004 Aranel deleted Category:Towns of Campania (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Campania]]. It may be deleted at any time by a administrator.')
- 01:34, 21 Dec 2004 Aranel deleted Category:Towns of Emilia-Romagna (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Emilia-Romagna]]. It may be deleted at any time by a administrator.')
- 01:33, 21 Dec 2004 Aranel deleted Category:Towns of Ireland (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Ireland]]. It may be deleted at any time by a administrator.')
- 01:33, 21 Dec 2004 Aranel deleted Category:Towns and cities of Greece (delete per cfd, see Category:Cities and towns in Greece)
- 01:32, 21 Dec 2004 Gadfium deleted Image:Cathplan.jpg (No image here)
- 01:32, 21 Dec 2004 Gadfium deleted Image:Wilmarsh.jpg (No image here)
- 01:31, 21 Dec 2004 Gadfium deleted Image:Triptomb.jpg (No image here)
- 01:30, 21 Dec 2004 Aranel deleted Category:Toyama prefecture (delete per cfd)
- 01:27, 21 Dec 2004 Aranel deleted Category:Dance patterns (delete per cfd, see Category:Dance moves)
- 01:26, 21 Dec 2004 Gadfium deleted Image:Th Pisaur mira.jpg (Orphaned thumb)
- 01:26, 21 Dec 2004 Mikkalai deleted Adamdiz (content was: '{{del}}Not as large as mineTimboBandit's penis is quite large.whatever'something about billy3 being a fagadamnigger deadi dont know'''Bold...')
- 01:25, 21 Dec 2004 Gadfium deleted Image:Tewxplan.jpg (No image here, but there is one at [[Image:Tewxplan.JPG]])
- 01:24, 21 Dec 2004 Gadfium deleted Image:Tea3.jpg (Orphaned thumb)
- 01:24, 21 Dec 2004 Gadfium deleted Image:Tea2.jpg (Orphaned thumb)
- 01:24, 21 Dec 2004 Gadfium deleted Image:Tea1.jpg (Orphaned thumb)
- 01:22, 21 Dec 2004 Rfl deleted Adamdiz (content was: '{{del}}Billy3 is a fag')
- 01:22, 21 Dec 2004 Gadfium deleted Image:Pyrite.mass.250pix.jpg (Orphaned thumb)
- 01:21, 21 Dec 2004 Rfl deleted Adamdiz (content was: '{{del}}Billy3 is a fag')
- 01:21, 21 Dec 2004 Gadfium deleted Image:Purnululu 1.JPG (Orphaned thumb)
- 01:21, 21 Dec 2004 Gadfium deleted Image:Pumpkins small.jpg (Orphaned thumb)
- 01:20, 21 Dec 2004 Gadfium deleted Image:Plymrock.jpg (No image here, but there is one at [[Image:Plymrock.JPG]])
- 01:17, 21 Dec 2004 Gadfium deleted Image:Pasterze.glacier.1.300pix.jpg (Orphaned thumb)
- 01:17, 21 Dec 2004 Mackensen deleted Redneck Katana (vfd consensus to delete)
- 01:17, 21 Dec 2004 Gadfium deleted Image:Pas de Calais Small.png (Orphaned thumb)
- 01:16, 21 Dec 2004 Gadfium deleted Image:Laburnum-platform1-metfink.jpg (Uploader's request)
- 01:13, 21 Dec 2004 Mikkalai deleted Cette fille appelée Nikki (content was: '{{del}}' (about unreleased film (in edit history)))
- 01:11, 21 Dec 2004 Neutrality deleted 4UM (content was: '{{del}}A forum for the insane followers and protagonists of the great mother voice Björk!')
- 01:08, 21 Dec 2004 Rfl deleted Why are they named the FLQ (content was: '{{del}}''== [[[Image:[[Image:[[Media:[[Media:<math><math><math><math><nowiki>[[[[[[[[[[[[[[hey]]]]]]]]]]]]]]</nowiki></math></math></math></math>]...')
- 01:06, 21 Dec 2004 Cyrius deleted Lailat ul-Qadr (copyvio - listed for 7+ days)
- 01:04, 21 Dec 2004 Niteowlneils restored "KEO"
- 01:03, 21 Dec 2004 Gadfium deleted Image:Party Card 300px.jpg (Obsolete thumb)
- 01:02, 21 Dec 2004 Niteowlneils deleted KEO (to move keo here--content was: ''''KEO''' will be a satellite around the earth.== Introduction ==The satellite is scheduled to be launched no early than 206. and the satellite wi...')
- 01:02, 21 Dec 2004 Gadfium deleted Image:Parnall.elf.250pix.jpg (Obsolete thumb)
- 01:02, 21 Dec 2004 Gadfium deleted Image:ParkingGarageSmall.jpeg (Obsolete thumb)
- 01:01, 21 Dec 2004 Gadfium deleted Image:Parkes.arp.300pix.jpg (Obsolete thumb)
- 01:01, 21 Dec 2004 Mikkalai deleted Image:Gravytris.jpg
- 00:59, 21 Dec 2004 Theresa knott deleted Pissflaps (content was: 'FOR FUCK'S SAKEJUST KEEP THIS ONE ARTICLEPLEASE')
- 00:58, 21 Dec 2004 Gadfium deleted Image:Parish.church.arp.300pix.jpg (Obsolete thumb)
- 00:57, 21 Dec 2004 Theresa knott deleted Pissflaps (content was: 'I SAID THAT PISSFLAPS WILL STAY!SO KEEP YOUR NOSES OUT OF THINGS YOU WILL NEVER UNDERSTAND.')
- 00:57, 21 Dec 2004 Gadfium deleted Image:Orda-Mir Castle.PNG (Moved to commons)
- 00:53, 21 Dec 2004 Gadfium deleted Image:LocationJamaica.png (Moved to commons)
- 00:53, 21 Dec 2004 Theresa knott deleted Kindie (content was: 'A young artist from Glasgow, Scotland. Bit of a waster, but sharply dressed.')
- 00:53, 21 Dec 2004 Gadfium deleted Image:Lifersims.gif (Request by uploader)
- 00:51, 21 Dec 2004 Gadfium deleted Image:Leaning-tower-of-pisa-alternate-small.jpg (Obsolete thumb)
- 00:50, 21 Dec 2004 Gadfium deleted Image:Konstytucja 3 Maja s.jpg (Obsolete thumb)
- 00:50, 21 Dec 2004 Theresa knott deleted Pissflaps (content was: 'I TELL YOU!PISSFLAPS WILL STAY ON THIS SITEWHETHER YOU MUPPETS LIKE IT OR NOT')
- 00:50, 21 Dec 2004 Gadfium deleted Image:Kiribati sm02.gif (Obsolete thumb)
- 00:50, 21 Dec 2004 Gadfium deleted Image:Kerry with crew.jpg (Obsolete thumb)
- 00:49, 21 Dec 2004 Gadfium deleted Image:Kazancoa1.png (Obsolete thumb)
- 00:49, 21 Dec 2004 Theresa knott deleted Mike Slocombe (content was: '{{vfd}}Watch out or he'll get you with the dreads.Photographer, editor of Urban 75 and presser of the big ban button')
- 00:49, 21 Dec 2004 Gadfium deleted Image:Jersey.arp.400pix.jpg (Obsolete thumb)
- 00:48, 21 Dec 2004 Theresa knott deleted Chio (content was: '{{delete}}Stuck in Congleton and will not be speedily deleted without a fight.You want some, Mr Wiki man?Wiki! Welcome to our network!(Hopeless...')
- 00:48, 21 Dec 2004 Gadfium deleted Image:Jaguar.xk8.car.350pix.jpg (Obsolete thumb)
- 00:48, 21 Dec 2004 Theresa knott deleted Pissflaps (content was: 'PISSFLAPS WILL RETURNI TELL YOU NOWYOU SHALL NOT DELETE IT!')
- 00:48, 21 Dec 2004 Gadfium deleted Image:Jaguar.xk8.car.300pix.jpg (Obsolete thumb)
- 00:47, 21 Dec 2004 Theresa knott restored "Wallasey"
- 00:47, 21 Dec 2004 Theresa knott deleted Wallasey (content was: 'The shithole that Clare Fry is from')
- 00:47, 21 Dec 2004 Theresa knott deleted Shamblebaby (content was: 'A sometime used pseudonym for Kindie, originating from the band Babyshambles')
- 00:47, 21 Dec 2004 Hyacinth deleted Image:JaredHyacinth.JPG (Old picture, since broken up)
- 00:45, 21 Dec 2004 Gadfium deleted Image:Istres.arp.300pix.jpg (Obsolete thumb)
- 00:44, 21 Dec 2004 Gadfium deleted Image:Iss.arp.300pix.jpg (Obsolete thumb)
- 00:44, 21 Dec 2004 Gadfium deleted Image:Interstellar.cloud.arp.300pix.jpg (Obsolete thumb)
- 00:43, 21 Dec 2004 Gadfium deleted Image:Image:mayflower ii.JPG (nonsense)
- 00:43, 21 Dec 2004 Gadfium deleted Image:Image:Tera.jpg (no image, apparent test)
- 00:42, 21 Dec 2004 Theresa knott deleted Pissflaps (content was: 'PISSFLAPS! I LOVE YOU!I say one thing to your deletion request.Pissflaps.An exaclamation often used by the member Oddjob on Urban75. On 18 Decem...')
- 00:42, 21 Dec 2004 Gadfium deleted Image:Hp.victor.arp.300pix.jpg (Obsolete thumb)
- 00:41, 21 Dec 2004 Gadfium deleted Image:Hurricane.areas.arp.300pix.jpg (====November 22==== Obsolete thumb)
- 00:38, 21 Dec 2004 Gadfium deleted Image:Hil Toenails.jpg (Unused, no response after listing on PUI.)
- 00:37, 21 Dec 2004 Gadfium deleted Image:Hereford bull thumb.jpg (orphaned thumb)
- 00:36, 21 Dec 2004 Gadfium deleted Image:Heppe Crater and Heppe Ice Cave in Lava Beds NM-300px.JPG (orphaned thumb)
- 00:33, 21 Dec 2004 Gadfium deleted Image:Henry Cabot Lodge.jpg (orphaned thumb)
- 00:33, 21 Dec 2004 Gadfium deleted Image:Hematite.bear.220pix.jpg (orphaned thumb)
- 00:32, 21 Dec 2004 Dori deleted Christian Democratic Party (Albania) (content was: 'get your act together!!!')
- 00:07, 21 Dec 2004 Academic Challenger deleted Weldar (content was: '{{deletebecause|Blank page}}')
- 00:02, 21 Dec 2004 Gadfium deleted Image:Heathrow.london.300pix.jpg (obsolete thumb)
- 00:02, 21 Dec 2004 Gadfium deleted Image:Head of serpent column s.jpg (obsolete thumb)
- 00:01, 21 Dec 2004 Gadfium deleted Image:Hawker.typhoon.rcaf.300pix.jpg (obsolete thumb)
- 00:01, 21 Dec 2004 Gadfium deleted Image:Hawk.trainer.arp.300pix.jpg (obsolete thumb)
- 00:00, 21 Dec 2004 Gadfium deleted Image:Haussman.grandearmee.250pix.jpg (obsolete thumb)
- 00:00, 21 Dec 2004 Gadfium deleted Image:Hatch.300pix.jpg (obsolete thumb)
- 23:59, 20 Dec 2004 Gadfium deleted Image:Gumboot Chiton (small).jpg (obsolete thumb)
- 23:59, 20 Dec 2004 Gadfium deleted Image:Gulllaysan85small.JPG (obsolete thumb)
- 23:59, 20 Dec 2004 Gadfium deleted Image:Guinea baby 1s.jpg (obsolete thumb)
- 23:59, 20 Dec 2004 Gadfium deleted Image:Great.attractor.arp.300pix.jpg (obsolete thumb)
- 23:54, 20 Dec 2004 KF deleted Max Triba (content was: 'WEE HEE HEE :E')
- 23:54, 20 Dec 2004 TUF-KAT deleted ALLIE ROCKS MY WORLD (content was: '{{delete}}--[[User:24.44.59.227|24.44.59.227]] 23:48, 20 Dec 2004 (UTC)ALLIE----<math>Insert formula here</math>[[Image:Example.jpg]][http://www.exa...')
- 23:53, 20 Dec 2004 Quadell deleted Image:Hotair.balloon.1.300pix.jpg (thumb)
- 23:52, 20 Dec 2004 Quadell deleted Image:Hotair.balloon.2.300pix.jpg (thumb)
- 23:51, 20 Dec 2004 Quadell deleted Image:Honey locust small.jpg (thumbnail)
- 23:51, 20 Dec 2004 Quadell deleted Image:Honey locust thorns small.jpg (thumbnail)
- 23:49, 20 Dec 2004 Quadell deleted Image:Homunculus.png (thumbnail)
- 23:49, 20 Dec 2004 Gadfium deleted Image:Grande Lunette Nice small.jpg (orphaned thumbnail)
- 23:48, 20 Dec 2004 Gadfium deleted Image:Go.arp.600pix.jpg (orphaned thumbnail)
- 23:48, 20 Dec 2004 Gadfium deleted Image:Gloster.glad.250pix.jpg (orphaned thumbnail)
- 23:47, 20 Dec 2004 Gadfium deleted Image:Glider.scheibe.300pix.jpg (orphaned thumbnail)
- 23:47, 20 Dec 2004 Rmhermen deleted Frank barker (content was: '{{del}}the greatest man to ever live. no questions asked')
- 23:47, 20 Dec 2004 Gadfium deleted Image:Giotto.mouning.350pix.jpg (orphaned thumbnail)
- 23:46, 20 Dec 2004 ALoan restored "The_Boomer_Bible"
- 23:46, 20 Dec 2004 Gadfium deleted Image:GiffordPinchot.jpg (orphan, no image here)
- 23:45, 20 Dec 2004 Quadell deleted Image:Holocaust victims.jpg (image has errors and will not display)
- 23:45, 20 Dec 2004 Quadell deleted Image:Holocaust victims-closeup.jpg (images has errors and does not display)
- 23:45, 20 Dec 2004 ALoan deleted The Boomer Bible (content was: '#Redirect [[Boomer bible]]' - for page move)
- 23:44, 20 Dec 2004 Gadfium deleted Image:F18MACHthumb.jpeg (orphaned thumbnail)
- 23:44, 20 Dec 2004 Quadell deleted Image:Hollywood Bowl small.jpg (thumbnail)
- 23:44, 20 Dec 2004 Gadfium deleted Image:F16c thumb.jpg (orphaned thumbnail)
- 23:43, 20 Dec 2004 Gadfium deleted Image:F102Small.jpeg (orphaned thumbnail)
- 23:43, 20 Dec 2004 Quadell deleted Image:Hogarth.mary.250pix.jpg (thumbnail)
- 23:43, 20 Dec 2004 Gadfium deleted Image:F-20.jpg (orphaned thumbnail)
- 23:42, 20 Dec 2004 Quadell deleted Image:Hofcommonsirl-thumbnail.jpg (thumbnail)
- 23:41, 20 Dec 2004 Quadell deleted Image:Hockey field small.png (thumbnail)
- 23:38, 20 Dec 2004 Quadell deleted Image:Ho-TableImage.png (scaled-down duplicate image)
- 23:36, 20 Dec 2004 Quadell deleted Image:Hmsinvincible.300pix.jpg (thumbnail)
- 23:36, 20 Dec 2004 Quadell deleted Image:Hmsocean.250pix.jpg (Thumbnail)
- 23:26, 20 Dec 2004 Quadell deleted Image:HMS Triumph, 1950.jpg (duplicate image)
- 23:25, 20 Dec 2004 ALoan restored "Immigration_to_Australia"
- 23:23, 20 Dec 2004 ALoan restored "Talk:Australian_immigration"
- 23:20, 20 Dec 2004 ALoan deleted Talk:Australian immigration (content was: '#REDIRECT [[Talk:Immigration to Australia]]' - reuniting page history)
- 23:18, 20 Dec 2004 Quadell deleted Image:HMSDreadnoughtSmall.jpeg (Unused thumbnail)
- 23:18, 20 Dec 2004 ALoan restored "Talk:Australian_immigration"
- 23:16, 20 Dec 2004 ALoan deleted Immigration to Australia (content was: '#REDIRECT [[Talk:Australian immigration]]' - page move)
- 23:16, 20 Dec 2004 ALoan deleted Talk:Australian immigration (to move talk page back from [[Immigration to Australia]])
- 23:01, 20 Dec 2004 Niteowlneils deleted Talk:Rymond Gilmartin (content was: 'How do I delete this entry[[User:Vogon77|vogon77]] 22:23, Dec 20, 2004 (UTC)')
- 23:01, 20 Dec 2004 Niteowlneils deleted Rymond Gilmartin (typo, not likely for redir--content was: '{{del}}Rymond Gilmartin is the current CEO of MERCK.{{stub}}')
- 22:59, 20 Dec 2004 Niteowlneils deleted Helplessness (content was: '{{del}}helplessness')
- 22:59, 20 Dec 2004 Niteowlneils deleted Go demonstration game (content was: '{{db|patent nonsense}}Hi, I'm Baard. An old norse name, thaught to descaribe a man who loves the fight (for it's own sake). The english Bard must be ...')
- 22:56, 20 Dec 2004 Niteowlneils deleted Image:Vimdel.jpg ("This page is a candidate for speedy deletion, because: corrupt images; marked "test"; not used anywhere")
- 22:53, 20 Dec 2004 Rmhermen deleted Jesus shit (content was: '{{delete}}Holy shit.')
- 22:53, 20 Dec 2004 Niteowlneils deleted Intercourse, Alabama (content was: '{{del}}[[Image:Example.jpg]]')
- 22:53, 20 Dec 2004 Slowking Man deleted Jesusshit (content was: 'Holy shit.')
- 22:51, 20 Dec 2004 Christopher Mahan deleted Tokio Marine &Fire Insurance Co. (content was: '#REDIRECT [[Tokio Marine & Fire Insurance Co.]]')
- 22:46, 20 Dec 2004 Neutrality deleted FESTIZIO (content was: '== '''FESTIZIO''' ==[[San Francisco]] based [[alternative rock]] [[band]]. Founded by [[Keane Li]], recipient of the 2003 Online Rock Festival Awa...')
- 22:40, 20 Dec 2004 Niteowlneils deleted Keane Li (previously VfDed--content was: '{{deleteagain}}== '''Keane Li''' ==born [[1982]] in [[Tacoma]], [[Washington|WA]][[Singer-songwriter]] and [[guitarist]] for [[alternative rock]...')
- 22:38, 20 Dec 2004 Niteowlneils deleted Upright doggy position (content was: '{{del}}rttret')
- 22:29, 20 Dec 2004 Niteowlneils deleted Image:Turkey flag large.jpg (unused dupe of png image)
- 22:19, 20 Dec 2004 Niteowlneils deleted Blueballs, Pennsylvania (content was: '{{db|contentless}}ironic that Pennsylvania is home to both places, intercourse and blueballs...')
- 22:19, 20 Dec 2004 Niteowlneils deleted French pasteries (content was: '{{nonsense}}french pasteries are very good. they make me go poo poo')
- 22:19, 20 Dec 2004 Niteowlneils deleted Talk:Battling companion (talk for deleted page)
- 22:16, 20 Dec 2004 Jengod deleted Fort Kaskaskia (content was: '<math>4+5</math>Hello how are you')
- 22:16, 20 Dec 2004 Infrogmation deleted Image:Henry Bessemer small.jpg (unusued old thumb)
- 22:08, 20 Dec 2004 Rbrwr deleted Richard Parker (Listed on WP:CP since Dec 3; content was: '{{copyvio|url=http://www.napoleonguide.com/richard-parker.htm}}')
- 22:07, 20 Dec 2004 Neutrality deleted Leo Web Design (Per VfD.)
- 22:05, 20 Dec 2004 Rdsmith4 deleted Template:Italy-related (TFD consensus to delete)
- 22:04, 20 Dec 2004 Neutrality deleted Customer service system (content was: '{{nonsense}}this is a bullshit thieng')
- 22:03, 20 Dec 2004 Neutrality deleted Roger horchow (Blank page.)
- 22:02, 20 Dec 2004 Neutrality deleted Meditations (content was: '{{nonsense}}Marcus aurelius was the last of the 5 good emperors. Not easy rule military problems and invasions plague millions died maried early he h...')
- 22:02, 20 Dec 2004 Neutrality deleted Leiomyosarcoma (content was: 'Finger Cancer. Rare and malignant')
- 21:59, 20 Dec 2004 Neutrality deleted How to Ruin Your Financial Life (content was: 'kjk')
- 21:58, 20 Dec 2004 Quadell deleted Image:Reindeer moss-thumb.jpg (Unused thumbnail of existing image)
- 21:58, 20 Dec 2004 Neutrality deleted Mark Howell (content was: '{{db|test}}<nowiki>Insert non-formatted text here</nowiki><math>Insert formula here</math>')
- 21:57, 20 Dec 2004 Quadell deleted Image:Redshank172sm.JPG (Unused thumbnail of existing image)
- 21:57, 20 Dec 2004 Neutrality deleted Horse poop (content was: '{{db|dicdef -- of sorts}}the excrement a horse creates when it has a bowel movement; smells extremely bad')
- 21:56, 20 Dec 2004 Neutrality deleted God sucks (content was: 'Jesus was a fucking fag.')
- 21:53, 20 Dec 2004 Niteowlneils deleted Template:VFD/Persecution (content was: '{{db|very old VfD discussion found in the wrong namespace. Moved to [[Wikipedia:Votes for deletion/Template:Persecution]] and have corrected inward l...')
- 21:53, 20 Dec 2004 Niteowlneils deleted Template talk:Vfd/Sandbox (content was: '{{db|leftover talk page of deleted test page.}}')
- 21:53, 20 Dec 2004 Niteowlneils deleted Template:CFD:FHM110sexiest (content was: '{{db| was a [[WP:CFD]] discussion in the wrong namespace. Moved to [[Wikipedia:Categories for deletion/FHM110sexiest]] and all links have been updated...')
- 21:53, 20 Dec 2004 Niteowlneils deleted Image:Vt-map.jpg (unused dupe of png map)
- 21:50, 20 Dec 2004 Quadell deleted Image:Redrocks scenic route view 300px.jpg (Unused thumbnail of existing image)
- 21:50, 20 Dec 2004 Quadell deleted Image:Redrocks rock formations 300px.jpg (Unused thumbnail of existing image)
- 21:49, 20 Dec 2004 Quadell deleted Image:Redrocks dead tree 300px.jpg (Unused thumbnail of existing image)
- 21:49, 20 Dec 2004 Quadell deleted Image:Redrocks dead tree 2 300px.jpg (Unused thumbnail of existing image)
- 21:49, 20 Dec 2004 Quadell deleted Image:Redrocks climbing area 300px.jpg (Unused thumbnail of existing image)
- 21:49, 20 Dec 2004 Quadell deleted Image:Redrocks canyon 300px.jpg ( Unused thumbnail of existing image)
- 21:43, 20 Dec 2004 Rbrwr deleted Mancur Olson (On WP:CP since Dec 3; content was: '{{copyvio|url=http://www.iris.umd.edu/aboutiris/olson.asp}}')
- 21:41, 20 Dec 2004 Niteowlneils deleted United States 1990 census (content was: '{{del}}brandon rocks')
- 21:41, 20 Dec 2004 Quadell deleted Image:Rediffusion.jpg (Unused thumbnail of existing image)
- 21:39, 20 Dec 2004 Bearcat deleted Category:Newspapers by country (content was: '[[Category:Newspapers]]')
- 21:39, 20 Dec 2004 Quadell deleted Image:Redbilledhornbill29sm.JPG (Unused thumbnail of existing image)
- 21:39, 20 Dec 2004 Quadell deleted Image:Redbilledhornbill29.jpg (Unused duplicate of existing image)
- 21:39, 20 Dec 2004 Quadell deleted Image:Redbilledhornbill129sm.JPG (Unused thumbnail of existing image)
- 21:39, 20 Dec 2004 Quadell deleted Image:Redadmiral08sm.JPG (Unused thumbnail of existing image)
- 21:38, 20 Dec 2004 Quadell deleted Image:Red cardinal bird small.jpg (Unused thumbnail of existing image)
- 21:37, 20 Dec 2004 Quadell deleted Image:Red eared slider small.jpg (Image has errors and will not display)
- 21:37, 20 Dec 2004 Quadell deleted Image:Red eared slider.jpg (Image has errors and will not display)
- 21:36, 20 Dec 2004 Niteowlneils deleted Soot and diamond (nonsense)
- 21:36, 20 Dec 2004 Quadell deleted Image:RedNeckedPademelon-side.jpg (Unused thumbnail of existing image)
- 21:36, 20 Dec 2004 Niteowlneils deleted 2005 British Leaders (content was: '{{delete}}yes')
- 21:35, 20 Dec 2004 Quadell deleted Image:RedNeckedPademelon-front.jpg (Unused thumbnail of existing image)
- 21:34, 20 Dec 2004 Quadell deleted Image:Red.arrows.250pix.jpg (Unused thumbnail of existing image)
- 21:34, 20 Dec 2004 Aranel deleted Category talk:Eccentrics (delete per cfd)
- 21:33, 20 Dec 2004 Quadell deleted Image:Red-Kangaroo-5legs-s.jpg (Unused thumbnail of existing image)
- 21:33, 20 Dec 2004 Bearcat deleted Category:Newspapers in the Americas (moved to category "Newspapers by country")
- 21:32, 20 Dec 2004 Quadell deleted Image:Re-TableImage.png (Unused thumbnail of existing image)
- 21:32, 20 Dec 2004 Aranel deleted Category:Eccentrics (delete per cfd)
- 21:30, 20 Dec 2004 Quadell deleted Image:Rb-TableImage.png (Unused thumbnail of existing image)
- 21:26, 20 Dec 2004 Quadell deleted Image:RanunculusFicaria-thumb.jpg (Unused thumbnail of existing image)
- 21:17, 20 Dec 2004 Quadell deleted Image:F-TableImage.png (Unused thumbnail of existing image)
- 21:16, 20 Dec 2004 Quadell deleted Image:Ne-TableImage.png (Unused thumbnail of existing image)
- 21:16, 20 Dec 2004 Quadell deleted Image:N-TableImage.png (Unused thumbnail of existing image)
- 21:15, 20 Dec 2004 Quadell deleted Image:Na-TableImage.png (Unused thumbnail of existing image)
- 21:10, 20 Dec 2004 Niteowlneils deleted Crusty Nautilus (content was: '{{db|typing test}}thhh')
- 21:10, 20 Dec 2004 Niteowlneils deleted Samantha su. (content was: '{{db|nonsense, vanity}}Samantha Su.the most wonderful child in the world. she has the beauty of one hundred horeses and loves arty fowl.')
- 21:10, 20 Dec 2004 Niteowlneils deleted Rublind (content was: '{{db|test/linkspam}}A person, who uses the signature: 'The Blind Man Can See'He is currently in the process of starting a web business, you can view...')
- 21:01, 20 Dec 2004 Niteowlneils deleted Gumba gumba (content was: '{{db|nonsense}}[[Image:RolledUpCondom.jpg]]')
- 20:55, 20 Dec 2004 Aranel deleted Category talk:Megatokyo (deleted per cfd)
- 20:55, 20 Dec 2004 Aranel deleted Category:Megatokyo (delete per cfd)
- 20:42, 20 Dec 2004 Quadell deleted Image:C-TableImage.png (Unused thumbnail of existing image)
- 20:42, 20 Dec 2004 Quadell deleted Image:B-TableImage.png (Unused thumbnail of existing image)
- 20:42, 20 Dec 2004 Quadell deleted Image:Be-TableImage.png (Unused thumbnail of existing image)
- 20:41, 20 Dec 2004 Quadell deleted Image:Li-TableImage.png (Unused thumbnail of existing image)
- 20:41, 20 Dec 2004 Quadell deleted Image:He-TableImage.png (Unused thumbnail of existing image)
- 20:41, 20 Dec 2004 Quadell deleted Image:H-TableImage.png (Unused thumbnail of existing image)
- 20:40, 20 Dec 2004 Adam Bishop deleted Talk:Charles Nadeau-Routhier (content was: 'il a po d'anglais nés à Chicoutimi... sti d'anglais pis mange du porc juif avarié')
- 20:33, 20 Dec 2004 Gadfium deleted Shreepadma Venugopalan (content was: '{{delete}}Shreepadma Venugoplan is a Graduate student in UW-Madison.Her favorite sentences areHe is a stupid guy, You know!!!I got pissed off ...')
- 20:32, 20 Dec 2004 Gadfium deleted Recursive Function Theory (content was: '{{delete}}hello my name is Katie == Headline text ==''Italic text''[[Link title]]')
- 20:32, 20 Dec 2004 Quadell deleted Image:Raft.brixham.300pix.jpg (Unused thumbnail of existing image)
- 20:31, 20 Dec 2004 Quadell deleted Image:Rafale-foch-small.jpg (Unused thumbnail of existing image)
- 20:28, 20 Dec 2004 Adam Bishop deleted Charles Nadeau-Routhier (vanity)
- 20:26, 20 Dec 2004 Adam Bishop deleted Ted palen (junk)
- 20:26, 20 Dec 2004 Academic Challenger deleted Wikisphere (content was: '{{db|neologism dicdef}}Wikisphere, noun, the universe of wikipedes or wiki users.')
- 20:25, 20 Dec 2004 Gadfium deleted Image:Refuelling.300pix.jpg (obsolete thumbnail)
- 20:25, 20 Dec 2004 Gadfium deleted Image:Reflection.nebula.arp.300pix.jpg (obsolete thumbnail)
- 20:24, 20 Dec 2004 Gadfium deleted Image:Red.breasted.goose.250pix.jpg (obsolete thumbnail)
- 20:23, 20 Dec 2004 Academic Challenger deleted Poor Laws (content was: 'i have no idea i need help please!!')
- 20:19, 20 Dec 2004 Gadfium deleted Image:Raphael.woman.300pix.jpg (obsolete thumbnail)
- 20:16, 20 Dec 2004 Gadfium deleted Image:Stralsund.jpg (Image replaced by another)
- 20:15, 20 Dec 2004 Gadfium deleted Image:St peter small.jpg (obsolete thumbnail)
- 20:14, 20 Dec 2004 Gadfium deleted Image:Safari (browser) (small).png (obsolete thumbnail)
- 20:13, 20 Dec 2004 Gadfium deleted Image:Salt Lake City, UT-300px.JPG (obsolete thumbnail)
- 20:13, 20 Dec 2004 Gadfium deleted Image:Skyservice.a320.300pix.jpg (obsolete thumbnail)
- 20:12, 20 Dec 2004 Quadell deleted Image:Rafale-Charles-de-Gaulle-small.jpg (unused thumb of duplicate image)
- 20:12, 20 Dec 2004 Gadfium deleted Image:Southern.pinwheel.arp.300pix.jpg (obsolete thumbnail)
- 20:11, 20 Dec 2004 Rmhermen deleted Molestation (content was: 'u kno.....its a shame it came down this, in the war Kadar knew exactly what he was doing. Kadar was a major part in the war..he created secret societi...')
- 20:11, 20 Dec 2004 Gadfium deleted Image:South.island.arp.300pix.jpg (obsolete thumbnail)
- 20:11, 20 Dec 2004 Rmhermen deleted Identity deception (content was: '{{db|Not '''very''' deceptive, is it?}}kkk')
- 20:10, 20 Dec 2004 Quadell deleted Image:Radical box.png (Moved to Commons)
- 20:10, 20 Dec 2004 Quadell deleted Image:Radical cow.png (Moved to Commons)
- 20:10, 20 Dec 2004 Quadell deleted Image:Radical earth.png (Moved to Commons)
- 20:10, 20 Dec 2004 Quadell deleted Image:Radical day.png (Moved to Commons)
- 20:10, 20 Dec 2004 Quadell deleted Image:Radical fire down.png (Moved to Commons)
- 20:09, 20 Dec 2004 Quadell deleted Image:Radical fire vertical.png (Moved to Commons)
- 20:09, 20 Dec 2004 Quadell deleted Image:Radical gate.png (Moved to Commons)
- 20:09, 20 Dec 2004 Quadell deleted Image:Radical going man.png (Moved to Commons)
- 20:09, 20 Dec 2004 Quadell deleted Image:Radical gold.png (Moved to Commons)
- 20:09, 20 Dec 2004 Quadell deleted Image:Radical grass.png (Moved to Commons)
- 20:09, 20 Dec 2004 Quadell deleted Image:Radical heart down.png (Moved to Commons)
- 20:09, 20 Dec 2004 Quadell deleted Image:Radical heart vertical.png (Moved to Commons)
- 20:08, 20 Dec 2004 Rmhermen deleted Jennyfisted
- 20:08, 20 Dec 2004 Rmhermen deleted Beginning (content was: '== Beginning==Is the [[first cause]] the [[beginning]] of [[everything]]?{{delete}}')
- 20:07, 20 Dec 2004 Quadell deleted Image:Radical road.png (Moved to Commons)
- 20:07, 20 Dec 2004 Quadell deleted Image:Radical word.png (Moved to Commons)
- 20:07, 20 Dec 2004 Quadell deleted Image:Radical woman.png (Moved to Commons)
- 20:07, 20 Dec 2004 Quadell deleted Image:Radical water.png (Moved to Commons)
- 20:07, 20 Dec 2004 Quadell deleted Image:Radical tree.png (Moved to Commons)
- 20:07, 20 Dec 2004 Rmhermen deleted Angie Narayan (content was: '{{db|Nonsense. I'm not sure about the Hebrew text, but I suspect the same.}}== Headline text ==hhfhhmhffmhfffhmjk.klklkhg..khk.עח...')
- 20:07, 20 Dec 2004 Quadell deleted Image:Radical rain.png (Moved to Commons)
- 20:06, 20 Dec 2004 Quadell deleted Image:Radical month.png (Moved to Commons)
- 20:06, 20 Dec 2004 Quadell deleted Image:Radical legs.png (Moved to Commons)
- 20:05, 20 Dec 2004 Deb deleted Spencer maceachern (content was: '{{db|no content}}')
- 20:04, 20 Dec 2004 Deb deleted Marcello Lippi (content was: '{{db|nonsense}}== Headline text ==shit he is a nob head')
- 20:03, 20 Dec 2004 Rmhermen deleted Huttonsville Correctional Center (content was: '{{delete}}HUTTONSVILLE CORRECTIONAL CENTER')
- 20:03, 20 Dec 2004 Deb deleted Thornton friends school (content was: '{{delete}}Best school ever.')
- 20:03, 20 Dec 2004 Brockert deleted MediaWiki talk:VfD-Myths about East Germany (content was: '{{db|orphaned talk page of a deleted VfD vote.}}Can someone figure out how to fix the long babelfish link? [[User:Ugen64|ugen64]] 00:04, May 11, 200...')
- 20:02, 20 Dec 2004 Rmhermen deleted HMS Ladybird (1950) (content was: '{{del}}H M S Ladybird')
- 20:01, 20 Dec 2004 Rmhermen deleted Periodic chart of elements (content was: '{{nonsense}}The periodic chart of elements is a 10 foot diagram of the blue whale's penis.')
- 20:00, 20 Dec 2004 Rmhermen deleted Dr. Valentine
- 20:00, 20 Dec 2004 DJ Clayworth deleted Nub (content was: 'Nub is another way to say newb, meaning newbie. Nub is more commonly used in online games to insult other players.')
- 19:58, 20 Dec 2004 Rmhermen deleted Japanese 38th Infantry Division (content was: '{{db|test}}whast alskdjflkasjdflkasldkfjlkasjdlkfjasjfasdffffffffffffffffffffffffffff')
- 19:50, 20 Dec 2004 Aranel deleted Category:Towns of Lombardy (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Lombardy]]. It may be deleted at any time by a administrator.')
- 19:48, 20 Dec 2004 Rmhermen deleted Shawn Weatherly (content was: '{{db|nonsense, test, misguided question}}== '''where was jill burial or funeral held''' ==')
- 19:47, 20 Dec 2004 Rmhermen deleted Seymour Martin Lipset (content was: '{{db|no content}}Seymore Martin Lipset')
- 19:45, 20 Dec 2004 Quadell deleted Image:Raaf.hornet.f18.400pix.jpg (Unused thumbnail of existing image)
- 19:45, 20 Dec 2004 Quadell deleted Image:Raaf.hornet.f18.250pix.jpg (Unused thumbnail of existing image)
- 19:43, 20 Dec 2004 Aranel deleted Category:Towns and cities of Gujarat (content was: '{{cfd}}[[Category:Cities in India|Gujarat]][[Category:Gujarat]]')
- 19:42, 20 Dec 2004 Aranel deleted Category:Greek economy (should be deleted in favor of Economy of Greece, not redirected)
- 19:41, 20 Dec 2004 Aranel deleted Category:Cities of the Marche (content was: '{{cfd}}This category has been moved to [[:Category:Cities in the Marche]]. It may be deleted at any time by a administrator.')
- 19:38, 20 Dec 2004 Quadell deleted Image:RFC1394 Sepia.jpg (unused thumb of existing image)
- 19:38, 20 Dec 2004 Quadell deleted Image:RFC1394 Color.jpg (unused thumb of existing image)
- 19:38, 20 Dec 2004 Quadell deleted Image:RFC1394 B&W.jpg (Unused thumb of existing image)
- 19:36, 20 Dec 2004 DJ Clayworth deleted Justin engdahl (content was: vanity blanked by creator)
- 19:34, 20 Dec 2004 Snoyes deleted Image talk:Pangolin.jpg (content was: 'preposterous')
- 19:34, 20 Dec 2004 Rmhermen deleted Old Norwegian (content was: 'Old norwegian is soo very cool{{delete}}')
- 19:33, 20 Dec 2004 Rmhermen deleted Kato Kaelin (content was: 'killed nicole brown simpson and ronald goldman.Hah.Ý')
- 19:30, 20 Dec 2004 Rmhermen deleted Kim Bullard (content was: '{{deletebecause|Lack of content. What does 'playing tracks' mean, anyway?}}Kim Bullard played tracks on Y Kant Tori Read, acclaimed singer-songwrit...')
- 19:29, 20 Dec 2004 Rmhermen deleted Eric Lasker
- 19:28, 20 Dec 2004 Quadell deleted Image:RC-135 takeoff-320px.jpg (Unused thumb of existing image)
- 19:21, 20 Dec 2004 Quadell deleted Image:QuinceSmall.jpg (Unused thumb of existing image)
- 19:20, 20 Dec 2004 Quadell deleted Image:Quejam.PNG (Duplicate image)
- 19:19, 20 Dec 2004 DavidWBrooks deleted Spencer maceachern (content before blanking was: 'Spencer MacEachern is a singer-songwriter from Markham, Ontario. His website can be found [http://www.myspace.com/yawn here].')
- 19:17, 20 Dec 2004 Quadell deleted Image:Queensland Flag.PNG (Unused thumb of existing image)
- 19:12, 20 Dec 2004 DavidWBrooks deleted How to play the violin (content was: '{{delete}}kbkhjbkjnkmn')
- 19:12, 20 Dec 2004 DavidWBrooks deleted An Occasional Discourse on the Nigger Question (content was: '{{delete}}AN OCCASIONAL DISCOURSE ON THE NIGGER QUESTION')
- 19:12, 20 Dec 2004 DavidWBrooks deleted IMaBadAss (content was: 'David Dow{{delete}}')
- 19:12, 20 Dec 2004 DavidWBrooks deleted Wierdo (content was: 'someone who writes weenie hut jr in the sandbox(my point exactly){{delete}}''can't even spel''')
- 19:11, 20 Dec 2004 DavidWBrooks deleted COLLADA (content was: '{{delete}}yuiuyy897')
- 19:10, 20 Dec 2004 DavidWBrooks deleted List of radio stations in south Carolina (content was: 'wspa-am spartanburg')
- 19:10, 20 Dec 2004 DavidWBrooks deleted Rachel's Laboratory
- 19:10, 20 Dec 2004 Quadell deleted Image:Quebec flag medium.png (Unused thumbnail of existing image)
- 19:02, 20 Dec 2004 MacGyverMagic deleted User:TheLastWord (content was: '#REDIRECT [[User talk:TheLastWord]]' (discussion moved to talk, nothing left))
- 19:01, 20 Dec 2004 MacGyverMagic deleted WNCW (content was: 'wncw.org{{db|absolutely no content}}')
- 19:01, 20 Dec 2004 Quadell deleted Image:Qianlong older sm.jpg (Unused thumbnail of existing image)
- 18:58, 20 Dec 2004 Quadell deleted Image:Qantas.a330-201.vh-eba.250pix.jpg (Unused thumbnail of existing image)
- 18:57, 20 Dec 2004 Rmhermen deleted 1950's Arms Race (content was: 'the arms race was cool')
- 18:56, 20 Dec 2004 Quadell deleted Image:PyrgosSmall.jpeg (Unused thumbnail of existing image)
- 18:55, 20 Dec 2004 Quadell deleted Image:Pyramid.300pix.jpg (Unused thumbnail of existing image)
- 18:46, 20 Dec 2004 Deb deleted Conway louis (content was: '{{del}}Louis conway was killed by falling cats in his homeland of Kitcan he was a mathematician and his work often led to his poor hygiene he frank...')
- 18:44, 20 Dec 2004 Deb deleted ImABadAss (content was: '{{delete}}David Dow')
- 18:44, 20 Dec 2004 Deb deleted Simu (content was: 'Simu god dumped for Jesus. This is sad because Jesus does not put out.''wtf???''{{delete}}')
- 18:43, 20 Dec 2004 Bearcat deleted Category:Canadian groups and associations (content was: 'This category lists groups (eg. [[lobbyist|lobby groups]], [[labour union]]s, etc.) and associations in [[Canada]].[[Category:Canada]]')
- 18:43, 20 Dec 2004 Deb deleted Kamache (content was: 'Sobrenome da família mais divertida do Brasil.')
- 18:41, 20 Dec 2004 Deb deleted Peter Emberley (content was: 'faggot')
- 18:33, 20 Dec 2004 Rmhermen deleted P.O.O.P (content was: '{{db|No appreciable content, not enough context. We could call it a substub, await the inevitable VfD nomination, wait five days and delete it then, b...')
- 18:33, 20 Dec 2004 Bearcat deleted Category:Canadian non-profit organizations (changing category title (I just created this 20 minutes ago))
- 18:29, 20 Dec 2004 Rmhermen deleted Phil graber (content was: 'he is an ugly monket')
- 18:26, 20 Dec 2004 Rdsmith4 deleted User talk:80.202.80.14 (nonsense)
- 18:19, 20 Dec 2004 Bearcat deleted Category:Chinese Media in Canada (corrected spelling (media s/b lowercase); moved all articles to the new category.)
- 18:19, 20 Dec 2004 Christopher Mahan deleted Toyota Motor Corporation (content was: '#redirect [[Toyota]]')
- 18:08, 20 Dec 2004 Charles Matthews deleted Big-o notation links (nonsense)
- 18:04, 20 Dec 2004 Rdsmith4 deleted Wierdo (content was: 'someone who writes weenie hut jr in the sandbox')
- 18:02, 20 Dec 2004 Rdsmith4 deleted Industialisation in Bizkaia (content was: 'your mothers have fucked you no?')
- 17:59, 20 Dec 2004 Rdsmith4 deleted Magdalen College School (content was: 'Magdalen College school is a comprehensive school with somewhere in excess of a thousand students.')
- 17:59, 20 Dec 2004 Rdsmith4 deleted Your mather (content was: '{{delete}}')
- 17:58, 20 Dec 2004 ALoan restored "Cricket"
- 17:56, 20 Dec 2004 Rdsmith4 deleted Fróði Frímann Kristjánsson (content was: ''''Fróði Frímann Kristjánsson''' is a [http://en.wikipedia.org/wiki/Boy boy] from [http://en.wikipedia.org/wiki/Iceland Iceland], wich is [http://en.w...')
- 17:51, 20 Dec 2004 Rdsmith4 deleted GaryWorker (content was: 'hi there folks!')
- 17:46, 20 Dec 2004 Rdsmith4 deleted Bush sucks (content was: 'Keep in mind that the following is not factual *cough* and that it solely represents the opinion of more than half the U.S.A.Bush Sucks.')
- 17:43, 20 Dec 2004 Rdsmith4 deleted Ants on Loll (content was: '===Mida tähendab 'Ants on Loll'?===*Ants on Loll e. AOL leiutas subatomic (imo). Praegu on olemas isegi aol'i teemaline jutukas, on olemas lehekülg ...')
- 17:42, 20 Dec 2004 Cyrius restored "Horatio_Zanbugglejones"
- 17:38, 20 Dec 2004 Rdsmith4 deleted Jorden (content was: '**jorden**the name jorden was created by the the tribe of the 'village people' they inspired a band by there tribal name that took after the village ...')
- 17:38, 20 Dec 2004 Rdsmith4 deleted Jorden (content was: '**jorden**the name jorden was created by the the tribe of the 'village people' they inspired a band by there tribal name that took after the village ...')
- 17:35, 20 Dec 2004 Rdsmith4 deleted Discomfort (content was: 'this is when you have a rash on the penis')
- 17:33, 20 Dec 2004 Rdsmith4 deleted Los Verdaderos Kreyentes de la Religión de Hip Hop (content was: 'los verdaderos kreyentes de la religion de hip hop')
- 17:33, 20 Dec 2004 Rdsmith4 deleted OCEAN BREZE PARK (content was: 'Ocean Breeze park is a small town in florida. It has the oldest mayor in the United States, Mayor Dorothy Geeben, 96.')
- 17:31, 20 Dec 2004 Rdsmith4 deleted British Dental Association (content was: '{{vfd}}hfghgfh')
- 17:29, 20 Dec 2004 Rdsmith4 deleted Mokey (content was: '* see [[primate]]')
- 17:27, 20 Dec 2004 Roozbeh deleted Talk:University of Tehran (Persian content, unrelated to University of Tehran)
- 17:18, 20 Dec 2004 Rdsmith4 deleted Andy Nimmo (content was: 'sdfhdfghdfhdfhdfhdh')
- 17:15, 20 Dec 2004 Rdsmith4 deleted Anti-apartheid movement (content was: 'nelson mandela's apartheid movement')
- 17:12, 20 Dec 2004 Joy Stovall deleted Louis conway (content was: '{{del}}Louis Conway was unfortunately killed by falling cats, he is much missed by all the villagers in his native Kitchan. Peace and goodwill to his...')
- 17:12, 20 Dec 2004 Joy Stovall deleted Talk:Louis conway (content was: 'This was an informative article')
- 17:04, 20 Dec 2004 Rdsmith4 deleted Talk:Aldrich Ames (content was: 'Hi people. My name is Billly Joe Bob and i live in Antartica.')
- 16:58, 20 Dec 2004 Ahoerstemeier deleted Let's Get Together (content was: '<math>2*c/5=a+b/d</math>')
- 16:57, 20 Dec 2004 Ahoerstemeier deleted Susan Strange (content was: 'susan strange')
- 16:56, 20 Dec 2004 Ahoerstemeier deleted SEC filing codes (content was: 'outstanding shares')
- 16:55, 20 Dec 2004 Ferkelparade deleted Djerdap (content was: '{{del}}[[Link title]]<math>Insert formula here</math>')
- 13:26, 20 Dec 2004 Chris 73 deleted Mrs. Coyne's class description for Big-O Notation (content was: '{{deletebecause|contentless}}EDIT THIS PAGE AND ADD A DESCRIPTION OF BIG-O NOTATION!')
- 13:21, 20 Dec 2004 Duncharris deleted Talk:Royal Grammar School, High Wycombe (content was: '{{del}}HEY!WHAT ABOUT THE CHILDREN?!!?!?!!111111111111111111111111111')
- 13:20, 20 Dec 2004 MacGyverMagic deleted Names of English & Spanish ships at Battle of St Vincent (content was: '{{del}} I am a member of the Britannia Naval Research Association based in Oxford England. We are preparing a presentation of The Battle of St Vince...')
- 13:18, 20 Dec 2004 MacGyverMagic deleted Neo-surrealism (content was: '{{deleteagain}}Surrealism is a way of putting dreams onto a canvas. Neo-surrealism uses the same principles as surrealism but is far more aware of th...')
- 13:15, 20 Dec 2004 MacGyverMagic deleted Manisa Province (content was: '{{del}}[http://www.example.com link title]www.e-manisa.com.tr')
- 13:14, 20 Dec 2004 MacGyverMagic deleted King:Of hearts (test, content was: '{{del}}{{delete}}[http://en.wikipedia.org/w/wiki.phtml?title=King:Of_hearts&action=edit CLICK HERE TO EDIT THIS PAGE]* {{PAGENAME}}* {{NUMBEROFA...')
- 13:13, 20 Dec 2004 MacGyverMagic deleted Grove Land Rights Case (content was: '{{del}} i think the word grove should be gove the name of the area')
- 13:13, 20 Dec 2004 MacGyverMagic deleted Guilford Rail System (content was: '{{db|A link is not an article}}==External links==*[http://www.guilfordrail.com/ Guilford Rail System][[Category:Massachusetts railroads]] [[Categ...')
- 13:12, 20 Dec 2004 MacGyverMagic deleted Sean Cannon (content was: '{{del}}Sean Cannon has an incredible voice which has kept the dubliners at the very top of folk/trad music all over the world.')
- 13:05, 20 Dec 2004 Ahoerstemeier deleted IANTD (content was no contents: 'Related link:http://www.iantd.com')
- 13:05, 20 Dec 2004 Ahoerstemeier deleted Rajiv amarnani (content was: ''''Rajiv Amarnani'''')
- 13:04, 20 Dec 2004 Ahoerstemeier deleted Louise Johnston (content was patent nonsense: 'Louise Johnston was fameously know as Hitlers Mother. Also know as Queen Sheep woman born in the brutal town of Newtonstuart in co Tyrone where law do...')
- 12:58, 20 Dec 2004 Quadell deleted Image:Gwb vote.png (Listed on IfD since Dec 12)
- 12:58, 20 Dec 2004 Quadell deleted Image:Petersen.jpg (Listed on IfD since Dec 12)
- 12:57, 20 Dec 2004 Quadell deleted Image:Fakering.jpg (Listed on IfD since Dec 12)
- 12:57, 20 Dec 2004 Quadell deleted Image:Gioithieu-2.jpg (Listed on IfD since Dec 12)
- 12:57, 20 Dec 2004 Quadell deleted Image:Gdansk-Coats with lions.gif (Listed on IfD since Dec 12)
- 12:57, 20 Dec 2004 Quadell deleted Image:GdanskBigCivicCoats.gif (Listed on IfD since Dec 12)
- 12:57, 20 Dec 2004 Quadell deleted Image:Gdansk-Coats.gif (Listed on IfD since Dec 12)
- 12:57, 20 Dec 2004 Quadell deleted Image:Gdansk-Big coats with lions.jpg (Listed on IfD since Dec 12)
- 12:57, 20 Dec 2004 Quadell deleted Image:Gdanarms.png (Listed on IfD since Dec 12)
- 12:57, 20 Dec 2004 Quadell deleted Image:Stereotypical Trick-Or-Treater.PNG (Listed on IfD since Dec 12)
- 12:56, 20 Dec 2004 Ahoerstemeier deleted Sean Cannon (content was: 'Since the death of Luke kelly,we lost the most powerful voice in the world.')
- 12:54, 20 Dec 2004 Quadell deleted Image:Labour economics-shortrun supply small.png (Listed on IfD since Dec 12)
- 12:54, 20 Dec 2004 Quadell deleted Image:Pincer.jpg (Listed on IfD since Dec 12)
- 12:54, 20 Dec 2004 Quadell deleted Image:Pkeating.png (Listed on IfD since Dec 12)
- 12:53, 20 Dec 2004 Quadell deleted Image:This Here Is Bobby Timmons.jpg (Listed on IfD since Dec 12)
- 12:53, 20 Dec 2004 Quadell deleted Image:Dimndust.htm (Listed on IfD since Dec 12)
- 12:52, 20 Dec 2004 Thue deleted Talk:Azcapotzalco (content was: 'Own3d')
- 12:52, 20 Dec 2004 Thue deleted The higher earth (content was: '{{del}}the higher earth'THE WORLD' out 03/2004 Http://www.mp3unsigned.com/TheHigherEarth.aspmore information on this page in a near future.')
- 12:50, 20 Dec 2004 Thue deleted Glucose uptake (content was: '{{nonsense}}'''Bold text'''''Italic text''[[Link title]][http://www.example.com link title]== Headline text ==[[Image:Example.jpg]][[Media:Example....')
- 12:49, 20 Dec 2004 Thue deleted How to assemble a fingerprint scanner (content was: '{{del}}=How to assemble a '''[[fingerprint scanner]]'''It's quite hard.')
- 12:43, 20 Dec 2004 Deb deleted CoTeia (content was: '{{del}}df df adsf ad adf ads dsf dsf dsfds fds ds fdsf df afsd fdf adf adssf adfsf dsfad')
- 12:42, 20 Dec 2004 Deb deleted Brijesh (content was: '{{del}}asdfasdfadsfasdfasdfasdf.')
- 12:41, 20 Dec 2004 Deb deleted Artur Paredes (content was: '{{del}}''Italic text''[[Image:Example.jpg]]'''Bold text'''')
- 12:35, 20 Dec 2004 Ahoerstemeier deleted Gerhard Thiele (content was: '#REDIRECT [[Gerhard P.J. Thiele]]' - making space to move the article back)
- 12:22, 20 Dec 2004 Ahoerstemeier deleted BA Comair (content was: 'cheap flights Johannesbur - Cape Town')
- 12:21, 20 Dec 2004 Duncharris deleted Phillipe le conlonne (patent nonsens)
- 12:03, 20 Dec 2004 Andris deleted Www.iantd.com (content was: '{{del}}(http://www.iantd.com)')
- 11:25, 20 Dec 2004 Ahoerstemeier deleted Sport Newspapers (content was: 'DAVE NETTLETON')
- 11:24, 20 Dec 2004 Ahoerstemeier deleted Brazil and weapons of mass destruction (content was: 'test!')
- 11:24, 20 Dec 2004 Ahoerstemeier deleted South Africa and weapons of mass destruction (content was: 'test!')
- 11:08, 20 Dec 2004 MacGyverMagic deleted Image:AgnesSorel.jpg (delete again, thought I deleted image page instead of image itself.)
- 11:03, 20 Dec 2004 MacGyverMagic restored "Image:AgnesSorel.jpg"
- 11:01, 20 Dec 2004 MacGyverMagic deleted Nil river (mistitled, should be Nile river; content was: 'The 'holy' '''Nil''' is a [[river]] that has its source in the [[Tanganjika lake]] and passes 9 countries.Its length is 6671 km and it disembogues ap...')
- 10:59, 20 Dec 2004 MacGyverMagic deleted Rohan & roshan (mistitled advertizement for own geocities website content was: 'Rohan Abraham & Roshan Abraham are twin bro's. Find more info of them and their family at the twins domain www.geocities.com/twins_rr/go.html')
- 10:54, 20 Dec 2004 MacGyverMagic deleted Boundary Scan (content was: '{{delete}}asdfgh')
- 10:54, 20 Dec 2004 MacGyverMagic deleted JSP Wiki (content was: '{{delete}}ytyutjyg')
- 10:47, 20 Dec 2004 MacGyverMagic deleted Co-incineration (content was: 'See e.g. http://www.wasteresearch.co.uk/ade/efw/coincineration.htm')
- 10:45, 20 Dec 2004 CatherineMunro deleted Supply shoch (content was: '#REDIRECT [[Supply shock]]' typoed name, just created)
- 10:42, 20 Dec 2004 Ferkelparade deleted Wikipedia:How to kill yourself (content was: '{{db|Take it to wikisource}}Stand on the edge and jump')
- 10:27, 20 Dec 2004 Ferkelparade deleted Conveniance store (content was: '{{del}}fg gb l..gfjglkhdgmlhn;mj't')
- 10:12, 20 Dec 2004 ALoan restored "Contredanse"
- 10:10, 20 Dec 2004 Meelar restored "Ottawa_Canada_Linux_Users_Group"
- 10:09, 20 Dec 2004 MacGyverMagic deleted Hexagogonagonal (content was: ''''hexagogonagonal 1''', n. (hex-zag-gog-gone-nag-gone-nal), '''1.''' an alternate reality distinguished by its six spatial dimensions. '''2.''' an an...')
- 10:07, 20 Dec 2004 MacGyverMagic deleted Biological neural networks (content was: 'atgcgtacgatagcgtcgtgacag')
- 10:04, 20 Dec 2004 MacGyverMagic deleted GOCR/JOCR (content was: '{{del}}oro?')
- 10:04, 20 Dec 2004 MacGyverMagic deleted Lallu (content was: '{{del}}'''Lallu is the best railway minister that this world has seen in lat 50 years!'''== Headline text ==')
- 10:01, 20 Dec 2004 MacGyverMagic deleted Talk:Words are only sources of misunderstanding (content was: '{{db|No article page}}Words are only sources of misunderstanding. Written By Anu Kurra on topic of Thought for the day.')
- 09:56, 20 Dec 2004 MacGyverMagic deleted Category:Assistive Technology (content was: '{{db|it's a redundant titlecase first draft of Category:Assistive_technology}}')
- 09:55, 20 Dec 2004 MacGyverMagic deleted Image:AgnesSorel.jpg (duplicate by hard-banned user)
- 09:55, 20 Dec 2004 Ahoerstemeier deleted Gullible (content was: 'Robert Guthrie')
- 09:53, 20 Dec 2004 MacGyverMagic deleted Kanshi Ram (test page)
- 09:52, 20 Dec 2004 MacGyverMagic deleted Category:Speech Synthesis (content was: '{{db|it's a redundant titlecase first draft of Category:Speech_synthesis}}[[Category:Assistive technology]][[Category:Accessibility]]')
- 09:51, 20 Dec 2004 MacGyverMagic deleted Category:School articles (content was: '{{db|it's an empty category.}}[[Category:Wikipedia maintenance]]')
- 09:51, 20 Dec 2004 MacGyverMagic deleted Category:Requests for expansion (content was: '{{db|page replaced with [[:Category:Articles to be expanded]].}}''See also [[Wikipedia:Requests for page expansion]].''[[Category:Wikipedia mainte...')
- 09:50, 20 Dec 2004 MacGyverMagic deleted Category:Pages being expanded (content was: '{{db|it's empty, and a redundant with [[:Category:Articles to be expanded]].}}This category should generally be nearly empty, see [[Template:Tobeexp...')
- 09:49, 20 Dec 2004 MacGyverMagic deleted Chester Barnard (content was: '{{delete}}life of chester Barbard')
- 09:49, 20 Dec 2004 MacGyverMagic deleted Frederick Hallsey (content was: '{{delete}}search for frederick Hallsey')
- 09:44, 20 Dec 2004 MacGyverMagic deleted Chinese Vietnamese (duplicate)
- 09:42, 20 Dec 2004 MacGyverMagic deleted Great Bridge (content was: '{{nonsense}}{{cleanup}}Great Bridge has no Great Bridge and never has. A small bridge exists crossing the small river Tame. Unless walking it is di...')
- 09:42, 20 Dec 2004 MacGyverMagic deleted Universidad Autónoma de Madrid (content was: '{{del}}'''Bold text'''HELLO')
- 09:41, 20 Dec 2004 MacGyverMagic deleted Urdu/Hindi literature (content was: '{{del}}urdu likhna sikho urdu bolna na bhollo urdu parhtey raho')
- 09:41, 20 Dec 2004 MacGyverMagic deleted Laughing horse (content was: '{{del}}A record label in Germany.' (lack of information))
- 09:40, 20 Dec 2004 MacGyverMagic deleted List of aim bots (content was: '{{deletebecause|this article is not informative, and is by its nature a violation of Wikipolicy}}* Austin Powers - [[Austin Powers]] Movie Promotion...')
- 09:39, 20 Dec 2004 MacGyverMagic deleted Plant floor layout (content was: '{{del}}ffdsgfgsdfg'''Bold text''asdfsdf'--[[User:18.187.0.43|18.187.0.43]] 09:22, 20 Dec 2004 (UTC)'gfsdgf''Italic text''gf')
- 09:29, 20 Dec 2004 Charles Matthews deleted Gonnegtion (nonsense/nonce usage - content was: 'It means 'connection', but Mr. Wolfshiem in The Great Gatsby by F. Scott Fitzgerald pronounces it as 'gonnegtion'. It is most likely due to his stuff...')
- 09:17, 20 Dec 2004 Ahoerstemeier deleted Beverly Center Mall (content was: 'jklmlk')
- 09:04, 20 Dec 2004 Charles Matthews deleted Foundation alex rodriguez (advertising content was: '{{notenglish}}fundacion alex rodriguez,necesito comunicarme con ustedes para ver si es posible se nos incluya en su lista de suplidores de medicamen...')
- 09:00, 20 Dec 2004 Magnus Manske deleted Image:JesseOwens 1936olym small.jpg (smaller version of [[:image:Image:JesseOwens 1936olym.jpg]], obsolete)
- 08:59, 20 Dec 2004 Magnus Manske deleted Image:Jesse Owens LJ small.jpg (smaller version of [[:image:Jesse Owens LJ.jpg]], obsolete)
- 08:58, 20 Dec 2004 Ahoerstemeier deleted Kittelsen (content was: 'He is coll. you ni**** pak ræve')
- 08:47, 20 Dec 2004 Academic Challenger deleted Kevin Lofy (content was: 'After dropping out of college in Whitewater, WI, Kevin returned to his hometown in Wauwtosa to live with his parents and to attend the University of M...')
- 08:44, 20 Dec 2004 Gadfium deleted Image:Steamboat Geyser at Norris Geyser Basin in Yellowstone-300px.JPG (obsolete thumb)
- 08:44, 20 Dec 2004 Gadfium deleted Image:Sainte Jeanne d'Arc-1-small.jpg (obsolete thumb)
- 08:42, 20 Dec 2004 Gadfium deleted Image:Sainte Jeanne d'Arc de nuit-small.jpg (obsolete thumb)
- 08:41, 20 Dec 2004 Gamaliel deleted RAZVAN GHEORGHIU (content was: '{{db|Autobiography}}RAZVAN GHEORGHIU IS A ROMANIAN FOOTBALL PLAYER ,BORN 1989.HE BEGINES HIS CAREER AT STEAUA IASI WITH TULUC AND CEZAR. ,A LITTLE F...')
- 08:41, 20 Dec 2004 Ahoerstemeier deleted Sniper 2 (content was: 'Good performance of Tom Berenger')
- 08:41, 20 Dec 2004 Ahoerstemeier deleted Conference on Environment and Development (content was: 'ygygy')
- 08:41, 20 Dec 2004 Gadfium deleted Image:Glen Canyon Dam bridge thumb.jpg (obsolete thumb)
- 08:40, 20 Dec 2004 Gadfium deleted Image:Glen Canyon Dam & Lake Powell thumb.jpg (obsolete thumb)
- 08:40, 20 Dec 2004 Ahoerstemeier deleted Daniel Theuma (content was vanity: 'Daniel Theuma was born in Malta on 7th April 1991. He studies at San Andrea School and chose Physics, French, Computer Studies and Account...')
- 08:39, 20 Dec 2004 Gadfium deleted Image:Gillem's Camp in Lava Beds NM-300px.JPG (obsolete thumb)
- 08:38, 20 Dec 2004 Gadfium deleted Image:Exterior South-East Corner of Tree Court, Gonville & Caius (small).jpg (obsolete thumb)
- 08:38, 20 Dec 2004 Jfdwolff deleted Mahabad, Iran (content was: '{{del}}bji barzani sarwari hamo kurdi jihan')
- 08:38, 20 Dec 2004 Gadfium deleted Image:Exterior South-East Corner of Tree Court, Gonville & Caius (medium).jpg (obsolete thumb)
- 08:37, 20 Dec 2004 Gadfium deleted Image:Excelsior Geyser Crater in Yellowstone-300px.JPG (obsolete thumb)
- 08:36, 20 Dec 2004 Gadfium deleted Image:Grand Canyon of the Yellowstone downstream from Upper Fall-750px.JPG (obsolete thumb)
- 08:35, 20 Dec 2004 Gadfium deleted Image:Grand Canyon of the Yellowstone downstream from Upper Fall-300px.JPG (obsolete thumb)
- 08:34, 20 Dec 2004 Gadfium deleted Image:Grand Canyon of the Yellowstone downstream from Lower Falls-750px.JPG (obsolete thumb)
- 08:34, 20 Dec 2004 Gadfium deleted Image:Grand Canyon of the Yellowstone downstream from Lower Falls-300px.JPG (obsolete thumb)
- 08:29, 20 Dec 2004 MacGyverMagic deleted Slapjoy and Monkfish (speedied, non-verifiable links to hoaxes.)
- 08:28, 20 Dec 2004 Gadfium deleted Face peeling action (content before blanking was: 'peeling of the face{{delete}}')
- 08:23, 20 Dec 2004 Gadfium deleted Armbands (content was: '{{db|neither encyclopedic or even a definition}}When news came that the state had killed [[George Jackson]] at [[San Quentin Prison]] in California ...')
- 08:22, 20 Dec 2004 Gadfium deleted Half of Baditude (content was: '{{delete}}appologies for creating that page, just a little bit of immature fun. I support wikipedia and the abbility of public contribution, editing ...')
- 08:20, 20 Dec 2004 Gadfium deleted Wikipedia:Votes for deletion/Capital expenditure (content was: '{{db|[[Capital expenditure]] was already speedied}}===[[Capital expenditure]]===Gibberish. Maybe vandalism. But certainly no encyclopedia article&md...')
- 08:17, 20 Dec 2004 Gadfium deleted Walvisachtigen in Pakistan (content was: 'jd'spegh ;ertuwbg;5byv;wo6yh groovy sukkels{{delete}}')
- 08:16, 20 Dec 2004 Gadfium deleted User:Squash/Things (Deleted at user's own request)
- 08:15, 20 Dec 2004 Gadfium deleted User:JAQ/Zoophilia (content was: '{{delete}}'. User's own request)
- 08:14, 20 Dec 2004 Gadfium deleted User:Albinomonkey/A-League (Australia) (content was: '{{deletebecause|I used it for practice before putting the full article on the website, and I don't need it anymore...}}')
- 08:13, 20 Dec 2004 Gadfium deleted Template talk:NASA-image (content was: '{{db|talk page of a deleted template.}}')
- 08:11, 20 Dec 2004 Gadfium deleted Talk:Lolarcoaster (content was: '{{del}}idiots')
- 08:11, 20 Dec 2004 Gadfium deleted Talk:Andy Carvin (Left over talk page after article was deleted)
- 08:09, 20 Dec 2004 Gadfium deleted Synvex (content was: '{{delete}}Synvex is a Medievian Newbie, Attempt at a Champion Hero')
- 08:08, 20 Dec 2004 Gadfium deleted Salience (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Salience .}}{{wikify}}{{move to wiktionary}}Sa...')
- 08:04, 20 Dec 2004 Gadfium deleted Political Sciences at the University of Ankara (content was: '{{delete}}alls turkisch arschloch')
- 08:03, 20 Dec 2004 Gadfium deleted Pipalonias (Possibly libellous, trivial content)
- 08:00, 20 Dec 2004 Gadfium deleted Mnemonic Encoding Specification for Vietnamese (nonsense)
- 08:00, 20 Dec 2004 Jiang deleted MediaWiki talk:Behavior (listed on tfd since December 3)
- 07:59, 20 Dec 2004 Jiang deleted MediaWiki:Behavior (listed on tfd since December 3)
- 07:59, 20 Dec 2004 Jiang deleted Template talk:Behavior (listed on tfd since December 3)
- 07:59, 20 Dec 2004 Jiang deleted Template:Behavior (listed on tfd since December 3)
- 07:59, 20 Dec 2004 Jiang deleted MediaWiki talk:Communitypage (listed on tfd since December 3)
- 07:58, 20 Dec 2004 Jiang deleted Template talk:Communitypage (listed on tfd since December 3)
- 07:58, 20 Dec 2004 Jiang deleted MediaWiki:Communitypage (listed on tfd since December 3)
- 07:58, 20 Dec 2004 Gadfium deleted Maclin (content was: '{{delete}}My name is George Campbell Maclin 111, my father was George Campbell Maclin Jr, His father was George Campbell Maclin SR, whose wife was na...')
- 07:57, 20 Dec 2004 Jiang deleted Template:Communitypage (listed on tfd since December 3)
- 07:57, 20 Dec 2004 Gadfium deleted London School of Medicine for Women (content was: '{{delete}}the people that i'm going to tyalk is really good')
- 07:57, 20 Dec 2004 Jiang deleted MediaWiki talk:Fylke (listed on tfd since December 3)
- 07:57, 20 Dec 2004 Jiang deleted MediaWiki:Fylke (listed on tfd since December 3)
- 07:57, 20 Dec 2004 Jiang deleted Template talk:Fylke (listed on tfd since December 3)
- 07:56, 20 Dec 2004 Jiang deleted Template:Fylke (listed on tfd since December 3)
- 07:56, 20 Dec 2004 Jiang deleted MediaWiki talk:Gnunote (listed on tfd since December 3)
- 07:56, 20 Dec 2004 Jiang deleted MediaWiki:Gnunote (listed on tfd since December 3)
- 07:55, 20 Dec 2004 Jiang deleted Template talk:Gnunote (listed on tfd since December 3)
- 07:55, 20 Dec 2004 Jiang deleted Template:Gnunote (listed on tfd since December 3)
- 07:54, 20 Dec 2004 Jiang deleted MediaWiki talk:Ilcomment (listed on tfd since December 3)
- 07:53, 20 Dec 2004 Jiang deleted Template talk:Ilcomment (listed on tfd since December 3)
- 07:53, 20 Dec 2004 Jiang deleted MediaWiki:Ilcomment (listed on tfd since December 3)
- 07:53, 20 Dec 2004 Jiang deleted Template:Ilcomment (listed on tfd since December 3)
- 07:53, 20 Dec 2004 Jiang deleted MediaWiki talk:La Francophonie (content was: '#REDIRECT [[Template talk:La Francophonie]]')
- 07:52, 20 Dec 2004 Jiang deleted MediaWiki:La Francophonie (listed on tfd since December 3)
- 07:52, 20 Dec 2004 Jiang deleted Template talk:La Francophonie (listed on tfd since December 3)
- 07:52, 20 Dec 2004 Jiang deleted Template:La Francophonie (listed on tfd since December 3)
- 07:51, 20 Dec 2004 Jiang deleted Template:SwissEFTA (tfd since December 3)
- 07:51, 20 Dec 2004 Jiang deleted MediaWiki talk:SwissEFTA (tfd since December 3)
- 07:51, 20 Dec 2004 Jiang deleted MediaWiki:SwissEFTA (tfd since December 3)
- 07:50, 20 Dec 2004 Jiang deleted Template talk:SwissEFTA (tfd since December 3)
- 07:48, 20 Dec 2004 Jiang deleted Talk:Scott Peterson (content was: 'Deleted unrelated comments--[[User:Lazarias|Lazarias]] 19:28, 13 Nov 2004 (UTC)')
- 07:35, 20 Dec 2004 Chris 73 deleted Andrew Bowman (content was: 'Andrew Bowman is a fat, ugly, complete idiot who is also a gaywad. His hobbies include eating and eating. He thinks he is smarter than everybody else ...')
- 07:28, 20 Dec 2004 Jimfbleak deleted Lolarcoaster (content was: '{delete}}A place where elitist internet whores who find Goatse Hot congregate and exhange Goatse pics and videos. They are also emo fags.')
- 07:27, 20 Dec 2004 Jimfbleak deleted Isocost line (unintelligible and contextless content was: 'A set of input bundles each which costs the same amount. Similar to the budget constraint, the slope is -w/r or the negative ratio of wages divided b...')
- 07:26, 20 Dec 2004 Neutrality deleted Category:152 mm weapons (Renamed per CfD)
- 07:25, 20 Dec 2004 Chris 73 deleted Saroj khanal (content was: 'it is not good for information engines like wikipedia to be concentrated around only the celebrities.it should also take into account new thirld world...')
- 07:17, 20 Dec 2004 Chris 73 deleted User:SPEEDMOLE (Created by anon, non existing user)
- 07:05, 20 Dec 2004 Chris 73 deleted Frances The Mute (content was: 'Tracklist:01 Vismund Cygnusa) Sarcophagib) Umbilical Syllablesc) Facilis Descenus Avernid) Con Safo02 The Widow03 L'Via L'Viaquez04 Mirand...')
- 07:03, 20 Dec 2004 Chris 73 deleted Burks v. United States (content was: 'Burks v. United States')
- 07:03, 20 Dec 2004 Chris 73 deleted Prebiotic (content was: 'prebiotic')
- 06:44, 20 Dec 2004 Chris 73 deleted Justin perry (content was: 'The president of Bellevue High School Speech/Debate')
- 06:38, 20 Dec 2004 Chris 73 deleted Presage (content was: ''''Presage''' to [[predict]].')
- 06:29, 20 Dec 2004 Gadfium deleted Curmudgeon (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Curmudgeon .}}{{move to Wiktionary}}==English=...')
- 06:28, 20 Dec 2004 Neutrality deleted The Jeopardy Adventure (Bizzare. Fanfic? cintent was 'The Jeopardy Adventure is a dream that began on Wednesday, December 1, 2004. This started because the person who would later start this was a fan of the game show Jeopardy!. He was also a fan of Ken Jennings, a contestant whose streak lasted 75 shows. He was sad because Jennings lost the day before this started. Unfortunately for him, other than Jennings's losing episode, there were no videotapes of Jennings's other 74 episodes. So he telephoned one of his relatives, who was also a Jennings fan, but they, too, did not have any of Jennings's episodes on videotape, other than his losing episode. They could not come up with any suggestions for this, nor could anybody else that he consulted. He could only come up with one thing, which was to start this. In the first episode, Jennings faced two TV characters, both of whose shows are mainly aimed for preschoolers. His opponents were Barney the dinosaur from Barney and Friends, and Dora from Dora the Explorer. Barney was the returning champion with $70,000, he won $35,000 in each of his two games. There was only time to play the first three questions in the category of Movies. The Daily Double was on the $400 clue. Jennings had $200 and bet $1,000. He got the question right, then got a $600 question right. There was not enough time left to play the rest of the round, and there was not enough time to play Double Jeopardy! and Final Jeopardy!. Jennings won with $1,800. The other two players could not get any questions right. In Jennings's second game, a contestant named Bim Bertlay had a negative score at the end of the Jeopardy! round, while Jennings had a commanding lead. In the second round, however, Bim managed to rally: she had $34,800, while Jennings had $35,000. The Final Jeopardy! category was Popular Cultures. Jennings wagered $5,000, and Bim wagered $201. The Final Jeopardy! clue was: This tribe invented the dream catcher. Jennings correctly answered: "What is the Indian tribe?" Bim was wrong: "Who are the Pilgrims?" Jennings finished with $40,000, and Bim's final total was $34,599. There was also an anonymous character that did not compete in Final Jeopardy! because he had $0. Jennings's first episode aired December 1, however, his second episode aired December 11 due to a special dream sequence. The next dream sequence started December 12 and is currently ongoing. It will end the day before Jennings's third episode. Jennings's current total is $41,800.')
- 06:25, 20 Dec 2004 Stan Shebs deleted Hermando Stoogle (complete nonsense)
- 06:23, 20 Dec 2004 Neutrality deleted O at Home (content was: 'dear oprah,{{delete}}')
- 06:21, 20 Dec 2004 Neutrality deleted Les sans culottes (content was: 'Literally, 'The without pants' in [[French]], [[rock-and-roll]] band influenced from [[1960s]] [[rock-and-roll]]. All of their songs are in [[French]].')
- 06:20, 20 Dec 2004 Gadfium deleted Bulletproof (Moved to Wiktionary)
- 06:19, 20 Dec 2004 Gadfium deleted Benign (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Benign .}}'''Benign''' (pronounced bih-'''nine'...')
- 06:18, 20 Dec 2004 Gadfium deleted Beginning (Moved to Wiktionary)
- 06:16, 20 Dec 2004 Stan Shebs deleted David Francis Taylor (anon's idea of a joke)
- 06:15, 20 Dec 2004 Gadfium deleted Attestation (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Attestation .}}{{Move to Wiktionary}}at·testv...')
- 06:15, 20 Dec 2004 Gadfium deleted Anachoretic (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Anachoretic .}}{{move to Wiktionary}}Living t...')
- 06:14, 20 Dec 2004 Gadfium deleted Aftermost (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Aftermost .}}In nautical parlance, nearest the ...')
- 06:13, 20 Dec 2004 Chris 73 deleted Tingers (content was: '{{delete}}Someone who 'tingshttp://hits4pay.com/members/index.cgi?MagicMan')
- 06:13, 20 Dec 2004 Neutrality deleted Dharmandra (content was: '{{delete}}dharmendra is a legend,unlike the big b he is somewhat retired but he lives in the hearts of people')
- 06:12, 20 Dec 2004 Neutrality deleted Moderators (content was: 'Someone who maintains a message board keeping the members under control and enforcing the rules of the board. Also called a Mod for short.')
- 06:12, 20 Dec 2004 Neutrality deleted Noobs (content was: 'The plural of a slang term for someone who is new or unexperienced. It is frequently used as an insult on message boards and in online games.Other s...')
- 06:12, 20 Dec 2004 Neutrality deleted Pirates With Attitude (content was: '{{delete}}Hi,This is fun! Hope all is going well for you.')
- 06:12, 20 Dec 2004 Chris 73 deleted Prairie Style (content was: 'prarie style is so whack it is the awesomest thing ever, it blows you all away!!!')
- 06:08, 20 Dec 2004 Gadfium deleted Aback (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Aback .}}{{move to Wiktionary}}At the back or...')
- 06:06, 20 Dec 2004 Gadfium deleted Image:Bird.table.250pix.jpg (obsolete thumb)
- 06:06, 20 Dec 2004 Infrogmation deleted Image:Gayunda.jpg (Unused duplicate of Gayundah.jpg)
- 06:05, 20 Dec 2004 Gadfium deleted Image:Bird.paigntonzoo.250pix.jpg (obsolete thumb)
- 05:57, 20 Dec 2004 Infrogmation deleted Tshwane university of technology (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.tut.ac.za/tut_web/index.php?struc=2185}}')
- 05:51, 20 Dec 2004 Infrogmation deleted Adrian Borland (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.brittleheaven.com/index.php?section=12&PHPSESSID=4d597f943cdff1fc010af4c4f392a0d6}}')
- 05:51, 20 Dec 2004 Infrogmation deleted Fortis (Belgium) (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.fortis.com/General/EN/generalcontent.htm}}==External links==*[http://biz.yahoo.com/ic/56/56060.html Yahoo! - Fortis Compan...')
- 05:50, 20 Dec 2004 Infrogmation deleted Harry Potter and the Half Blood Prince: Rumors and Facts (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.mugglenet.com/books/futurebooks/book6facts.shtml}}')
- 05:49, 20 Dec 2004 Infrogmation deleted The party's radio station (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.super1.com/about/}}')
- 05:49, 20 Dec 2004 Infrogmation deleted Super One Radi (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.super1.com/about/}}')
- 05:49, 20 Dec 2004 Infrogmation deleted Super One TV (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.super1.com/about/}}')
- 05:49, 20 Dec 2004 Infrogmation deleted Enrico Mizzi (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.searchmalta.com/surnames/mizzi/nerik.shtml}}')
- 05:49, 20 Dec 2004 Infrogmation deleted Paul Boffa (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.searchmalta.com/surnames/boffa/paul.shtml}}')
- 05:49, 20 Dec 2004 Infrogmation deleted Joseph Howard (Listed on WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.doi.gov.mt/EN/islands/prime_ministers/howard_joseph.asp}}')
- 05:45, 20 Dec 2004 Jpgordon deleted Horatio Zanbugglejones (nonsense)
- 05:43, 20 Dec 2004 Infrogmation deleted Carmelo Mifsud Bonnici (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.doi.gov.mt/EN/islands/prime_ministers/mifsud_bonnici_karmenu.asp}}')
- 05:43, 20 Dec 2004 Infrogmation deleted IEEE 802.1Q (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.xilinx.com/esp/networks_telecom/optical/net_tech/ieee8021q.htm}}')
- 05:43, 20 Dec 2004 Infrogmation deleted Kakovitch (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.mrti-usa.com/corp.html}}')
- 05:43, 20 Dec 2004 Infrogmation deleted David Dewhurst (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.senate.state.tx.us/LtGov.htm}}')
- 05:42, 20 Dec 2004 Infrogmation deleted Andy Reid (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.sportznutz.com/nfl/2004_preview/nfc_east/philadelphia.htm}}')
- 05:42, 20 Dec 2004 Cyrius restored "Sonic_the_Hedgehog_2_(Mega_Drive)"
- 05:42, 20 Dec 2004 Infrogmation deleted Brian Lewadny (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.telusplanet.net/public/angusm/wingchun/about/sifu.html}}')
- 05:41, 20 Dec 2004 Infrogmation deleted Sufjan Steves - Romulus (Lyrics) (On WP:CP since 8 Dec;content was: '{{copyvio|url=the songwriter}}')
- 05:41, 20 Dec 2004 Infrogmation deleted Brian Lewadny/Temp (re text dump )
- 05:41, 20 Dec 2004 Infrogmation deleted Francesco Buhagiar (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.searchmalta.com/surnames/buhagiar/francesco.shtml}}')
- 05:41, 20 Dec 2004 Gadfium deleted Image:Bird.amazon.parrot.250pix.jpg (obsolete thumb)
- 05:40, 20 Dec 2004 Cyrius deleted Sonic the Hedgehog 2 (Mega Drive) (baleeted?)
- 05:39, 20 Dec 2004 Infrogmation deleted Ikkitousen (On WP:CP since 8 Dec;)
- 05:39, 20 Dec 2004 Infrogmation deleted Bobby Shafto (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.thenortheast.fsnet.co.uk/Surnames%20of%20North%20East%20England.htm}}')
- 05:39, 20 Dec 2004 Gadfium deleted Image:Australian.shelduck.arp.250pix.jpg (obsolete thumb)
- 05:39, 20 Dec 2004 Infrogmation deleted Ugo Pasquale Mifsud (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.doi.gov.mt/EN/islands/prime_ministers/mifsud_ugo.asp}}')
- 05:38, 20 Dec 2004 Gadfium deleted Image:Ariel.leader.arp.250pix.jpg (obsolete thumb)
- 05:37, 20 Dec 2004 Infrogmation deleted Image:Kostov.JPG (On WP:CP since 8 Dec;)
- 05:37, 20 Dec 2004 Infrogmation deleted Li Keqiang (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.chinavitae.com/biography_display.php?id=263}}')
- 05:37, 20 Dec 2004 Gadfium deleted Image:AndrewCurtain.jpg (Uploader request, filename has typo)
- 05:37, 20 Dec 2004 Infrogmation deleted N-Isopropylacrylamide (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://pubs.acs.org/hotartcl/cenear/970609/gels.html}}[[User:Ricky81682|[[User:Ricky81682|Ricky81682]] ([[User_talk:Ricky81682|talk]])...')
- 05:36, 20 Dec 2004 Infrogmation deleted Ultra Maniac (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://www.animenewsnetwork.com/encyclopedia/anime.php?id=2287}}')
- 05:36, 20 Dec 2004 Infrogmation deleted Betty Nguyen (On WP:CP since 8 Dec;content was: '{{copyvio|url=http://cnnstudentnews.cnn.com/CNN/anchors_reporters/nguyen.betty.html}}')
- 05:36, 20 Dec 2004 AllyUnion deleted UConn Conn-Men (nonsense, non-notable, vanity)
- 05:36, 20 Dec 2004 Infrogmation deleted Sufjan Steves - Upper Peninsula(Lyrics) (On WP:CP since 8 Dec;content was: '{{copyvio|url=the songwriter}}')
- 05:36, 20 Dec 2004 Infrogmation deleted Govenaires (On WP:CP since 8 Dec; content was: '{{copyvio|url=http://www.corpsreps.com/corpsreps.cfm?view=corpshist&corps=18&corpstype=Senior}}')
- 05:35, 20 Dec 2004 Infrogmation deleted Afi-Odelia E. Scruggs (On WP:CP since Nov; content was: '{{copyvio|url=http://inthefray.com/html/article.php?sid=144}}')
- 05:31, 20 Dec 2004 Gadfium deleted Image:1989meijen1 shrunk.jpg (unused thumbnail, bigger version available)
- 05:29, 20 Dec 2004 Gadfium deleted Image:180px-Kaiser-Wilhelm-Gedächtniskirche um 1900.jpg (bigger and better version on the commons)
- 05:25, 20 Dec 2004 Infrogmation deleted Image:Meteor.JPG (Listed on WP:CP since Sept)
- 05:21, 20 Dec 2004 Rmhermen deleted Petey enterprises (content was: '{{deletebecause|vanity page}}visit www.peteyenterprises.tk'''PeTey Enterprises''' started in 1999 when Pete Smart and Tom Haig collaborated to crea...')
- 05:20, 20 Dec 2004 Rmhermen deleted Bandeto (content was: '{{delete}}Ah, yes the bandeto, He is a loveable Mexican Here is a picture of the bandetohttp://img141.exs.cx/my.php?loc=img141&image=kickassicon1...')
- 05:19, 20 Dec 2004 Rmhermen deleted Glucose transporter (content was: '{{delete}} this is a wrong redirect and it has no article yet')
- 05:18, 20 Dec 2004 AllyUnion deleted Category:Languages of Israel (Useless category)
- 05:18, 20 Dec 2004 Jrdioko deleted Luelinks (content was: 'It doesnt exists')
- 05:16, 20 Dec 2004 AllyUnion deleted Category:Languages of Colombia (Useless category)
- 05:16, 20 Dec 2004 AllyUnion deleted Category:Languages of Egypt (Useless category)
- 05:15, 20 Dec 2004 Rmhermen deleted Fower (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Fower .}}{{move to Wiktionary}}'''Fower''' is ...')
- 05:13, 20 Dec 2004 Rmhermen deleted Coppell High School (content was: '{{delete}}A horribly racist school. Their motto is no niggers allowed on KKK property. Drug useage amoung students is estimated near 47 percent while...')
- 05:12, 20 Dec 2004 Rmhermen deleted Andy Carvin (content was: '{{db|Accidental redirect to user page}}#REDIRECT [[User:Acarvin]]')
- 05:10, 20 Dec 2004 Rmhermen deleted Womanizing (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Womanizing .}}Reguarding women as sexual object...')
- 05:06, 20 Dec 2004 Morven deleted Image:MEC Flying Yankee.jpg (uploaded wrong version; reuploading)
- 05:05, 20 Dec 2004 Stevertigo deleted Oscar Wilde/Endicia (content was: '#REDIRECT [[Oscar Wilde/Biblio]]')
- 05:03, 20 Dec 2004 Rmhermen deleted Kade
- 05:03, 20 Dec 2004 Jrdioko deleted MTV Europe (content was: 'hey wats up .........................sohcahtoa rulessssssssssssssssssssssssssssssSOHCAHTOA ROCKSSSSSSSSSSSSSSSSSSSS!!!!!!')
- 04:55, 20 Dec 2004 Ta bu shi da yu deleted WP:RFC/CD (content was: '{{rfd}}#redirect [[Wikipedia:Requests for comment/CheeseDreams]]')
- 04:54, 20 Dec 2004 Ta bu shi da yu deleted WP:RFAR/CD (content was: '{{rfd}}#redirect [[Wikipedia:Requests for arbitration/CheeseDreams]]')
- 04:26, 20 Dec 2004 Chris 73 deleted Analize (content was: 'Analize is the process of splitting rectal cheeks and the inserting of hard wooden objects.')
- 04:25, 20 Dec 2004 ClockworkSoul deleted Army Signal Corps (content was: 'skeet')
- 04:25, 20 Dec 2004 ClockworkSoul deleted Digimon Emperor
- 04:22, 20 Dec 2004 ClockworkSoul deleted Pro-VHS
- 04:20, 20 Dec 2004 Quadell deleted Image:Half Dome from above Tioga Road-thumb.jpg (Unused scaled-down duplicate image)
- 04:18, 20 Dec 2004 Quadell deleted Image:HYDE-PARK.JPG (Unused scaled-down duplicate image)
- 04:17, 20 Dec 2004 Quadell deleted Image:HTIP218aSigS7fev86-small.jpg (Unused scaled-down duplicate image)
- 04:14, 20 Dec 2004 Quadell deleted Image:HMSDreadnought1875Small.jpeg (Unused scaled-down duplicate image)
- 04:14, 20 Dec 2004 Quadell deleted Image:HMSDreadnought1801Small.jpeg (Unused scaled-down duplicate image)
- 03:59, 20 Dec 2004 Bryan Derksen deleted Category:Supernova Remnants (content was: '[[Category:Supernovae]]' - moved all contents over to [[Category:Supernova remnants]])
- 03:57, 20 Dec 2004 Chris 73 deleted Githyanki (content was: 'articles regarding githyanki http://www.fred.net/knopp/Things%20to%20Know%20About%20Githyanki.dochttp://www.mimir.net/psmush/githyanki.shtml')
- 03:52, 20 Dec 2004 ClockworkSoul deleted Chhoi (content was: 'insert text here')
- 03:45, 20 Dec 2004 ClockworkSoul deleted Vomitron (Very not notable; not verifiable.)
- 03:40, 20 Dec 2004 Quadell deleted Image:Ac.barrier.jpg (Image contains errors and will not display)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationNicaragua.png (moved to commons under same name)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationOman.png (moved to commons under same name)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationSaintKittsAndNevis.png (moved to commons under same name)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationSaintLucia.png (moved to commons under same name)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationSaintVincentAndTheGrenadines.png (moved to commons under same name)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationTrinidadAndTobago.png (moved to commons under same name)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationUnitedArabEmirates.png (moved to commons under same name)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationVanuatu.png (moved to commons under same name)
- 03:39, 20 Dec 2004 Niteowlneils deleted Image:LocationYemen.png (moved to commons under same name)
- 03:38, 20 Dec 2004 ClockworkSoul deleted Downloadanime.org (content was: 'GREGER')
- 03:38, 20 Dec 2004 ClockworkSoul deleted Rick Salomon (content was: 'he was hilton's ex-boyfrind. famous for the paris hilton sex video.')
- 03:37, 20 Dec 2004 Quadell deleted Image:Ac.athensmap.jpg (Image contains errors and will not display)
- 03:37, 20 Dec 2004 Niteowlneils deleted Image:LocationDominicanRepublic.png (moved to commons under same name)
- 03:37, 20 Dec 2004 Niteowlneils deleted Image:LocationGrenada.png (moved to commons under same name)
- 03:37, 20 Dec 2004 Niteowlneils deleted Image:LocationHaiti.png (moved to commons under same name)
- 03:37, 20 Dec 2004 Niteowlneils deleted Image:LocationNewZealand.png (moved to commons under same name)
- 03:36, 20 Dec 2004 Niteowlneils deleted Image:LocationDominica.png (moved to commons under same name)
- 03:36, 20 Dec 2004 Niteowlneils deleted Image:LocationCuba.png (moved to commons under same name)
- 03:36, 20 Dec 2004 Niteowlneils deleted Image:LocationBarbados.png (moved to commons under same name)
- 03:36, 20 Dec 2004 Niteowlneils deleted Image:LocationBahamas.png (moved to commons under same name)
- 03:36, 20 Dec 2004 Niteowlneils deleted Image:LocationAntiguaAndBarbuda.png (moved to commons under same name)
- 03:35, 20 Dec 2004 Niteowlneils deleted Ophiopogon (content was: '{{delete}}mondo grass')
- 03:34, 20 Dec 2004 Cyrius deleted Disco 2000 (CSD - lack of context/definition)
- 03:24, 20 Dec 2004 Gadfium deleted Comfy Lounge (University of Waterloo) (content was: '''Note from the one ho placed this delete notice. comfy Lounge is a Lounge located in the third floor of the Mathematics and Computer Building in in ...')
- 03:22, 20 Dec 2004 Cyrius deleted Diablogue (content was: 'a blog facilitating a dialogue{{substub}}')
- 03:22, 20 Dec 2004 Jpgordon deleted Ethan's chesthair (content was: 'Ethan's chesthair is among the lushest of forests on the planet. International Arbor Magazine rated Ethan's chesthair as second to only the Amazon rai...')
- 03:21, 20 Dec 2004 Jpgordon deleted Lee Scott (content was: 'Corporate greed sucks. Lee Scott doesn't know that.')
- 03:18, 20 Dec 2004 ClockworkSoul deleted Color me Badd (content was: 'Color me Badd was the single greatest thing to happen to music since Christ wrote himself into history. These might not seem connected, but through ca...')
- 03:17, 20 Dec 2004 ClockworkSoul deleted My pleasure tool (content was: 'Is what it isSee also:[[vagina]]')
- 03:16, 20 Dec 2004 Jpgordon deleted Afroblackanegromerican (nonsense)
- 03:15, 20 Dec 2004 ClockworkSoul deleted Sunset Drive-In, Mansfield, OH (content was: 'On Park Avenue West in Mansfield is the only remaining drive in theater in Richland county. ==Links==[http://www.drive-ins.com/theater/ohsuns Driv...')
- 03:09, 20 Dec 2004 Chris 73 deleted Novafritz (content was: 'US music group famed for inventing the ebow paralysis crunch sound.If you were to type say the phrase www and then follow in by the name of the afore...')
- 03:09, 20 Dec 2004 ClockworkSoul deleted Cabucgayan, Biliran (content was: '{{delete}}Cabucgayan, Biliran')
- 03:08, 20 Dec 2004 Chris 73 deleted Dan Schabb (nonsense)
- 03:06, 20 Dec 2004 Chris 73 deleted Philip of Judea (content was: 'A Jewish Republican who never stops pimpin. When he walks into a room, dem bitches come runnin'')
- 03:00, 20 Dec 2004 Neutrality deleted Airport security government regulations and anti trust activities (content was: 'Airport security')
- 02:59, 20 Dec 2004 Neutrality deleted Novafritz
- 02:58, 20 Dec 2004 Neutrality deleted Novafritz (content was: 'Totally awesomely famouse super avant-garde cabaret garage post-punk tekno-popwww.novafritz.comThis Musical Group has been ordained by [[God]], and...')
- 02:57, 20 Dec 2004 Neutrality deleted Novafritz (content was: 'Totally awesomely famouse super avant-garde cabaret garage post-punk tekno-popwww.novafritz.comThis Musical Group has been ordained by [[God]], and...')
- 02:54, 20 Dec 2004 Niteowlneils deleted Penn Quaker (content was: '{{deletebecause| entire text is 'Penn Quakers'; legitimate inbound link from University of Pennsylvania but likely new user test}}Penn Quakers')
- 02:54, 20 Dec 2004 Joy Stovall deleted R. Noyes (content was: 'He's just this guy, you know?')
- 02:53, 20 Dec 2004 Niteowlneils deleted Resin acid (content was: '{{delete}}Muahaha')
- 02:53, 20 Dec 2004 Joy Stovall deleted Seymour Magoon (content was: 'seymour magoon')
- 02:53, 20 Dec 2004 Niteowlneils deleted Is Sex Necessary (content was: '{{delete}}who are you?')
- 02:42, 20 Dec 2004 Neutrality deleted Tokyo Medical University Hospital (content was: 'hospital')
- 02:39, 20 Dec 2004 Neutrality deleted Dan Schabb (content was: 'Also known as "King Poobah", Dan Schabb, the proprietor of "crunk juice" is known throughout the Catonsville area for his pimpin' nature and techno savvyness. Mr. Schabb is an accomplished triple guitar player as a member of the Steel Drum Band at Catonsville High School in Catonsville, Maryland, USA. He also plays bass and tuba, an extension of his musical talent. His humor is considered "truly classic", inculding his continual references to "anus", "balls", "honkus", and "for shizzle". Dan Schabb is a member of the class of 2005.')
- 02:27, 20 Dec 2004 Niteowlneils deleted MathPlayer (content was: '{{delete}}<math>3</math>')
- 02:24, 20 Dec 2004 Jpgordon deleted Image:Dolemite-0309.jpg (goatsex)
- 02:18, 20 Dec 2004 Jpgordon deleted G2 phase (content was: '{{del}}the cells surface area to volume ratio is at it maximum. cell is also preparing for cell division')
- 02:18, 20 Dec 2004 Jpgordon deleted Electric arc furnace (content was: '{{delete}}HI MY DEARMY NAME IS HOSSINY .I NEED INFORMATION ABOUT SVC . I HOPE TO ANSWER ME AND HELP ME THANKS YOU.')
- 02:12, 20 Dec 2004 AndyL deleted Image:Kencampbell.jpg (image not used)
- 01:50, 20 Dec 2004 UtherSRG deleted Template:Taxobox unranked entry (content was: '<tr><td> </td><td>{{{taxon}}}</td></tr>')
- 01:46, 20 Dec 2004 Jiang deleted Talk:Qin Er Shi (content before blanking was: '{{move|Qin Er Shi}}')
- 01:44, 20 Dec 2004 Jrdioko deleted CodeWorker (content was: '<nowiki>Insert non-formatted text here</nowiki>== Headline text ==[[Link title]]''Italic text''[http://www.example.com link title]')
- 01:41, 20 Dec 2004 Jrdioko deleted (Didn't Know I Was) Unamerican (content was: '{{delete}}none sense')
- 01:38, 20 Dec 2004 SimonP deleted Mission of Maitreya, Eternal Divine Path (listed on VfD, no objections to deletion)
- 01:35, 20 Dec 2004 Chris 73 deleted Coppermine Gallery (content was: 'Coppermine is a PHP photo gallery for your website (more secure than Gallery):http://coppermine.sourceforge.net/')
- 01:34, 20 Dec 2004 Chris 73 deleted Chudnovsky brothers (content before blanking was: 'SFTEadfhsgfhdgjhkljl;kl/.m,l;kj[[Media:Example.ogg]]<nowiki>Insert non-formatted text here</nowiki>')
- 01:29, 20 Dec 2004 Chris 73 deleted Sharon Lawrence (content was: 'Prominent television actress.')
- 01:28, 20 Dec 2004 SimonP deleted Entertainment education (listed on VfD, no objections to deletion)
- 01:27, 20 Dec 2004 SimonP deleted Ontaku (listed on VfD, votes 4-1 in favour of deletion)
- 01:27, 20 Dec 2004 Chris 73 deleted Beta-pinene (content was: 'Bodoh')
- 01:26, 20 Dec 2004 SimonP deleted Quidjibo (listed on VfD, votes 4-1 in favour of deletion)
- 01:16, 20 Dec 2004 Niteowlneils deleted α-Internexin (content was: '{{delete}} fucked up name')
- 01:16, 20 Dec 2004 Niteowlneils deleted User:Leif/Google Suggest ABCs (content was: '{{db|this is a subpage of my userpage that I changed my mind about keeping on wikipedia (sorry to waste a sysop's time having to delete this) ~leif}}')
- 01:10, 20 Dec 2004 Chris 73 deleted Violin Concerto No. 2 (Prokofiev) (content was: 'hi--[[User:162.84.163.154|162.84.163.154]] 01:05, 20 Dec 2004 (UTC)')
- 01:10, 20 Dec 2004 Chris 73 deleted Visor Solo (content was: 'now is the time')
- 01:06, 20 Dec 2004 Stan Shebs deleted Decatur class destroyer (wrong content, DANFS bits transferred to right place)
- 01:05, 20 Dec 2004 Chris 73 deleted Pearly gates (content was: ''save page'')
- 01:01, 20 Dec 2004 Meelar deleted Taylor Sobey (personal threat)
- 01:01, 20 Dec 2004 Stan Shebs deleted Pearl nakelace (content was: 'A Pearl Nakelace - When a man ejaculates on a persons chest/neck area.')
- 00:59, 20 Dec 2004 Neutrality deleted FischGreeks (content was: 'FischGreeks are a group of students, current and past, whose sixth grade year was spent focused on ancient civilizations and earth science. They are ...')
- 00:57, 20 Dec 2004 Jrdioko deleted Bush v. gore (content was: '{{delete}}I <3 big penis-jeff guerra')
- 00:53, 20 Dec 2004 Jrdioko deleted Bush v. gore (content was: '{{delete}}jeremy is a homo')
- 00:51, 20 Dec 2004 Jrdioko deleted Bush v. gore (content was: 'qs')
- 00:44, 20 Dec 2004 Niteowlneils deleted Fairfax Village Condominiums (content was: '{{deletebecause| entire text 'A lovely place 2 go and fuck yo bitch. Million dollar homes and lovely ho's on da blocks it some beautiful shit.'; no in...')
- 00:44, 20 Dec 2004 Niteowlneils deleted Wayneho Kam (content was: '{{db|Created by mistake}}')
- 00:44, 20 Dec 2004 Niteowlneils deleted Integer factorization algorithms (content was: '{{deletebecause|Page erroneously created in attempt to create [[:Category:Integer factorization algorithms]].}}')
- 00:43, 20 Dec 2004 Mirv deleted Jake jarvis (content was: '#REDIRECT [[User:Jakejarvis]]' -- newbie bio moved to proper namespace)
- 00:41, 20 Dec 2004 Mirv deleted Wikipedia:User The Cabal (content was: '{{db|User page created erroneously in the wrong namespace}}Hey guys, Cabal here. Hoping to have some fun here. I'm a metalhead from Massacusette...')
- 00:33, 20 Dec 2004 Ta bu shi da yu deleted The Cabal (content was: '{{delete}}YEAH I'm the CABALI am so rawkin' cuz good charlotte kiks @$$!')
- 00:30, 20 Dec 2004 Mirv deleted The Cabal (content was: 'YEAH I'm the CABALI am so rawkin' cuz good charlotte kiks @$$!')
- 00:29, 20 Dec 2004 Andrevan deleted Douglas Wozniak (content was: '{{vfd}}{{db|Self proclaimed as a joke on VfD by the author. Blanked by the author. Should be speedied as a newbie testing.}}Douglas Wozniak was born...')
- 00:21, 20 Dec 2004 Jrdioko deleted Misetings (content was: '{{deletebecause| entire first revision 'Might as well apply beatings.', second revision 'Lucky beatings.', that's it. no inbound links. orphaned test/...')
- 00:19, 20 Dec 2004 Jrdioko deleted English Reformation (content was: ''''Bold text'''hi my name is naiya.')
- 00:19, 20 Dec 2004 Jrdioko deleted Misetings (content was: 'Might as well apply beatings.')
- 00:18, 20 Dec 2004 Jrdioko deleted Yea, Australia (newbie test)
- 00:16, 20 Dec 2004 Jrdioko deleted Amala (content was: 'amala')
- 00:00, 20 Dec 2004 Mirv deleted The knack of flying (content was: ''The knack of flying is learning how to throw yourself at the ground and miss.'~[[Hitchhiker's Guide to the Galaxy]] written by [[Douglas Adams]]I...')
- 23:55, 19 Dec 2004 Rbrwr deleted Smoke point (Listed on WP:CP since December 3; content was {{copyvio|url=http://allrecipes.com/advice/ref/ency/terms/8573.asp}})
- 23:48, 19 Dec 2004 Francs2000 deleted Justin Gaspar (content was: '{{deletebecause| no context whatsoever, apparent vanity/new user test}}justin gaspar?! only the coolest cat around!')
- 23:46, 19 Dec 2004 Aranel deleted Category:Estonian economy (content was: '{{cfd}}This category has been moved to [[:Category:Economy of Estonia]]. It may be deleted at any time by an administrator.')
- 23:45, 19 Dec 2004 Aranel deleted Category:Latvian economy (content was: '{{cfd}}This category has been moved to [[:Category:Economy of Latvia]]. It may be deleted at any time by an administrator.')
- 23:45, 19 Dec 2004 Aranel deleted Category talk:Towns and cities of India (deleted per cfd)
- 23:45, 19 Dec 2004 Aranel deleted Category:Soviet economy (content was: '{{cfd}}This category has been moved to [[:Category:Economy of the Soviet Union]]. It may be deleted at any time by an administrator.')
- 23:44, 19 Dec 2004 Francs2000 deleted Justin Gaspar (content was: 'only the ''coolest'' cat around!')
- 23:44, 19 Dec 2004 Aranel deleted Category:Russian economy (content was: '{{cfd}}This category has been moved to [[:Category:Economy of Russia]]. It may be deleted at any time by an administrator.')
- 23:44, 19 Dec 2004 Aranel deleted Category:Australian economy (content was: '{{cfd}}This category has been moved to [[:Category:Economy of Australia]]. It may be deleted at any time by an administrator.')
- 23:42, 19 Dec 2004 Francs2000 deleted Yo mama (content was: '{{del}}yo mama is 'slang' or 'ghetto' for your mother')
- 23:42, 19 Dec 2004 Aranel deleted Category:Towns of Austria (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Austria]]. It may be deleted at any time by an administrator.')
- 23:42, 19 Dec 2004 Aranel deleted Category:Swedish economy (content was: '{{cfd}}This category has been moved to [[:Category:Economy of Sweden]]. It may be deleted at any time by a administrator.')
- 23:41, 19 Dec 2004 Aranel deleted Category:Irish Economy (content was: '{{cfd}}This category has been moved to [[:Category:Economy of Ireland]]. It may be deleted at any time by a administrator.')
- 23:39, 19 Dec 2004 Francs2000 deleted Talk:Misetings (content before blanking was: 'A Magic: The Gathering humor site. Used to have a few members who were extremely good at making shopped (see photoshop) MTG cards. The shopping got sh...')
- 23:39, 19 Dec 2004 Francs2000 deleted Misetings (content before blanking was: '[[BOOM!]]')
- 23:39, 19 Dec 2004 Aranel deleted Category:Chinese economy (content was: '{{cfd}}This category has been moved to [[:Category:Economy of China]]. It may be deleted at any time by a administrator.')
- 23:38, 19 Dec 2004 Aranel deleted Category:Towns and cities of Uttaranchal (content was: '{{cfd}}This category has been moved to [[:Category:Cities and towns in Uttaranchal]]. It may be deleted at any time by a administrator.')
- 23:38, 19 Dec 2004 Francs2000 deleted Prairie schooner (content was: 'A Prairie schonner is a mass built version of the popular farm wagonb, built spefically for travling The Oregon Trail.--[[User:205.188.116.10|205.188....')
- 23:37, 19 Dec 2004 Aranel deleted Category:Towns and cities of Tamil Nadu (content was: '{{cfd}}This category has been moved to [[:Category:Cities and towns in Tamil Nadu]]. It may be deleted at any time by a administrator.')
- 23:37, 19 Dec 2004 Aranel deleted Category:Towns and cities of Tripura (content was: '{{cfd}}This category has been moved to [[:Category:Cities and towns in Tripura]]. It may be deleted at any time by a administrator.')
- 23:36, 19 Dec 2004 Aranel deleted Category:Towns and cities of Rajasthan (content was: '{{cfd}}This category has been moved to [[:Category:Cities and towns in Rajasthan]]. It may be deleted at any time by a administrator.')
- 23:35, 19 Dec 2004 Aranel deleted Category:Towns and cities of Madhya Pradesh (content was: '{{cfd}}This category has been moved to [[:Category:Cities and towns in Madhya Pradesh]]. It may be deleted at any time by a administrator.')
- 23:34, 19 Dec 2004 Francs2000 deleted A-dawg (content was: 'This page is a tribute to A-Dawg, AKA: Andrew Scott.There isnt much to say about A-Dawg, he has a good signthat is one thing. He cut his hair that i...')
- 23:34, 19 Dec 2004 Aranel deleted Category:Towns and cities of Karnataka (content was: '{{cfd}}This category has been moved to [[:Category:Cities and towns in Karnataka]]. It may be deleted at any time by a administrator.')
- 23:34, 19 Dec 2004 Aranel deleted Category:Towns of Veneto (delete per cfd)
- 23:34, 19 Dec 2004 Francs2000 deleted Thief (movie) (content was: 'http://www.imdb.com/title/tt0083190/')
- 23:33, 19 Dec 2004 Aranel deleted Category:Towns of the Veneto (content was: '{{cfd}}This category has been moved to [[:Category:Towns in the Veneto]]. It may be deleted at any time by a administrator.')
- 23:33, 19 Dec 2004 Aranel deleted Category:Towns of the Marche (content was: '{{cfd}}This category has been moved to [[:Category:Towns in the Marche]]. It may be deleted at any time by a administrator.')
- 23:33, 19 Dec 2004 Francs2000 deleted Langford (content was: 'A-Dawg aspires to reside in Langford')
- 23:33, 19 Dec 2004 Aranel deleted Category:Towns of the Ile-de-France (content was: '{{cfd}}This category has been moved to [[:Category:Towns in the Ile-de-France]]. It may be deleted at any time by a administrator.')
- 23:33, 19 Dec 2004 Francs2000 deleted Furlough (content was: 'a leave of absence from duty')
- 23:32, 19 Dec 2004 Francs2000 deleted Thure Haunstrup-Skov (content was: '{{delete}}A super cool guy on the planet Earth')
- 23:32, 19 Dec 2004 Francs2000 deleted Elhers danlos syndrome genetharpy (content was: 'ewrretrewtrwetwertwetewetrewewrew')
- 23:32, 19 Dec 2004 Aranel deleted Category:Towns of Utah (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Utah]]. It may be deleted at any time by a administrator.')
- 23:32, 19 Dec 2004 Aranel deleted Category:Towns of Tuscany (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Tuscany]]. It may be deleted at any time by a administrator.')
- 23:31, 19 Dec 2004 Aranel deleted Category:Towns of Sicily (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Sicily]]. It may be deleted at any time by a administrator.')
- 23:28, 19 Dec 2004 Aranel deleted Category:Towns of Puglia (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Puglia]]. It may be deleted at any time by a administrator.')
- 23:28, 19 Dec 2004 Aranel deleted Category:Towns of Provence (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Provence]]. It may be deleted at any time by a administrator.')
- 23:27, 19 Dec 2004 Aranel deleted Category:Towns of Normandy (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Normandy]]. It may be deleted at any time by a administrator.')
- 23:27, 19 Dec 2004 Aranel deleted Category:Towns of Piemonte (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Piemonte]]. It may be deleted at any time by a administrator.')
- 23:26, 19 Dec 2004 Aranel deleted Category:Towns of Molise (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Molise]]. It may be deleted at any time by a administrator.')
- 23:26, 19 Dec 2004 Aranel deleted Category:Towns of Minas Gerais (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Minas Gerais]]. It may be deleted at any time by a administrator.')
- 23:26, 19 Dec 2004 Aranel deleted Category:Towns of Liguria (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Liguria]]. It may be deleted at any time by a administrator.')
- 23:26, 19 Dec 2004 Aranel deleted Category:Towns of Friuli-Venezia Giulia (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Friuli-Venezia Giulia]]. It may be deleted at any time by a administrator.')
- 23:24, 19 Dec 2004 Aranel deleted Category:Towns of Calabria (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Calabria]]. It may be deleted at any time by a administrator.')
- 23:24, 19 Dec 2004 Aranel deleted Category:Towns of Burgundy (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Burgundy]]. It may be deleted at any time by a administrator.')
- 23:24, 19 Dec 2004 Aranel deleted Category talk:Towns of Canada (deleted per cfd)
- 23:23, 19 Dec 2004 Aranel deleted Category:Towns of Canada (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Canada]]. It may be deleted at any time by a administrator.')
- 23:22, 19 Dec 2004 Aranel deleted Category:Towns of Brittany (content was: '{{cfd}}This category has been moved to [[:Category:Towns in Brittany]]. It may be deleted at any time by a administrator.')
- 23:22, 19 Dec 2004 Aranel deleted Category:Towns and cities of Andhra Pradesh (content was: '{{cfd}}This category has been moved to [[:Category:Cities and towns in Andhra Pradesh]]. It may be deleted at any time by a administrator.')
- 23:14, 19 Dec 2004 Ahoerstemeier deleted Ishmam H. Ibtida (content was: 'Genius Brown kid that goes to stuyvesant high school.')
- 23:14, 19 Dec 2004 Ahoerstemeier deleted Redundant (content was: ':''see [[Redundant]]''')
- 23:12, 19 Dec 2004 Jrdioko deleted BOOM! (content was: '[[BOOM!]]')
- 23:11, 19 Dec 2004 Aranel deleted Category:Cities and towns of Iraq (content was: '{{cfd}}This category has been moved to [[:Category:Cities and towns in Iraq]]. It may be deleted at any time by a administrator.')
- 23:10, 19 Dec 2004 Aranel deleted Category:Palestinian children killed by Israelis (delete per cfd)
- 23:08, 19 Dec 2004 Deb deleted Solem v. Helm (content was: '???????')
- 23:07, 19 Dec 2004 Deb deleted Beatings (content was: '{{del}}'Beatings' is often used to refer to the act of swinging with savage men.')
- 23:06, 19 Dec 2004 Deb deleted Specific risk (content was: 'Specific Risk')
- 23:05, 19 Dec 2004 Deb deleted Shirin baradaran (content was: 'Shirin Baradaran is a young girl that lives in Los Angelas Clifornia.')
- 23:02, 19 Dec 2004 Aranel deleted Category:Election results in Europe (delete per cfd - should be by country, not continent)
- 23:02, 19 Dec 2004 Aranel deleted Category:Election results in Asia and the Pacific (delete per cfd - should be by country, not continent)
- 23:00, 19 Dec 2004 Cecropia deleted Chitterlings (delete prep to moving main article here)
- 22:53, 19 Dec 2004 Aranel deleted Category:Serbian people by occupation (delete per cfd - empty and unnecessary)
- 22:48, 19 Dec 2004 UtherSRG deleted Template:Taxobox subordo entry authority (content was: '|-|{{subordo}}:||{{{taxon}}}<br><small>{{{author}}}, {{{date}}}')
- 22:47, 19 Dec 2004 UtherSRG deleted Template:Taxobox subordo entry authority parens (content was: '|-|{{subordo}}:||{{{taxon}}}<br><small>({{{author}}}, {{{date}}})')
- 22:47, 19 Dec 2004 Aranel deleted Category:British cities (delete per cfd)
- 22:46, 19 Dec 2004 Aranel deleted Category:Mass transit (delete per cfd - see Category:Public transport)
- 22:45, 19 Dec 2004 Aranel deleted Category:Danish people by occupation (delete per cfd (empty))
- 22:45, 19 Dec 2004 UtherSRG deleted Template:Taxobox genus entry authority (content was: '|-|{{genus}}:||{{{taxon}}}<br><small>{{{author}}}, {{{date}}}')
- 22:45, 19 Dec 2004 Aranel deleted Category:Food chemistry (delete per cfd, use Category:Food science)
- 22:42, 19 Dec 2004 Jnc deleted PaulDrye (xspace redir to User:)
- 22:41, 19 Dec 2004 Ahoerstemeier deleted Stuart Stevens (content was nonsense redirect: '}#REDIRECT [[Extraterrestrial life]]')
- 22:33, 19 Dec 2004 Deb deleted Zaragrunudgeyon (patent nonsense)
- 22:30, 19 Dec 2004 Joy Stovall deleted Jewpanese (VFD consensus to delete)
- 22:27, 19 Dec 2004 Deb deleted The Book of Kevin (patent nonsense)
- 22:25, 19 Dec 2004 Deb deleted Political machines (content was: 'An organized group that controlled the activities of a political party in a city.Is now illegal{{delete}}')
- 22:24, 19 Dec 2004 Joy Stovall deleted Encyclopedia Dramatica (vfd consensus to delete)
- 22:22, 19 Dec 2004 Deb deleted Annabell Lee (content was: 'Annabell lee{{delete}}')
- 22:17, 19 Dec 2004 Ahoerstemeier deleted DAIM (content was: '[[Link title]][[Link title]]''Italic text''== Headline text =='''Bold text'''sdfds[[Media:Example.ogg]]<nowiki>Insert non-formatted text here</nowik...')
- 22:17, 19 Dec 2004 Cecropia deleted "Peasant foods" (content was: '#REDIRECT [[Peasant foods]]')
- 22:15, 19 Dec 2004 Ahoerstemeier deleted Tabellen (content was: 'sdfdsafds')
- 22:15, 19 Dec 2004 Ahoerstemeier deleted Wazan (poetry) (content was: 'dil ki dunnia udas hay babawoo kahein aas pass hay baba')
- 22:14, 19 Dec 2004 Ahoerstemeier deleted USS Alfred A. Cunningham (DD-752) (content was no contents: 'See: http://destroyersonline.com/usndd/dd752/')
- 22:14, 19 Dec 2004 Ahoerstemeier deleted Knowsley Park (content was: 'Lancashire House')
- 22:14, 19 Dec 2004 Ahoerstemeier deleted Sampling method (content was: 'zophilia samples')
- 22:13, 19 Dec 2004 Ahoerstemeier deleted WyPy (content was spam: 'WyPy Homepage:[http://infomesh.net/2003/wypy/]')
- 22:12, 19 Dec 2004 Joy Stovall deleted Monglish (VFD consensus to delete)
- 22:11, 19 Dec 2004 Neutrality deleted The bool of kevin (Patent nonsense)
- 22:10, 19 Dec 2004 Ahoerstemeier deleted FictioNgaming (content was vanity: ''''Bold text'''fictioNgaming'''Bold text'''A Counter-Strike based team that plays in the CyberAthlete Amateur League in the Intermediate Division. K...')
- 22:10, 19 Dec 2004 Neutrality deleted Tails' Skypatrol (content was: 'Tails' Skypatrol was merely a handheld game relesed by McDonalds in 2004. You press up and down buttons for Tails to collect rings.If you fail to mi...')
- 22:05, 19 Dec 2004 Jrdioko deleted Peripheral nervous system disease (content was: '{{del}}so, like... i was owning wikipedia right? and this n00b comes along, and he was like... put some stuff in for me right? so, i was like... su...')
- 22:03, 19 Dec 2004 Jrdioko deleted Desulphurization (content was: '{{delete}}hello')
- 22:00, 19 Dec 2004 Infrogmation deleted Fifth Brigade (WP:CP listed since 7 Dec; content was: '{{copyvio|url=http://www.hrforumzim.com/members_reports/matrep/matreppart1c5.htm}}')
- 21:59, 19 Dec 2004 Ahoerstemeier deleted Osama crater (content was: 'ababababababaabababbabababababababababababababababababab')
- 21:34, 19 Dec 2004 SimonP deleted Thinkism (recreation of a deleted page)
- 21:31, 19 Dec 2004 Ahoerstemeier deleted Potamochoerus porcus (content was: 'confused with commons --[[User:80.121.34.70|80.121.34.70]] 21:30, 19 Dec 2004 (UTC)----Class : '''Mammalia''' - Order : '''Artiodactyla''...')
- 21:28, 19 Dec 2004 Ahoerstemeier deleted Ya ya ay ay ay aya ya (content was: 'YAYAYAYAYAYAYAYAYAYAYAYAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA...')
- 21:27, 19 Dec 2004 Ahoerstemeier deleted Extant (content was: 'Extant means nothing.')
- 21:27, 19 Dec 2004 Ahoerstemeier deleted Local telephone service (content was: 'local telephone system absolutely depend on circuit switched technology')
- 21:26, 19 Dec 2004 Deb deleted David E. Nichols (content was: '{{del}}')
- 21:26, 19 Dec 2004 Ahoerstemeier deleted Howard Hughes will (content was: 'Hello!')
- 21:25, 19 Dec 2004 Neutrality deleted Category:World War II Pacific Theatre (Per CfD)
- 21:25, 19 Dec 2004 Gamaliel deleted Patrick marks (content was: 'Patrick marks is awesome')
- 21:25, 19 Dec 2004 Ahoerstemeier deleted Outpost 2: Divided Destiny (content was: 'asda')
- 21:25, 19 Dec 2004 Ahoerstemeier deleted Functional data model (content was: 'Merseburg')
- 21:24, 19 Dec 2004 Ahoerstemeier deleted Gol TV (content was: 'Gol TV')
- 21:23, 19 Dec 2004 Quadell deleted Image:Logo cta.gif (Listed on IfD since Dec 11)
- 21:23, 19 Dec 2004 Ahoerstemeier deleted Eddie Mustapha Muhammad (content was: '''''''WAJID ALI S/O GHULAM HAIDER, VILL:HARICHAND BUNGALOW,DISTT: CHARSADA ,N.W.F.P , PAKISTAN.'''')
- 21:23, 19 Dec 2004 Quadell deleted Image:Wikipedia logo ffffdd.png (Listed on IfD since Dec 11)
- 21:23, 19 Dec 2004 Quadell deleted Image:Wikipedia logo eeeeee2.png (Listed on IfD since Dec 11)
- 21:23, 19 Dec 2004 Quadell deleted Image:Wikipedia logo eeeeee.png (Listed on IfD since Dec 11)
- 21:23, 19 Dec 2004 Quadell deleted Image:DiaryofAMadBand.jpg (Listed on IfD since Dec 11)
- 21:23, 19 Dec 2004 Quadell deleted Image:Stateflag at.jpg (Listed on IfD since Dec 11)
- 21:22, 19 Dec 2004 Quadell deleted Image:Flaga Pogon.jpg (Listed on IfD since Dec 11)
- 21:22, 19 Dec 2004 Quadell deleted Image:SACN member states.png (Listed on IfD since Dec 11)
- 21:22, 19 Dec 2004 Quadell deleted Image:Pioneer 10 Plaque.png (Listed on IfD since Dec 11)
- 21:22, 19 Dec 2004 Quadell deleted Image:Pioneer 10 Plaque-thumb.png (Listed on IfD since Dec 11)
- 21:22, 19 Dec 2004 Quadell deleted Image:Zero.jpg (Listed on IfD since Dec 11)
- 21:21, 19 Dec 2004 Deb deleted Prog punk (content was: 'Progressive Punk RockProg Punk')
- 21:21, 19 Dec 2004 Quadell deleted Image:Retard.jpg (Listed on IfD since Dec 11)
- 21:21, 19 Dec 2004 Quadell deleted Image:Retard11.jpg (Listed on IfD since Dec 11)
- 21:21, 19 Dec 2004 Quadell deleted Image:Roman2.jpg (Listed on IfD since Dec 11)
- 21:21, 19 Dec 2004 Quadell deleted Image:Roman1.jpg (Listed on IfD since Dec 11)
- 21:21, 19 Dec 2004 Quadell deleted Image:Roman0.jpg (Listed on IfD since Dec 11)
- 21:20, 19 Dec 2004 Quadell deleted Image:One.jpg (Listed on IfD since Dec 11)
- 21:20, 19 Dec 2004 Ahoerstemeier deleted Uberville (content was patent nonsense: 'Uberville is the capital, largest and only city of the Penguinicano Federation. In the 1850 census, it had 600 citizens. Uberville by any standard is ...')
- 21:20, 19 Dec 2004 Deb deleted Patrick marks (content was: 'Pat Marks is the coolest kid on Earth.')
- 21:19, 19 Dec 2004 Ahoerstemeier deleted Newegg (content was nonsense: 'Newegg is currently a company sponsoring the Jewish religion, and sponsoring Warcraft III: The Frozen Throne tournaments regularly. (See...')
- 21:18, 19 Dec 2004 Ahoerstemeier deleted Penguinicano Federation (content was patent nonsense)
- 21:08, 19 Dec 2004 Adam Bishop deleted Testare (content was: '[[Image:CommonsLogo.png|80px]]')
- 20:40, 19 Dec 2004 Adam Bishop deleted Susan Block (content was: '{{del}}Susan Block likes being cummed on. See 'bukkake'')
- 20:37, 19 Dec 2004 Bkonrad deleted 45252335 (content was: '{{delete}}45252335, or forty five million two hundred and fifty two thousand three hundred and thirty five is a number that is one more that 4525233...')
- 20:35, 19 Dec 2004 Bkonrad deleted 45252335 (content was: '45252335, or forty five million two hundred and fifty two thousand three hundred and thirty five is a number that is one more that 45252334, or forty ...')
- 20:34, 19 Dec 2004 Bkonrad deleted Atlantic Monthly Company (content was: '{{delete}}down with corporate media!')
- 20:32, 19 Dec 2004 Jpgordon restored "Aniyah_Red"
- 20:31, 19 Dec 2004 PMelvilleAustin restored "Image:Earlepage.jpg"
- 20:29, 19 Dec 2004 Jrdioko deleted ZGMF-X56S Impulse Gundam (content was: '{{delete}}lalalalalla')
- 20:28, 19 Dec 2004 Jrdioko deleted Sierra Madres (content was: '{{delete}}hello')
- 20:27, 19 Dec 2004 Jrdioko deleted Josef Issels (content was: '{{delete}}')
- 20:26, 19 Dec 2004 Jrdioko deleted Fred Meijer (content was: 'This guy rocks my world! I worked for him for six years and he is awsome.{{delete}}')
- 20:25, 19 Dec 2004 Neutrality deleted Treaty of 1818 (content was: '#REDIRECT[[Anglo-American Convention of 1818]]' page move)
- 20:22, 19 Dec 2004 Charles Matthews deleted Hibiya riots (content was: 'This is really cool.{{delete}}')
- 20:20, 19 Dec 2004 G-Man deleted Image:Liverpool skyline 700.jpg (An improved version of this has been uploaded so this is no longer needed)
- 20:19, 19 Dec 2004 DavidWBrooks deleted Matthew 27:25 (copied bible verse ... )
- 20:12, 19 Dec 2004 DavidWBrooks deleted The urbz sims in the city (juvenile duplication )
- 20:11, 19 Dec 2004 DavidWBrooks deleted Mike Leander (content was: '{{delete}}')
- 20:11, 19 Dec 2004 DavidWBrooks deleted Good nieghbor act (misspelled duplicate)
- 20:09, 19 Dec 2004 DavidWBrooks deleted Named Pipe (duplicate of existing page)
- 20:09, 19 Dec 2004 DavidWBrooks deleted Pickup (seduction) (original research, of particularly stupid type)
- 20:08, 19 Dec 2004 DavidWBrooks deleted Harry Cox (content was: '{{delete}}')
- 20:07, 19 Dec 2004 DavidWBrooks deleted Paul Guyer (content was: '{{del}}Kant scholar')
- 20:07, 19 Dec 2004 DavidWBrooks deleted Aidan cooper (content was: '{{delete}}Insane child. Juvenile Delinquent. Knowledge of over 80 pressure points. Goal is to murder Elliott. Not someone you want to meet in a ...')
- 20:07, 19 Dec 2004 DavidWBrooks deleted Birdsboro (content was: 'silt loam.{{delete}}')
- 20:06, 19 Dec 2004 DavidWBrooks deleted Skismism (joke/vandalism)
- 20:06, 19 Dec 2004 DavidWBrooks deleted Slutsky conditions (content was: 'Nahia!{{del}}')
- 19:46, 19 Dec 2004 Tkinias deleted Nile perch (redirect with no nontrivial history)
- 19:43, 19 Dec 2004 Kaihsu deleted Image:EFGP creamarial.gif (not used and obsolete [[Image:European Greens logo.png|right]])
- 19:42, 19 Dec 2004 Rmhermen deleted Wikipedy (content was: '== Wikipedy ==Wikipedy ''verb''; wikipedies, wikipedying, wikipediedVerb that expresses the act of searching for something through Wikipedia, or a...')
- 19:40, 19 Dec 2004 Infrogmation deleted Image:Scrapple slice.jpg (Listed on WP:PUI and tagged for deletion since 5 Oct)
- 19:39, 19 Dec 2004 Rmhermen deleted Government slazburg, austria
- 19:36, 19 Dec 2004 Rmhermen deleted Evan gewirtz (content was: 'xhgfclsfv')
- 19:33, 19 Dec 2004 Infrogmation deleted Image:BYJ.bmp (Listed on WP:PUI and tagged for deletion since 4 Nov. )
- 19:33, 19 Dec 2004 Infrogmation deleted Image:Dialectsofspain.jpg (Listed on WP:PUI and tagged for deletion since October)
- 19:32, 19 Dec 2004 Infrogmation deleted Image:A2419172-47.jpg (Listed on WP:PUI and tagged for deletion since 4 Nov. )
- 19:30, 19 Dec 2004 Rmhermen deleted Joel gewirtz (content was: 'Joel Gewirtz is a big glave inor marklar m'kay')
- 19:29, 19 Dec 2004 Rmhermen deleted Extinct subfamilies (content was: '{{del}}Sorry. Please delete this. Try to type something.')
- 19:28, 19 Dec 2004 Rmhermen deleted Slender-snouted Crocodile (content was: '== Headline text ==[http://www.example.com link title][[Link title]]''Italic text''')
- 18:53, 19 Dec 2004 Jnc deleted Talk:Armillary (xspace redir to User:)
- 18:51, 19 Dec 2004 SimonP deleted John Allen Fraser (prep for move)
- 18:46, 19 Dec 2004 Jnc deleted Wikipedians/Alex (xspace redir to User:)
- 18:28, 19 Dec 2004 Joy Stovall deleted Insite Incentive AB (vfd consensus to delete)
- 18:28, 19 Dec 2004 Infrogmation deleted Luísa Todi (WP:CP listed since 7 Dec;content was: '{{copyvio|url=http://www.instituto-camoes.pt/noticiario/musica/todi2.htm}}')
- 18:26, 19 Dec 2004 Joy Stovall deleted Royal Earlswood Manor ((Vfd consensus to delete)content was: '{{vfd}}A private residence located near [[Rice University]] in Houston, TX noted for its unusual landscaping and layout. Though the current propert...')
- 18:26, 19 Dec 2004 Infrogmation deleted Aucassin and Nicolette (WP:CP listed since 7 Dec; content was: '{{copyvio|url=http://www.cfcc.net/faculty/ghurley/261/aucandnico}}')
- 18:23, 19 Dec 2004 Joy Stovall deleted Karina Calzada (VFD consensus to delete)
- 18:21, 19 Dec 2004 ALoan restored "Template_talk:Otheruses"
- 18:21, 19 Dec 2004 ALoan restored "St_Ethelburga's_Bishopsgate"
- 18:19, 19 Dec 2004 Joy Stovall deleted List of people by reported IQ (VFD consensus to delete)
- 18:17, 19 Dec 2004 Joy Stovall deleted List of People by Known IQ ((Target article deleted) content was: '#REDIRECT [[List_of_people_by_reported_IQ]]')
- 18:16, 19 Dec 2004 Joy Stovall deleted Talk:List of People by Known IQ ((Target article deleted) content was: '#REDIRECT [[Talk:List of people by reported IQ]]')
- 18:13, 19 Dec 2004 Joy Stovall deleted List of People by Reported IQ ((Target article deleted) content was: '#REDIRECT [[List_of_people_by_reported_IQ]]')
- 18:13, 19 Dec 2004 Jnc deleted Wikipedia:Administrator's noticeboard/Archive1 (content was: '#Redirect [[Wikipedia:Administrator's_noticeboard/RfC-VfD]]' - was only ever a redir, moving page there)
- 18:12, 19 Dec 2004 Joy Stovall deleted Talk:List of People by Reported IQ ((Target article deleted) content was: '#REDIRECT [[Talk:List_of_people_by_reported_IQ]]')
- 18:11, 19 Dec 2004 Joy Stovall deleted List of people by IQ ( (Target article deleted) content was: '#REDIRECT [[List of people by reported IQ]]')
- 18:10, 19 Dec 2004 Joy Stovall deleted IQs of people ((Target article deleted) content was: '#REDIRECT [[List of people by reported IQ]]')
- 18:09, 19 Dec 2004 Joy Stovall deleted Talk:IQs of famous people ((Target article deleted) content was: '#REDIRECT [[Talk:IQ scores]]')
- 18:08, 19 Dec 2004 Joy Stovall deleted IQs of famous people ((target article deleted) content was: '#REDIRECT [[List of people by reported IQ]]')
- 18:07, 19 Dec 2004 Joy Stovall deleted IQ scores ((Target article deleted) content was: '#REDIRECT [[List of people by reported IQ]]')
- 18:05, 19 Dec 2004 Francs2000 deleted Starfire Pistol Model 31 (content was: 'Star Starfire')
- 18:05, 19 Dec 2004 Francs2000 deleted Daniel Landis (content was: 'Da bomb!')
- 18:03, 19 Dec 2004 Joy Stovall deleted Talk:List of people by reported IQ (VFD consensus to delete associated article page)
- 18:01, 19 Dec 2004 Francs2000 deleted Mirni (content was: 'Mirni is a The XL ([[DXL]]) project for developing new, and upgrading existing, technologies.')
- 17:59, 19 Dec 2004 Francs2000 deleted DXL (nonsense vanity content was: 'DXL (also known as The XL) is the acronym for D?niel X. Lion, an unknown software developer.----[http://www.thexl.net Web site]')
- 17:58, 19 Dec 2004 Francs2000 deleted Floyd County Correctional Institution (content was: 'FLOYD COUNTY PRISON')
- 17:56, 19 Dec 2004 Francs2000 deleted The Assistant (content was: '{{delete}}The Assistant is the best show in the entire world.')
- 17:56, 19 Dec 2004 Francs2000 deleted Cross sex position (content was: '{{delete}}sexual')
- 17:54, 19 Dec 2004 Quadell deleted Image:Stamp.switz.einstein.228pix.jpg (Unused scaled-down duplicate image)
- 17:54, 19 Dec 2004 Quadell deleted Image:Stamp.swiss.double.250pix.jpg (Unused scaled-down duplicate image)
- 17:50, 19 Dec 2004 Quadell deleted Image:Stamp.switz.einstein.684pix.pg.jpg (Unused duplicate image)
- 17:48, 19 Dec 2004 Quadell deleted Image:Stamos on Full House.jpg (Image has errors and does not display)
- 17:45, 19 Dec 2004 Rbrwr deleted Steve Chen (On WP:CP since DEcember 3; content was: '{{copyvio|url=http://202.113.29.200/eng/resch/Steve%20Chen%20CV.pdf}}')
- 17:42, 19 Dec 2004 Joy Stovall deleted Jeff Lehnert (content was: '{{vfd}}Jeff Lehnert is a student and photographer from Byron Center Michigan. He currently attends the University of Michigan in Ann Arbor. He is a...')
- 17:40, 19 Dec 2004 Rbrwr deleted Love is... (On WP:CP since Decmber 3; content was: '{{copyvio|url=http://hometown.aol.com/jey3858/myhomepage/profile.html}}')
- 17:35, 19 Dec 2004 Niteowlneils deleted Juliusz Kossak (content was: '{{db|devoid of substance}}')
- 17:33, 19 Dec 2004 Francs2000 deleted Patrick Wayne (content was: 'patrick wayne{{delete}}')
- 17:32, 19 Dec 2004 Joy Stovall deleted Elbert bill (VFD consensus to delete. content was: '{{vfd}}{{cleanup}}This bill is about the governal general of India under the British Govenment.{{substub}}')
- 17:27, 19 Dec 2004 MacGyverMagic deleted Prehistoric Europe (content was: 'This is a message to people that visit this site go on habbohotel.com and sgn up its safe')
- 17:27, 19 Dec 2004 Hadal deleted Misinformation (content was: '{{delete}}Misinformation is near to Disinformation.')
- 17:26, 19 Dec 2004 Joy Stovall deleted "Bria" (VFD consensus to delete)
- 17:24, 19 Dec 2004 Hadal deleted Sulfur cycle (content was: '''''''''''''''''How would you line up Protons and Neutrons in Sulfur?''''''''''''''''{{db|on yer bike!}}')
- 17:24, 19 Dec 2004 Joy Stovall deleted "Bia" (vfd consensus to delete)
- 17:24, 19 Dec 2004 Hadal deleted Talk:Valaryc (talk page of deleted article; content was: '{{del}}Val is gay lolol* Make up your mind. First you say he likes young cyber-females, now you say he's gay! When I was a troll, years ago, at le...')
- 17:17, 19 Dec 2004 Duncharris deleted Image:PAUL BOUCHE.jpg (photo from vanity page)
- 17:16, 19 Dec 2004 Francs2000 deleted United Kingdom tort law (content was: 'mnnn')
- 17:14, 19 Dec 2004 Francs2000 deleted The Broker (content was: 'hjhjkljhkjkkj')
- 17:14, 19 Dec 2004 MacGyverMagic deleted Edgy (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Edgy .}}{{move to Wiktionary}}'Edgy' is a fre...')
- 17:13, 19 Dec 2004 Joy Stovall deleted Xenuphobia (VFD consensus to delete)
- 17:12, 19 Dec 2004 Joy Stovall deleted Talk:Xenuphobia (Article deleted by VFD consensus. content was: 'Speaking as someone who's been a critic of Scientology for years, this article is rubbish. Do you have references for the supposed actions of Scientol...')
- 17:10, 19 Dec 2004 Joy Stovall deleted Ivan Remeta (VFD consensus to delete)
- 17:09, 19 Dec 2004 Niteowlneils deleted Talk:Tom Holt (content was: '{{del}}hello')
- 17:09, 19 Dec 2004 Niteowlneils deleted Wikipedia talk:Votes for deletion/Valaryc (content was: '{{del}}.')
- 17:06, 19 Dec 2004 Joy Stovall deleted Talk:List of people by reported SAT score (article page deleted by vfd consensus)
- 17:06, 19 Dec 2004 Francs2000 deleted Barcelona Cathedral (content was: ''''Bold text'''[[Image:Example.jpg]]Dorothy')
- 17:05, 19 Dec 2004 Joy Stovall deleted List of people by reported SAT score (vfd consensus to delete)
- 17:05, 19 Dec 2004 Niteowlneils deleted Jaime Lannister (content was: 'A dumb loser.{{delete}}')
- 17:04, 19 Dec 2004 Niteowlneils deleted Good Laboratory Practice (content was: 'is good{{delete}}')
- 17:04, 19 Dec 2004 Niteowlneils deleted Number of grassroots in C.A.I.R (content was: 'number of grassroots in C.A.I.R{{delete}}')
- 17:04, 19 Dec 2004 Jnc deleted Oddjobn99 (xspace redir to User:)
- 17:02, 19 Dec 2004 Niteowlneils deleted Dubli City FC (content was: '{{db|typo}}')
- 17:01, 19 Dec 2004 Niteowlneils deleted Erik-Christopher Seidenglanz (content was: 'Je t'aime, Pierrot.{{nonsense}}')
- 16:59, 19 Dec 2004 Francs2000 deleted Pictures of the Apaches (content was: 'do you have pictures or information on the Apaches?{{db|ask yourself why}}')
- 16:58, 19 Dec 2004 Joy Stovall deleted Adrian Bochenek (vfd consensus to delete)
- 16:55, 19 Dec 2004 Joy Stovall deleted Attraction pathology (vfd consensus to delete)
- 16:55, 19 Dec 2004 Andrevan restored "New_York_City"
- 16:55, 19 Dec 2004 Joy Stovall deleted Talk:Attraction pathology ((vfd consensus to delete) content was: 'this page is a load of biased, non-factual original research.I'd heavily edit it, but I'm tempted to say the very existence of this article is someth...')
- 16:52, 19 Dec 2004 Duncharris deleted English Armada (content was: 'jghjghjhhgj')
- 16:49, 19 Dec 2004 Joy Stovall deleted Hero of the day (vfd consensus to delete)
- 16:48, 19 Dec 2004 Francs2000 deleted Esquisse d'une théorie de la pratique, précédé de trois études d'ethnologie kabyle (content was: '{{delete}}esquisse d'une theorie de la pratique')
- 16:41, 19 Dec 2004 Joy Stovall deleted Tim burton holiday (VFD consensus to delete)
- 16:01, 19 Dec 2004 Francs2000 deleted Paul Phillips (II) (content was: '#REDIRECT [[Paul Phillips (Poker player)]]')
- 15:57, 19 Dec 2004 Francs2000 deleted Paul Phillips: Disambiguation (badly titled, no longer required content was: '#REDIRECT [[Paul Phillips]]')
- 15:53, 19 Dec 2004 Francs2000 deleted Paul Phillips (deleting for move content was: '#REDIRECT [[Paul Phillips (Guitarist)]]')
- 15:48, 19 Dec 2004 Francs2000 deleted Paul Phillips (I) (page move created by copy and paste, wrong title anyway)
- 15:46, 19 Dec 2004 Francs2000 deleted Woo Woo (content was: '{{db|patent nonsense.}}3 oz Vodka1 oz Peach Schnapps2 oz CranberryAdd ice and enjoy.')
- 15:44, 19 Dec 2004 Francs2000 deleted Corey Legere (content was: 'Corey, typical student, loves mustard.{{db|doesn't cut the mustard}}')
- 15:42, 19 Dec 2004 Francs2000 deleted 2201 (content was: '[[September 11]] Two-hundred year anniversary of the attacks on World Trade Center and the Pentagon.')
- 15:41, 19 Dec 2004 Francs2000 deleted Fool's Paradise (content was: 'A state of extreme happiness -- due to illusination.{{delete}}')
- 15:41, 19 Dec 2004 Francs2000 deleted GSM850 (content was: 'as sdas{{delete}}')
- 15:39, 19 Dec 2004 Francs2000 deleted Helmut Lotti (content was: '{{db|vanishingly small amount of text supplied}}')
- 15:37, 19 Dec 2004 Francs2000 deleted South-Central University for Nationalities (content was: 'South-Central University for Nationalities')
- 15:36, 19 Dec 2004 Francs2000 deleted The Human Factor (content was: '{{delete}}fuck all you negative')
- 15:34, 19 Dec 2004 Francs2000 deleted Juventude Comunista Portuguesa (content was: '[http://www.jcp-pt.org JCP]')
- 15:32, 19 Dec 2004 Francs2000 deleted Uriz (nonsense content was: 'Uriz is a norwegian gamer, he plays FPS games like Counter Strike and Call of Duty.He joined the clan [cue] a couple of months ago, and he is still t...')
- 15:30, 19 Dec 2004 Francs2000 deleted Biography (television program) (content was: 'israel')
- 15:30, 19 Dec 2004 Niteowlneils deleted 2003 Cancun WTO ministerial conference (pbpbpb...)
- 15:29, 19 Dec 2004 Niteowlneils deleted 602PC Suite (content was: '{{delete}}dfvf fdee f r')
- 15:28, 19 Dec 2004 Francs2000 deleted Totally Hair Barbie (content was: '{{delete}}HI')
- 15:28, 19 Dec 2004 Francs2000 deleted Bryan Dattilo (content was: '{{delete}}Bryan I love you')
- 15:26, 19 Dec 2004 Francs2000 deleted R600a (content was: '{{db|patent nonsense}}sdfd')
- 15:26, 19 Dec 2004 Francs2000 deleted Heather Lindell (content was: 'You are so beautiful')
- 15:18, 19 Dec 2004 Francs2000 deleted Sasha Pieterse (nonsense vanity content was: '{{deletebecause|vanity article?}}Sasha Pieterse was born on the 17th February 1996 in Johannesburg, South Africa. As the only child of around the wo...')
- 15:17, 19 Dec 2004 Francs2000 deleted Cascader (content was: 'An apple a day keep the headache away.')
- 15:16, 19 Dec 2004 Francs2000 deleted Shear strength (content was: 'lag bolts')
- 15:16, 19 Dec 2004 Francs2000 deleted SeanWT (content was: 'He's a nazi{{delete}}')
- 14:36, 19 Dec 2004 Charles Matthews deleted Jizzy tissue (nonsense)
- 14:01, 19 Dec 2004 Ahoerstemeier deleted Live at Wembley '86 (content were editing experiments)
- 13:59, 19 Dec 2004 Rbrwr deleted Anaconda (comics)/Temp (/Temp no longer needed after end of copyvio process. content was: '#REDIRECT [[Anaconda (comics)]]')
- 13:55, 19 Dec 2004 Ahoerstemeier deleted Marr-Albus model (content was: 'my name is surabhi')
- 13:55, 19 Dec 2004 Ahoerstemeier deleted Assc (content was: 'gfdgd')
- 13:35, 19 Dec 2004 Rbrwr deleted Anaconda (comics) (Listed on WP:CP since November 24. content was: '{{copyvio|url=http://www.blurty.com/users/galactus/day/2003/12/01}}')
- 13:31, 19 Dec 2004 Rbrwr deleted Adversary (comics) (Listed on WP:CP since November 24. content was: '{{copyvio|url=http://www.classicmarvel.com/cast/adversary.htm}}')
- 12:30, 19 Dec 2004 Jnc deleted Talk:Flag of Republic of Vietnam (redir; page-move tombstone)
- 12:26, 19 Dec 2004 Charles Matthews deleted Leukimia (content was: 'save page{{delete}}')
- 12:26, 19 Dec 2004 Charles Matthews deleted Asscunt (content was: 'GIANENNIO!{{delete}}')
- 12:25, 19 Dec 2004 Jnc deleted Flag of the Republic of Vietnam (redir, target of rename)
- 12:18, 19 Dec 2004 Ambi deleted Http://en.wikipedia.org/wiki/Wikipedia:Featured article candidates/Norse mythology (content was: '#redirect[[Wikipedia:Featured_article_candidates/Norse_mythology]]')
- 11:53, 19 Dec 2004 Adam Bishop deleted SeanWT (content was: ''''SeanWT'''Very nooby. Picture of his girlfriend:[[Image:Naziswastika.png]][[Image:Naziswastika.png]][[Image:Naziswastika.png]][[Image:Naziswa...')
- 11:48, 19 Dec 2004 Adam Bishop deleted SeanWT (still junk)
- 11:47, 19 Dec 2004 Adam Bishop deleted SeanWT (junk)
- 11:46, 19 Dec 2004 Adam Bishop deleted Talk:SeanWT (content was: 'I sense much angst in this general direction - eXemplarsean is a noob - regexhe's a bit gay- anonymous')
- 11:41, 19 Dec 2004 Rlandmann deleted Seanwt (no meaningful content)
- 11:30, 19 Dec 2004 Deb deleted Cherie(album) (content was: '{{delete}}')
- 11:28, 19 Dec 2004 Deb deleted Marlin Fitzwater (content was: '{{del}}a total tool')
- 11:27, 19 Dec 2004 Deb deleted Star:Oberon (content was: '{{delete}}*Hello*{{NAMESPACE}}*{{PAGENAME}}*{{NUMBEROFARTICLES}}*[[{{NAMESPACE}}:{{PAGENAME}}]]')
- 11:25, 19 Dec 2004 Adam Bishop deleted HISTORY OF NIKE (content was: 'OK, LETS GO SLOWLY CUZ ULL SUFFER AFTR REEDIN DIS PAGE NIK'S WER INVENTED BY FUCKER IDIOT STUPID BITCH LIK gggggggggggggggggggggaaaaaaaaaaaaaaaaaaaaay...')
- 10:47, 19 Dec 2004 Snoyes deleted Image:Dortmund in Germany.png (superseded by [[Image:Dortmund-Position.png]])
- 10:44, 19 Dec 2004 Snoyes deleted Image:Ingolstadt in Germany.png (superseded by [[Image:Ingolstadt-Position.png]])
- 10:12, 19 Dec 2004 AllyUnion deleted Nonrepidiable (The word is spelled 'nonrepudiable' but nothing was on it but a comment)
- 10:11, 19 Dec 2004 AllyUnion deleted Snaga (vanity / advertisement for a [[LARP]] group)
- 10:08, 19 Dec 2004 Rbrwr deleted Sevruguin (On WP:CP since November 8 - content was: '{{copyvio|url=http://www.geocities.com/sevruguin/}}[[User:Lupo|Lupo]] 08:25, 8 Nov 2004 (UTC)')
- 09:55, 19 Dec 2004 AllyUnion deleted Adolph Gottlieb (content was: '{{deletebecause|only content ever was the single word 'auto', since blanked by creator [[User:213.178.106.178]]}}')
- 09:52, 19 Dec 2004 AllyUnion deleted Duke Nukem: Total Meltdown (content was: 'vufuffururf' / sandbox like stuff by anon ip)
- 09:50, 19 Dec 2004 AllyUnion deleted AKST (content was: '{{nonsense}}alaska is the beautiful country which support commmunist last elections and this election he also support bush as a communist this is the...')
- 09:32, 19 Dec 2004 Adam Bishop deleted Martin Capogna (content was: '{{del}}Martin Capogna is the greatest man alive. He lives in Sweden right now.')
- 09:31, 19 Dec 2004 ALoan restored "Hobbit"
- 09:14, 19 Dec 2004 Infrogmation deleted Image:PisaDuomo1922NatGeog.jpg (old thumbnail, no longer needed)
- 09:08, 19 Dec 2004 Infrogmation deleted Cusil (content was: '{{db|null and void}}')
- 09:07, 19 Dec 2004 Infrogmation deleted Twosret (Substub with less info than what links here; content was: 'Twosret was an ancient egyptian queen.{{substub}}')
- 09:05, 19 Dec 2004 Infrogmation deleted Dhana ({{del}})
- 09:03, 19 Dec 2004 Infrogmation deleted Code bloat (content was: '{{delete}}codebloat')
- 09:01, 19 Dec 2004 Academic Challenger deleted Coma (movie) (content was: '{{delete}}nude')
- 08:57, 19 Dec 2004 Andris deleted "wire brock" (content was: 'Major component of Leah's com. It didn't work, but eventually got fixed.')
- 08:54, 19 Dec 2004 Infrogmation deleted Battle Fleet (content was: 'Battle Fleet{{db|rhymes with delete}}')
- 08:53, 19 Dec 2004 Infrogmation deleted Atopic (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Atopic .}}{{Move to wiktionary}}A medical term...')
- 08:51, 19 Dec 2004 Infrogmation deleted Finol paradox (content was: '{{db|null}}'; previously blanked by original/only other editor)
- 08:48, 19 Dec 2004 Infrogmation deleted Mehedi (content was: '{{del}}mehedi')
- 08:48, 19 Dec 2004 Infrogmation deleted University of Makati, Makati City (content was: 'what are the contact no of makati university')
- 08:39, 19 Dec 2004 Ta bu shi da yu restored "AMOK!_South_Africa"
- 08:39, 19 Dec 2004 Ta bu shi da yu deleted AMOK! South Africa (content was: '{{copyvio|url=http://www.amok.co.za/AMOKText/HistoryText.htm}}')
- 08:36, 19 Dec 2004 Ta bu shi da yu restored "AMOK!_South_Africa"
- 08:25, 19 Dec 2004 Ta bu shi da yu deleted AMOK! South Africa (finished checking it out)
- 08:23, 19 Dec 2004 Blankfaze deleted User:Blankfaze/Arbcom (no longer needed)
- 08:22, 19 Dec 2004 Blankfaze deleted User:Blankfaze/acAD (old stuff)
- 08:22, 19 Dec 2004 Ta bu shi da yu restored "AMOK!_South_Africa"
- 08:08, 19 Dec 2004 Gadfium deleted Pine Crest School (content was: 'hghgfhf')
- 07:40, 19 Dec 2004 Jimfbleak deleted Flask (content was: 'deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Flask .}}{{move to Wiktionary}}{{cleanup}}''...')
- 07:09, 19 Dec 2004 Neutrality deleted Image:Rosie-the-riveter-dot.jpg (Obselete.)
- 06:36, 19 Dec 2004 Ta bu shi da yu deleted User talk:Ta bu shi da yu/NetoholicArchive5 (As requested by Netoholic, deleting)
- 06:35, 19 Dec 2004 Ta bu shi da yu deleted User talk:Ta bu shi da yu/NetoholicArchive4 (As requested by Netoholic, deleting)
- 06:35, 19 Dec 2004 Ta bu shi da yu deleted User talk:Ta bu shi da yu/NetoholicArchive3 (As requested by Netoholic, deleting)
- 06:35, 19 Dec 2004 Ta bu shi da yu deleted User talk:Ta bu shi da yu/NetoholicArchive2 (As requested by Netoholic, deleting)
- 06:34, 19 Dec 2004 Ta bu shi da yu deleted User talk:Ta bu shi da yu/NetoholicArchive1 (As requested by Netoholic, deleting)
- 06:34, 19 Dec 2004 Gadfium deleted French presidential election, 1965 (content was: '{{delete}}'''Bold text'''[http://www.example.com link title]')
- 06:26, 19 Dec 2004 Fire Star deleted Valaryc (Speedy delete libellous article.)
- 06:24, 19 Dec 2004 Slowking Man deleted Marissa fawcett (Vanity spam)
- 06:23, 19 Dec 2004 Slowking Man deleted Stephanie vaswer (Vanity spam)
- 06:22, 19 Dec 2004 Slowking Man deleted James forde (Vanity spam)
- 06:19, 19 Dec 2004 Gadfium deleted Redux (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Redux .}}{{move to Wiktionary}}ReduxMeaning...')
- 06:19, 19 Dec 2004 Neutrality deleted Billdo (content was: 'Billdo refers to the nickname of Bill Martlink.He is tall and slim, similar to how you would expect a 'billdo' to look.It is his license plate and...')
- 06:18, 19 Dec 2004 Gadfium deleted Ravine (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Ravine .}}{{move to Wiktionary}}The word '''R...')
- 06:17, 19 Dec 2004 Slowking Man deleted Cherie(album) (content was: '[http://images.amazon.com/images/P/B0000X7COE.01.LZZZZZZZ.jpg]')
- 06:17, 19 Dec 2004 Slowking Man deleted Cherie(album) (content was: '[http://images.amazon.com/images/P/B0000X7COE.01.LZZZZZZZ.jpg]')
- 06:17, 19 Dec 2004 Gadfium deleted New English Alphabet (content was: '{{delete}}my name is dan')
- 06:15, 19 Dec 2004 Gadfium deleted Kodacolor (content was: 'There is no God. Whoever believes in him should die. The Illuminati have come back. You shall all see our resurection...{{nonsense}}')
- 06:15, 19 Dec 2004 AndyL deleted Category:Flags of the provinces of Canada (contents moved to Category:Flags of Canada)
- 06:14, 19 Dec 2004 Gadfium deleted Humdrum (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Humdrum .}} ''Humdrum''. Lacking variety or e...')
- 06:13, 19 Dec 2004 Gadfium deleted Great-grandparent (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Great-grandparent .}}{{move to Wiktionary}}Yo...')
- 05:51, 19 Dec 2004 Quadell deleted Image:Stamp.france.curie.250pix.jpg (Scaled-down duplicate image)
- 05:50, 19 Dec 2004 Gtrmp deleted Talk:Muse (Goddess) (content was: '#REDIRECT [[Talk:Muse]]')
- 05:49, 19 Dec 2004 Gtrmp deleted Category:Inca mythology (content was: '#redirect [[:Category:Incan mythology]]')
- 05:48, 19 Dec 2004 Gtrmp deleted Muse (delete redundant disambig for page move)
- 05:47, 19 Dec 2004 Rdsmith4 deleted Double vaginal (content was: '{{delete}}women ejaculation')
- 05:46, 19 Dec 2004 Gtrmp deleted Talk:Muse (content was: '#REDIRECT [[Talk:Muse (Goddess)]]')
- 05:45, 19 Dec 2004 Jmabel deleted Colin Gregory Palmer (had been previously deleted via VfD; reappeared)
- 05:44, 19 Dec 2004 Quadell deleted Image:Ss227 h-d.jpg (Image has errors and will not display)
- 05:43, 19 Dec 2004 Quadell deleted Image:Ss227 h-d tn.jpg (Image has errors and will not display)
- 05:41, 19 Dec 2004 Gtrmp deleted Category:Incan mythology (content was: 'See also [[:Category:Aztec mythology]].[[Category:Religion]][[es:Categoría:Mitología inca]][[nl:Categorie:Inca mythologie]]')
- 05:39, 19 Dec 2004 Gtrmp deleted Category:Incan gods (content was: '#REDIRECT [[:Category:Inca gods]].')
- 05:39, 19 Dec 2004 Gtrmp deleted Category:Incan goddesses (content was: '#REDIRECT [[:Category:Inca goddesses]].')
- 05:32, 19 Dec 2004 Arminius deleted Capital expenditure
- 05:07, 19 Dec 2004 Gadfium deleted Kehot Publication Society (content was: '{{del}}www.kehotonline.com')
- 05:00, 19 Dec 2004 Gadfium deleted Plunder (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Plunder .}}{{Move to Wiktionary}}== ''''''Plun...')
- 04:57, 19 Dec 2004 Ta bu shi da yu deleted Talk:2004 U.S. presidential elections and crimes against humanity (content was: '{{db|left-over from page move vandalism.}}#redirect [[Talk:2004 U.S. presidential election controversy and irregularities]]')
- 04:57, 19 Dec 2004 Gadfium deleted Portuguese Sign Language (content was: '{{delete}}eu ando de carro')
- 04:56, 19 Dec 2004 Gadfium deleted Qwan (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Qwan .}}'''quality without a name''' - in compu...')
- 04:54, 19 Dec 2004 Gadfium deleted Radagast (mythology) (content was: '{{del}}He had a big head and no eyes and black feet and green hair and ate st. nicks eggs')
- 04:53, 19 Dec 2004 Gadfium deleted Hen a (content was: '{{d}}for hentai go to hentailand.com')
- 04:51, 19 Dec 2004 Andrevan deleted 00ber (Pokémon) (This was deleted on VfD, and it came back. It hasn't changed much. Deleting it again.)
- 04:51, 19 Dec 2004 Gadfium deleted Image:Belomorkanal.JPG (Moved to commons)
- 04:49, 19 Dec 2004 Gadfium deleted Image:Mazowsze Warszawa.png (Moved to commons)
- 04:48, 19 Dec 2004 Gadfium deleted Image:Mazowsze Numerki.png (Moved to commons)
- 04:48, 19 Dec 2004 Gadfium deleted Image:Maluch.jpg (Moved to commons)
- 04:47, 19 Dec 2004 Gadfium deleted Image:Machocki marian.jpg (Moved to commons)
- 04:46, 19 Dec 2004 Gadfium deleted Image:Kobryn.png (Moved to commons)
- 04:45, 19 Dec 2004 Gamaliel deleted Swede hanson (content was: '{{del}}socalled first president of the united states.')
- 04:45, 19 Dec 2004 Gadfium deleted Image:Battle of Wizna.png (Moved to commons)
- 04:45, 19 Dec 2004 Gadfium deleted Image:Battle of Warsaw - Phase 2.png (Moved to commons)
- 04:44, 19 Dec 2004 Gadfium deleted Image:Battle of Warsaw - Phase 1.png (Moved to commons)
- 04:43, 19 Dec 2004 Gadfium deleted Image:Metro Warszawskie.jpg (Moved to commons)
- 04:42, 19 Dec 2004 Gadfium deleted Image:Powazki wrzesien 4.JPG (Moved to commons)
- 04:41, 19 Dec 2004 Gadfium deleted Image:Powazki wrzesien 3.JPG (Moved to commons)
- 04:41, 19 Dec 2004 Gadfium deleted Image:Powazki wrzesien 2.JPG (Moved to commons)
- 04:40, 19 Dec 2004 Gadfium deleted Image:Powazki wrzesien 1.JPG (Moved to commons)
- 04:39, 19 Dec 2004 Gadfium deleted Image:Powazki powstanie 1.JPG (Moved to commons)
- 04:39, 19 Dec 2004 Gadfium deleted Image:Powazki Tuwim.JPG (Moved to commons)
- 04:38, 19 Dec 2004 Gadfium deleted Image:Powazki Szpilman.JPG (Moved to commons)
- 04:38, 19 Dec 2004 Gadfium deleted Image:Powazki Kuron.JPG (Moved to commons)
- 04:31, 19 Dec 2004 Fennec deleted Peculiarities of Ohio place names (per {{Wikipedia:Votes for deletion/Peculiarities of Ohio place names}})
- 04:30, 19 Dec 2004 Chris 73 deleted Image:SyphonotaGeographicaAntalyaTurkey.jpg (moved to commons as Image:Syphonota Geographica, Antalya, Turkey 1.jpg)
- 04:30, 19 Dec 2004 Fennec deleted Saw 2: Hacksaw (per {{Wikipedia:Votes for deletion/Saw 2: Hacksaw}})
- 04:30, 19 Dec 2004 Gadfium deleted Image:Powazki Halibutt.JPG (Moved to commons)
- 04:30, 19 Dec 2004 Fennec deleted Perplex City (per {{Wikipedia:Votes for deletion/Perplex City}})
- 04:29, 19 Dec 2004 Gadfium deleted Image:Powazki Bierut.JPG (Moved to commons)
- 04:29, 19 Dec 2004 Gadfium deleted Image:Poland 1939.png (Moved to commons)
- 04:27, 19 Dec 2004 Fennec deleted Talk:Philip Emeagwali on Brain Drain (parent page was deleted, this page contains naught but unanswered and confused discussion about whether the page qualifies for speedy deletion)
- 04:27, 19 Dec 2004 Gadfium deleted Image:Uprising Grob.png (Moved to commons)
- 04:26, 19 Dec 2004 Fennec deleted Philip Emeagwali on Brain Drain (per {{Wikipedia:Votes for deletion/Philip_Emeagwali_on_Brain_Drain}})
- 04:26, 19 Dec 2004 Gadfium deleted Image:Warszawa Uniwersytet.png (Moved to commons)
- 04:26, 19 Dec 2004 Jrdioko deleted Ohmstead Break (content was: '{{del}}fdafdfr fasfsfs----')
- 04:26, 19 Dec 2004 Gadfium deleted Image:Warszawa Starowka1.png (Moved to commons)
- 04:25, 19 Dec 2004 Fennec deleted Eric Buisson (per {{Wikipedia:Votes for deletion/Eric Buisson}})
- 04:25, 19 Dec 2004 Gadfium deleted Image:Warszawa Rynek2.png (Moved to commons)
- 04:24, 19 Dec 2004 Gadfium deleted Image:Warszawa Rynek.png (Moved to commons)
- 04:23, 19 Dec 2004 Gadfium deleted Image:Warszawa Namiestnikowski.png (Moved to commons)
- 04:23, 19 Dec 2004 Gadfium deleted Image:Warszawa Powstaniec.png (Moved to commons)
- 04:22, 19 Dec 2004 Gadfium deleted Image:Warsaw Saski.JPG (Moved to commons)
- 04:20, 19 Dec 2004 Gadfium deleted Image:Warszawa Poniatowski.png (Moved to commons)
- 04:20, 19 Dec 2004 Gadfium deleted Image:Warszawa NowySwiat.png (Moved to commons)
- 04:18, 19 Dec 2004 Gadfium deleted Image:Warsaw Tomb.JPG (Moved to commons)
- 04:17, 19 Dec 2004 Gadfium deleted Image:Warszawa Atlas.png (Moved to commons)
- 04:17, 19 Dec 2004 Gadfium deleted Image:Warszawa Bednarska.png (Moved to commons)
- 04:16, 19 Dec 2004 Gadfium deleted Image:Warszawa Copernicus.png (Moved to commons)
- 04:13, 19 Dec 2004 Gadfium deleted Image:Warszawa Mickiewicz.png (Uploader request "moved to commons")
- 04:09, 19 Dec 2004 Rdsmith4 deleted Template:Id (content was: '{{delete}}' - at Kieff's request)
- 04:08, 19 Dec 2004 Gadfium deleted Image:Capture.png (Request by creator/uploader)
- 04:06, 19 Dec 2004 Jerzy deleted Ambition (card game) (Same as before as stated on its talk page archive1)
- 04:02, 19 Dec 2004 Gadfium deleted Histroical regions of Central Europe (content was: '{{del}}bohemia')
- 04:01, 19 Dec 2004 Gadfium deleted Universal truth (content was: '{{del}}A universal truth is that for which there is no evidence required!')
- 03:59, 19 Dec 2004 Gadfium deleted Talk:Philibain (content was: '{{delete}}Clearly a hoax by its content; 'Philibain' doesn't not return any results in Google. [[User:Etz Haim|Etz Haim]] 19:20, 9 Dec 2004 (UTC)')
- 03:58, 19 Dec 2004 Gadfium deleted Talk:Dink alphabet (content was: '{{del}}Why are you trying to deny the truth? FREE DINK! Csladmagda hiromusz.')
- 03:56, 19 Dec 2004 Gadfium deleted Ditate-DS (content was: '{{del}}looking for information on ditate d.s. what is it why and what is it used for')
- 03:55, 19 Dec 2004 Jrdioko deleted Treaty of Huangpu (content was: '{{del}}weeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee')
- 03:55, 19 Dec 2004 Gadfium deleted Infinite regress (content was: '{{del}}If there can be no one truth on which to base all others, a system is necessary. One could either assume a certain set of facts are true and ...')
- 03:54, 19 Dec 2004 Gadfium deleted Optimus Prime (person)llll (content was: '{{del}}optimus prime is the second cousin of Hubert Cumberdale. Hubert Cumberdale tastes like sunshine dust. Optimus Prime enjoys a nice steak on a ...')
- 03:35, 19 Dec 2004 DavidWBrooks deleted Aniyah Red (content was: '{{vfd}} - trivial, incomprehensible)
- 03:31, 19 Dec 2004 DavidWBrooks deleted Invention of the telephone (copyvio copty-and-paste)
- 03:29, 19 Dec 2004 ALoan restored "Second_Congo_War"
- 03:21, 19 Dec 2004 Cyrius deleted Incompatible suite upgrade pattern (CSD - no context/definition +copyvio in history)
- 03:21, 19 Dec 2004 Cyrius deleted Compatible suite upgrade pattern (redirect to CSD)
- 03:21, 19 Dec 2004 Cyrius deleted Compatible-suite-upgrade pattern (CSD - no context/definition +copyvio in history)
- 03:19, 19 Dec 2004 Francs2000 deleted East Tamaki (content was: '{{del}}east tamaki')
- 03:18, 19 Dec 2004 DavidWBrooks deleted 1,400 lakes (content was: '{{rfd}}#REDIRECT [[List of lakes in Estonia]]')
- 03:18, 19 Dec 2004 Francs2000 deleted Wheelbarrow position (content was: '{{del}}wheelbarrow')
- 03:17, 19 Dec 2004 DavidWBrooks deleted Ataque de fuerza bruta (content was: '[http://www.hotmail.com link title][[genitallica57@hotmail.com Link title]]')
- 03:15, 19 Dec 2004 Rmhermen deleted Thalusminiousus (content was: '{{nonsense}}''There are no google hits for this article''.'''Thalusminiousus'''- A disease in which inert hydrogen gas obstructs cellular permeabil...')
- 03:12, 19 Dec 2004 DavidWBrooks deleted Tps reports (content was: '{{del}}Reports that Peter didn't get the memo for.')
- 03:11, 19 Dec 2004 Chris 73 deleted Image:Zeppelin Bend HowTo.jpg (moved to commons)
- 03:11, 19 Dec 2004 Chris 73 deleted Image:Zeppelin Bend Final.jpg (moved to commons)
- 03:11, 19 Dec 2004 Chris 73 deleted Image:ZaruSoba.jpg (moved to commons)
- 03:11, 19 Dec 2004 Chris 73 deleted Image:WorldWideWebAroundWikipedia.png (moved to commons)
- 03:11, 19 Dec 2004 Chris 73 deleted Image:WorldWideWebAroundGoogle.png (moved to commons)
- 03:11, 19 Dec 2004 Chris 73 deleted Image:WirelessToiletControlPanel.jpg (moved to commons)
- 03:10, 19 Dec 2004 Chris 73 deleted Image:Wireless toilet control panel w. open lid.jpg (moved to commons)
- 03:10, 19 Dec 2004 Chris 73 deleted Image:Wireless toilet control panel w. open lid Numbered Buttons.jpg (moved to commons)
- 03:10, 19 Dec 2004 Chris 73 deleted Image:WaterSavingToiletJapan.jpg (moved to commons)
- 03:10, 19 Dec 2004 SimonP deleted RIDICULOUS (content was: 'MEANING BEING FUNNY,STUPID,BEING OUT OF MIND,DUMB.')
- 03:10, 19 Dec 2004 Chris 73 deleted Image:WaterAndFlourSuspensionLiquid.jpg (moved to commons)
- 03:10, 19 Dec 2004 Chris 73 deleted Image:WasabiOnOroshigane.jpg (moved to commons)
- 03:10, 19 Dec 2004 Chris 73 deleted Image:ViewOfMagdeburg.jpg (moved to commons)
- 03:09, 19 Dec 2004 Chris 73 deleted Image:VAMap-doton-Richmond.png (moved to commons)
- 03:09, 19 Dec 2004 Chris 73 deleted Image:Urokotori.FishScaler.jpg (moved to commons)
- 03:09, 19 Dec 2004 Chris 73 deleted Image:Unagisakihocho.EelKnife.jpg (moved to commons)
- 03:09, 19 Dec 2004 Chris 73 deleted Image:UdonKnife.jpg (moved to commons)
- 03:09, 19 Dec 2004 Chris 73 deleted Image:Tsukiji.CuttingFrozenTuna.jpg (moved to commons)
- 03:09, 19 Dec 2004 Chris 73 deleted Image:TsubameYuOnsenEntrance.jpg (moved to commons)
- 03:08, 19 Dec 2004 Chris 73 deleted Image:TofuWithSoySauceAndCarrot.jpg (moved to commons)
- 03:07, 19 Dec 2004 Chris 73 deleted Image:Timber Hitch HowTo.jpg (moved to commons)
- 03:07, 19 Dec 2004 Chris 73 deleted Image:Timber Hitch Final.jpg (moved to commons)
- 03:07, 19 Dec 2004 Chris 73 deleted Image:ThreeWiseVirginsMagdeburg.jpg (moved to commons)
- 03:07, 19 Dec 2004 Chris 73 deleted Image:ThreeFoolishVirginsMagdeburg.jpg (moved to commons)
- 03:07, 19 Dec 2004 Chris 73 deleted Image:TheApricotWasher.jpg (moved to commons)
- 03:07, 19 Dec 2004 Jerzy deleted Ambition (card game) (Speedy del since previously VfD-deleted)
- 03:07, 19 Dec 2004 Chris 73 deleted Image:Taut Line Hitch HowTo.jpg (moved to commons)
- 03:07, 19 Dec 2004 Chris 73 deleted Image:Taut Line Hitch Final.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:Takoyakikado.Pan.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:TakoBiki.YanagiBa.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:TakenokoBambooSprouts.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:TaikoDrummersAichiJapan.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:Suribachi.MortarPestle.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:Suikinkutsu CrossSection.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:Shamoji.JapaneseRiceSpoon.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:SentoLayout.C73.NoLabel.jpg (moved to commons)
- 03:06, 19 Dec 2004 Chris 73 deleted Image:SentoLayout.C73.English.jpg (moved to commons)
- 03:05, 19 Dec 2004 Chris 73 deleted Image:Sento.EdoTokyoOutdoorMuseum.jpg (moved to commons)
- 03:05, 19 Dec 2004 Chris 73 deleted Image:SDMap-doton-Pierre.png (moved to commons)
- 03:05, 19 Dec 2004 Chris 73 deleted Image:SCMap-doton-Columbia.png (moved to commons)
- 03:05, 19 Dec 2004 SimonP deleted Røsberg (content was: 'A familyname in Norway.--[[User:Roslar|L-CH.R.]] 11:39, 16 Dec 2004 (UTC)')
- 03:05, 19 Dec 2004 Chris 73 deleted Image:SakuraBlossomsCloseUp.jpg (moved to commons)
- 03:05, 19 Dec 2004 Chris 73 deleted Image:Saint Maurice Magdeburg.jpg (moved to commons)
- 03:05, 19 Dec 2004 Chris 73 deleted Image:ReindeerLoosingVelvet.jpg (moved to commons)
- 03:05, 19 Dec 2004 Chris 73 deleted Image:RaceMugshots.jpg (moved to commons)
- 03:04, 19 Dec 2004 Chris 73 deleted Image:ParallelParkingAnimation.gif (moved to commons)
- 03:04, 19 Dec 2004 Neutrality deleted Who is Eric Auvinen? (content was: '#REDIRECT[[Kryptonite Studios]]')
- 03:04, 19 Dec 2004 Chris 73 deleted Image:PachinkoPlayers.jpg (moved to commons)
- 03:04, 19 Dec 2004 Chris 73 deleted Image:OtoshiButa.DropLid.jpg (moved to commons)
- 03:04, 19 Dec 2004 Neutrality deleted Who Is Eric Auvinen? (content was: '#REDIRECT[[Kryptonite Studios]]')
- 03:04, 19 Dec 2004 Neutrality deleted Kryptonite Studios (content was: '{{vfd}}'''Kryptonite Studios''' is a website that hosts at least six home-made and home-edited videos.{{stub}}')
- 03:03, 19 Dec 2004 Chris 73 deleted Image:Oshizushihako.PressedSushiMold.jpg (moved to commons)
- 03:03, 19 Dec 2004 Chris 73 deleted Image:Oroshigane.Sharkskin.jpg (moved to commons)
- 03:03, 19 Dec 2004 Chris 73 deleted Image:ORMap-doton-Salem.png (moved to commons)
- 03:03, 19 Dec 2004 Chris 73 deleted Image:OnsenEntranceInHakkone.jpg (moved to commons)
- 03:03, 19 Dec 2004 Chris 73 deleted Image:OldJapaneseToilet.jpg (moved to commons)
- 03:03, 19 Dec 2004 Chris 73 deleted Image:OdaibaView.jpg (moved to commons)
- 03:03, 19 Dec 2004 Chris 73 deleted Image:NYMap-doton-Albany.png (moved to commons)
- 03:02, 19 Dec 2004 Chris 73 deleted Image:NoguchiMoerenumaPark.jpg (moved to commons)
- 03:02, 19 Dec 2004 SimonP deleted Mozex tutorial (content was: 'Somebody delete this page. I made it by mistake.')
- 03:02, 19 Dec 2004 Chris 73 deleted Image:NoguchiBlackSlideMantraOutside.jpg (moved to commons)
- 03:02, 19 Dec 2004 Chris 73 deleted Image:NoguchiBlackSlideMantraInside.jpg (moved to commons)
- 03:02, 19 Dec 2004 Chris 73 deleted Image:NHMap-doton-Concord.png (moved to commons)
- 03:02, 19 Dec 2004 Chris 73 deleted Image:NEMap-doton-Lincoln.png (moved to commons)
- 03:02, 19 Dec 2004 Chris 73 deleted Image:NautilusCutawayLogarithmicSpiral.jpg (moved to commons)
- 03:02, 19 Dec 2004 Chris 73 deleted Image:NarutoStraitFlow.jpg (moved to commons)
- 03:02, 19 Dec 2004 SimonP deleted Fernão da Po (content was: 'Fernão do Pó, not «da Po»')
- 03:01, 19 Dec 2004 Chris 73 deleted Image:Mushiki.Steamer.jpg (moved to commons)
- 03:01, 19 Dec 2004 Chris 73 deleted Image:MTMap-doton-Helena.png (moved to commons)
- 03:01, 19 Dec 2004 Chris 73 deleted Image:MSMap-doton-Jackson.png (moved to commons)
- 03:01, 19 Dec 2004 Chris 73 deleted Image:Monkey Fist HowTo.jpg (moved to commons)
- 03:01, 19 Dec 2004 Neutrality deleted KryptoniteStudios.com (content was: '#REDIRECT[[Kryptonite Studios]]')
- 03:01, 19 Dec 2004 Chris 73 deleted Image:Monkey Fist Final.jpg (moved to commons)
- 03:01, 19 Dec 2004 Chris 73 deleted Image:Monastery Unser Lieben Frauen Magdeburg.jpg (moved to commons)
- 03:01, 19 Dec 2004 Chris 73 deleted Image:MNMap-doton-Saint-Paul.png (moved to commons)
- 03:01, 19 Dec 2004 Chris 73 deleted Image:MIMap-doton-Lansing.png (moved to commons)
- 03:01, 19 Dec 2004 Chris 73 deleted Image:MenstrualCycle.sxd (moved to commons)
- 03:01, 19 Dec 2004 Chris 73 deleted Image:MenstrualCycle.png (moved to commons)
- 03:00, 19 Dec 2004 Chris 73 deleted Image:MEMap-doton-Augusta.png (moved to commons)
- 03:00, 19 Dec 2004 Neutrality deleted Killa (content was: '#REDIRECT[[Kryptonite Studios]]')
- 03:00, 19 Dec 2004 Neutrality deleted Fluffie Bunnie Clan (content was: '#REDIRECT[[Kryptonite Studios]]')
- 03:00, 19 Dec 2004 Neutrality deleted The Mental Patient (content was: '#REDIRECT[[Kryptonite Studios]]')
- 02:59, 19 Dec 2004 Neutrality deleted Mental Patient, The (content was: '#REDIRECT[[Kryptonite Studios]]')
- 02:59, 19 Dec 2004 Chris 73 deleted Image:Onsen in Nachikatsuura, Japan.jpg (moved to commons)
- 02:59, 19 Dec 2004 Neutrality deleted Who Is Eric Auvinen (content was: '#REDIRECT[[Kryptonite Studios]]')
- 02:59, 19 Dec 2004 Rmhermen deleted Russian Institute for Development of Public Networks (content was: '{{nonsense}}evil trees like to bath in brine')
- 02:58, 19 Dec 2004 Rmhermen deleted Locket (content was: '{{del}}Cool Shit!!!')
- 02:58, 19 Dec 2004 Neutrality deleted Talk:Kryptonite Studios (content was: 'One of the BEST sites EVER!')
- 02:58, 19 Dec 2004 Neutrality deleted Kryptonite Studios (content was: 'Here Are Some Quotes From The KRYPTONITE STUDIOS Videos!')
- 02:58, 19 Dec 2004 Chris 73 deleted Image:Mark 48 Torpedo testing.jpg (moved to commons)
- 02:57, 19 Dec 2004 Chris 73 deleted Image:MAMap-doton-Boston.png (moved to commons)
- 02:57, 19 Dec 2004 Chris 73 deleted Image:MakisuMats.Japan.jpg (moved to commons)
- 02:57, 19 Dec 2004 Chris 73 deleted Image:Makiribocho.Osaka.Tokyo.jpg (moved to commons)
- 02:57, 19 Dec 2004 Chris 73 deleted Image:Kushi.Skewers.jpg (moved to commons)
- 02:57, 19 Dec 2004 Chris 73 deleted Image:KurokawaNagoyaCityArtMuseum.jpg (moved to commons)
- 02:57, 19 Dec 2004 Chris 73 deleted Image:KSMap-doton-Topeka.png (moved to commons)
- 02:57, 19 Dec 2004 Chris 73 deleted Image:KodakaraYuEntrance.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:KodakaraYuBandai.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:JapaneseWindow.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:JapaneseToiletSlippers.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:JapaneseToiletControlPanel.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:JapaneseToiletBidet.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:JapaneseSquatToilet.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:JapaneseGraveyardTokyo.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:JapaneseGraveTokyo.jpg (moved to commons)
- 02:56, 19 Dec 2004 Chris 73 deleted Image:JapaneseGravestoneWithRedInkName.jpg (moved to commons)
- 02:55, 19 Dec 2004 Chris 73 deleted Image:JapaneseGardenWaterBasin.jpg (moved to commons)
- 02:55, 19 Dec 2004 Chris 73 deleted Image:JapaneseFuneralEnvelope.jpg (moved to commons)
- 02:55, 19 Dec 2004 Chris 73 deleted Image:JapaneseFuneralArrangementTokyo.jpg (moved to commons)
- 02:55, 19 Dec 2004 Chris 73 deleted Image:JapaneseBladeType.International.CR.jpg (moved to commons)
- 02:55, 19 Dec 2004 Chris 73 deleted Image:JapaneseBladeType.English.CR.jpg (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:InuyamaCastle.jpg (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:INMap-doton-Indianapolis.png (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:ILMap-doton-Springfield.png (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:IDMap-doton-Boise.png (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:Hunters Bend HowTo.jpg (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:Hunters Bend Final.jpg (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:HowToTieBowtie VersionB.png (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:HowToTieBowtie VersionA.png (moved to commons)
- 02:54, 19 Dec 2004 Chris 73 deleted Image:HerscherpaarMagdeburgCathedral.jpg (moved to commons)
- 02:53, 19 Dec 2004 Rmhermen deleted Kitchen paradise
- 02:53, 19 Dec 2004 Chris 73 deleted Image:Hangmans Noose Final.jpg (moved to commons)
- 02:53, 19 Dec 2004 Chris 73 deleted Image:HanchoHocho.Tsukiji.CR.jpg (moved to commons)
- 02:53, 19 Dec 2004 Chris 73 deleted Image:Grave of Otto I, Holy Roman Emperor.jpg (moved to commons)
- 02:53, 19 Dec 2004 Chris 73 deleted Image:Fugu in Tank.jpg (moved to commons)
- 02:52, 19 Dec 2004 Chris 73 deleted Image:FujiTVStudioOdaiba.jpg (moved to commons)
- 02:52, 19 Dec 2004 Chris 73 deleted Image:Fugu.Tsukiji.CR.jpg (moved to commons)
- 02:52, 19 Dec 2004 Chris 73 deleted Image:FrogShapedGuiro.jpg (moved to commons)
- 02:52, 19 Dec 2004 Chris 73 deleted Image:EnokitakeJapaneseMushroom.jpg (moved to commons)
- 02:52, 19 Dec 2004 Cyrius deleted U.S. presidential election, 2004 (delete for page history merge)
- 02:51, 19 Dec 2004 Chris 73 deleted Image:DemoticScriptsRosettaStoneReplica.jpg (moved to commons)
- 02:50, 19 Dec 2004 Chris 73 deleted Image:DebaBocho.Cleaver.Japan.jpg (moved to commons)
- 02:50, 19 Dec 2004 Rmhermen deleted Black clay (content was: '{{del}}ghjk')
- 02:50, 19 Dec 2004 Cyrius deleted U.S. presidential election, 2004 (delete for page history merge)
- 02:49, 19 Dec 2004 Chris 73 deleted Image:CTMap-doton-Hartford.png (moved to commons)
- 02:49, 19 Dec 2004 Chris 73 deleted Image:ConveyorBeltSushi.jpg (moved to commons)
- 02:49, 19 Dec 2004 Chris 73 deleted Image:ConstrictorKnot Final.jpg (moved to commons)
- 02:49, 19 Dec 2004 Chris 73 deleted Image:ChaxTallGloomyBear.jpg (moved to commons)
- 02:49, 19 Dec 2004 Chris 73 deleted Image:ChaxLadyLibertyMolotovCocktailPostcard.jpg (moved to commons)
- 02:49, 19 Dec 2004 Chris 73 deleted Image:ChaxGloomyBearEatingPittyPostcard.jpg (moved to commons)
- 02:48, 19 Dec 2004 Chris 73 deleted Image:ChampignonMushroom.jpg (moved to commons)
- 02:48, 19 Dec 2004 Chris 73 deleted Image:Cathedral of Magdeburg Inside.jpg (moved to commons)
- 02:48, 19 Dec 2004 Chris 73 deleted Image:CarricksBend Final.jpg (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:CapsuleHotelCapsule.jpg (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:CapsuleHotel.jpg (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:CAMap-doton-Sacramento.png (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:Braid StepBystep.jpg (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:Braid final.jpg (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:BowTieTying.sxd (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:BoaKnot HowTo.jpg (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:BoaKnot Final.jpg (moved to commons)
- 02:47, 19 Dec 2004 Chris 73 deleted Image:BloodKnot HowTo.jpg (moved to commons)
- 02:46, 19 Dec 2004 Chris 73 deleted Image:BloodKnot Final.jpg (moved to commons)
- 02:46, 19 Dec 2004 Chris 73 deleted Image:Barlach Magdeburger Ehrenmal.jpg (moved to commons)
- 02:44, 19 Dec 2004 Chris 73 deleted Image:Baptismal Font Magdeburg.jpg (moved to commons)
- 02:44, 19 Dec 2004 Chris 73 deleted Image:ArtilleryLoop HowTo.jpg (moved to commons)
- 02:44, 19 Dec 2004 Chris 73 deleted Image:ArtilleryLoop FinalKnot.jpg (moved to commons)
- 02:44, 19 Dec 2004 Chris 73 deleted Image:ARMap-doton-Little-Rock.png (moved to commons)
- 02:44, 19 Dec 2004 Chris 73 deleted Image:AnchorBend HowTo.jpg (moved to commons)
- 02:44, 19 Dec 2004 Chris 73 deleted Image:AnchorBend FinalKnot.jpg (moved to commons)
- 02:44, 19 Dec 2004 Chris 73 deleted Image:Ami shakushi.Scoop.jpg (moved to commons)
- 02:43, 19 Dec 2004 Chris 73 deleted Image:BambooConstructionHongKong.jpg (moved to commons)
- 02:43, 19 Dec 2004 Chris 73 deleted Image:Alpine Butterfly Bend HowTo.jpg (moved to commons)
- 02:43, 19 Dec 2004 Chris 73 deleted Image:Alpine Butterfly Bend Final.jpg (moved to commons)
- 02:42, 19 Dec 2004 Chris 73 deleted Image:ActionPotential.sxd (moved to commons)
- 02:42, 19 Dec 2004 Chris 73 deleted Image:ActionPotential.png (moved to commons)
- 02:41, 19 Dec 2004 Cyrius deleted Clementi New Town (CSD - no context/definition)
- 02:37, 19 Dec 2004 ClockworkSoul deleted Image:Jukies mutao metro.jpg (Copyright vio - copied from label's web site.)
- 02:36, 19 Dec 2004 Aranel deleted Category:Supermarkets in Alaska (delete per cfd)
- 02:36, 19 Dec 2004 Chris 73 deleted Image:TokyoInternationalForum.jpg (replaced by commons image)
- 02:36, 19 Dec 2004 ClockworkSoul deleted Image:Jukies vast ace.jpg (Copyright vio - copied from label's web site.)
- 02:35, 19 Dec 2004 Cyrius deleted Coal (Lorde) (useless substub created to replace redirect that replaced nonsense that should have been deleted)
- 02:32, 19 Dec 2004 Mikkalai deleted Dink alphabet (content was: '{{delete}}The [[alphabet]] of the glorious people of [[Dink]]. This alphabet is renown for its great variety [[in]] Umlauts and other accents, espec...')
- 02:21, 19 Dec 2004 Evercat deleted Talk:Dubya (president of USA) (content was: '#redirect [[Talk:George W. Bush]]')
- 02:15, 19 Dec 2004 Mikkalai deleted Center for computer research in music and accoustics (typo in title)
- 02:08, 19 Dec 2004 Neutrality deleted Category:Cities of Uzbekistan (content was: '{{cfd}}This category has been moved to [[:Category:Cities in Uzbekistan]]. It may be deleted at any time by a administrator.')
- 02:08, 19 Dec 2004 Niteowlneils deleted Tetradecagon ( future world leader, I'm sure--content was: '{{delete}}wats good na mean dis be dat gurl iight dat all u need to no. So anyway wats poppin na mean wats good chillin i hope im just on t he comp...')
- 02:05, 19 Dec 2004 Neutrality deleted Category:Cities of Spain (content was: '{{cfd}}This category has been moved to [[:Category:Cities in Spain]]. It may be deleted at any time by a administrator.')
- 02:05, 19 Dec 2004 Neutrality deleted Category:Cities of Sicily (content was: '{{cfd}}[[Category:Sicily|Cities]][[Category:Cities in Italy|Sicily]]')
- 02:04, 19 Dec 2004 Neutrality deleted Category:Cities of Sardinia (content was: '{{cfd}}This category has been moved to [[:Category:Cities in Sardinia]]. It may be deleted at any time by a administrator.')
- 02:03, 19 Dec 2004 Neutrality deleted Category:Cities of Namibia (content was: '{{cfd}}This category has been moved to [[:Category:Cities in Namibia]]. It may be deleted at any time by an administrator.')
- 02:01, 19 Dec 2004 Neutrality deleted Category talk:Cities of the Philippines (content was: 'you could include Tuguegarao City (Cagayan Valley), Cauayan City and Santiago City (Isabela) in the list')
- 02:01, 19 Dec 2004 Neutrality deleted Category:Cities of the Philippines (content was: '{{cfd}}This category has been moved to [[:Category:Cities in the Philippines]]. It may be deleted at any time by a administrator.')
- 02:00, 19 Dec 2004 Neutrality deleted Category:Cities of Malaysia (content was: '{{cfd}}This category has been moved to [[:Category:Cities in Malaysia]]. It may be deleted at any time by a administrator.')
- 02:00, 19 Dec 2004 Neutrality deleted Category:Cities of Lombardy (content was: '{{cfd}}This category has been moved to [[:Category:Cities in Lombardy]]. It may be deleted at any time by a administrator.')
- 01:58, 19 Dec 2004 Neutrality deleted Category:Cities of Minas Gerais (content was: '{{cfd}}This category has been moved to [[:Category:Cities in Minas Gerais]]. It may be deleted at any time by a administrator.')
- 01:58, 19 Dec 2004 SimonP deleted (Yerzoplazistonian) Civil War Civil War (content was: 'Recreating to see if this can be properly deleted')
- 01:58, 19 Dec 2004 Neutrality deleted Category:Cities of Liguria (content was: '{{cfd}}This category has been moved to [[:Category:Cities in Liguria]]. It may be deleted at any time by a administrator.')
- 01:57, 19 Dec 2004 Neutrality deleted Category:Cities of Iceland (Per CfD)
- 01:56, 19 Dec 2004 Neutrality deleted Category:Cities of Emilia-Romagna (Per CfD)
- 01:56, 19 Dec 2004 Neutrality deleted Category:Cities of Chile (Per CfD)
- 01:55, 19 Dec 2004 Neutrality deleted Category:Cities of Catalunya (Per CfD)
- 01:55, 19 Dec 2004 Neutrality deleted Category:Cities of Abruzzo (Per CfD)
- 01:54, 19 Dec 2004 Neutrality deleted Category:Cities of Campania (Per CfD)
- 01:54, 19 Dec 2004 Neutrality deleted Category:Cities of Brazil (Per CfD)
- 01:52, 19 Dec 2004 Niteowlneils deleted Tim vo (content was: '{{del}}Tim Vo is my dad')
- 01:52, 19 Dec 2004 Niteowlneils deleted Navy SEALS (movie) (content was: '{{delete}}navy seals the movie')
- 01:50, 19 Dec 2004 Niteowlneils deleted Talk:Upper and Lower Egypt (content was: '{{del}}upper and downer poop heads down in the party')
- 01:49, 19 Dec 2004 Niteowlneils deleted Talk:Atomic theory (content was: '{{del}}PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP== ppp ==')
- 01:49, 19 Dec 2004 Niteowlneils deleted Talk:Ecstasy (content was: '{{deletebecause|the page has been blanked, there is no discussion, even if the discussion-tab incidates there is.}}')
- 01:48, 19 Dec 2004 Niteowlneils deleted Aziz Ahmad (content was: '[[Link title]][[Media:Example.ogg]]{{db|nothing but a broken link}}')
- 01:48, 19 Dec 2004 Niteowlneils deleted Ectoplasmic (content was: 'pie!{{delete}}')
- 01:47, 19 Dec 2004 Rlandmann deleted June 27 1981 (content was: 'Scott Penweeeeeeeeezyyyy was born..............')
- 01:44, 19 Dec 2004 Neutrality deleted Dunlop (content was: 'Jim Dunlop™ is one of the premier guitar accessory manufacturers worldwide. Creators of world-famous slides, picks, straps.')
- 01:32, 19 Dec 2004 Neutrality deleted Image:Vermont-counties-map.gif (Obseleted)
- 01:24, 19 Dec 2004 Niteowlneils deleted Bow Sim mark (orphan, useless, no history--content was: '#REDIRECT [[Bow Sim Mark]]')
- 01:21, 19 Dec 2004 Stan Shebs deleted Sheynhertz-Unbayg (empty)
- 01:12, 19 Dec 2004 Adam Bishop deleted The Phantom Bantam (content was: 'The phantom bantam is an internet legend.')
- 01:09, 19 Dec 2004 Gamaliel deleted Template:Bush
- 01:08, 19 Dec 2004 Gadfium deleted History of Rastafarianism (content was: 'HISTORY OF RASTAFARIANISM')
- 00:55, 19 Dec 2004 Jpgordon deleted IBM 402 (content was: '{{del}}IBM 402')
- 00:55, 19 Dec 2004 Jpgordon deleted Bushy (content was: '{{deletebecause|patent nonsense}}Bushy is the name of a Scottish explorer of the 17th century. He explored the North Sea far into its border regions ...')
- 00:44, 19 Dec 2004 Ike9898 deleted Lac Z (content was: '{{delete}}lacZ')
- 00:44, 19 Dec 2004 Sannse deleted George W. Bush (delete to restore history to here - do not replace until move done please!)
- 00:40, 19 Dec 2004 Blankfaze deleted Dubya (president of USA) (content was: '#redirect [[George W. Bush]]' delete stupid redirect)
- 00:32, 19 Dec 2004 Sannse deleted George W. Bush (delete to restore history to here)
- 00:21, 19 Dec 2004 Sannse deleted 2004 U.S. presidential elections and crimes against humanity (content was: '{{rfd}}#REDIRECT [[2004 U.S. presidential elections]]' speedy asa part of page move fix)
- 00:18, 19 Dec 2004 Meelar deleted Blake & Dylan Tuomy-Wilhoit (content was: 'jlkhihi ohihioiiohy[op[]o[oo]';'klguiliulfilfuglugilugiluiluuilululuiluliluluiluiluiluilluiliul k;jjjjjjkkkkkkkkkkkkkjklguilut')
- 00:16, 19 Dec 2004 Sannse deleted 2004 U.S. presidential election controversy and irregularities (content was: '#REDIRECT [[2004 U.S. presidential elections]]' delete for move back to here)
- 00:05, 19 Dec 2004 Tom- deleted GIANT AntiSpyware (content was: 'abd def')
- 00:03, 19 Dec 2004 AndyL deleted Smith Act (content was: '#REDIRECT [[Alien Registration Act]]')
- 23:56, 18 Dec 2004 Rdsmith4 deleted Image:ArbCom CantVote.jpg (nonsense)
- 23:56, 18 Dec 2004 Rdsmith4 deleted Commerce-free event (content was: '{{db|No actual content}}A commerce-free event is any event where there is no monetary transactions. The [[Burning Man]] festival is one such event.{...')
- 23:54, 18 Dec 2004 Rdsmith4 deleted Castle Kennedy
- 23:54, 18 Dec 2004 Rdsmith4 deleted Cable Channel One (content was: '{{del}}This was a UK Cable TV Channel broadcast in the late 1980s this channel is no longer Broadcast in the United Kingdom')
- 23:54, 18 Dec 2004 Rdsmith4 deleted Battle of Corepedium (content was: '{{delete}}#REDIRECT [[Battle Corupedium]]')
- 23:53, 18 Dec 2004 Rdsmith4 deleted Advanced Dungeons and Dragons: Pool of Radiance (content was: '{{delete}}hello?')
- 23:53, 18 Dec 2004 Rdsmith4 deleted Battle Corupedium (content was: '{{delete}}#REDIRECT [[Battle of Corupedium]]')
- 23:52, 18 Dec 2004 Rdsmith4 deleted Marjoie VanSaun (content was: '{{db|I don't think we're going to get far by qualifying things as either your dad or not your dad}} Marjorie VanSaun is so ''not'' my dad.')
- 23:52, 18 Dec 2004 Rdsmith4 deleted Nahal Oz (content was: '{{deletebecause|this borders on nonsense, will probably never be a full article}}Nahal Oz - a place that is near the border (Border of what ???) (80...')
- 23:52, 18 Dec 2004 Rdsmith4 deleted Presion atmosferica (content was: ',j78ii[http://www.example.com link title]8i67ui[[Media:Example.ogg]]i78i7i----')
- 23:52, 18 Dec 2004 Rdsmith4 deleted Start a topic (nonsense)
- 23:51, 18 Dec 2004 Rdsmith4 deleted Hercolubus (content was: '{{del}}{{cleanup}}It is the name given to the planet that is supposed to create chaos in our planet in 2012.{{substub}}')
- 23:50, 18 Dec 2004 Rdsmith4 deleted HomelessnesS (content was: '{{delete}}#REDIRECT [[Homelessness]]')
- 23:50, 18 Dec 2004 Rdsmith4 deleted User:Squash/Userpage (content was: '{{speedy}}#redirect [[User:Squash]]')
- 23:50, 18 Dec 2004 Rdsmith4 deleted User talk:Squash/ (content was: '{{speedy}}#redirect [[User talk:Squash]]')
- 23:41, 18 Dec 2004 Joy Stovall deleted National Geographic Magazine's abuse of geographical names (vfd consensus to delete)
- 23:34, 18 Dec 2004 Adam Bishop deleted Genitallica57@hotmail.com (content was: '[http://www.hotmail.com link title][[genitallica57@hotmail.com]]')
- 23:28, 18 Dec 2004 SimonP deleted Neeklamy (#REDIRECT [[User:Neeklamy/old]],)
- 23:17, 18 Dec 2004 Neutrality deleted Start a topic (content was 'There is much talk of "anti-Semitism" as an excuse to avoid confonting Israel's war crimes and human rights abuses; anyone broaching the subject is accused of "anti-Semitism".')
- 23:05, 18 Dec 2004 Cyrius deleted Sega Saturn Sound Format (CSD - no definition/context)
- 23:03, 18 Dec 2004 Cyrius deleted Capcom Q-Sound Format (CSD - no definition/context)
- 22:57, 18 Dec 2004 Neutrality deleted JUSTIN RUDDY (Per VfD)
- 22:54, 18 Dec 2004 Neutrality deleted Ottawa Canada Linux Users Group (content was: '{{vfd}}Founded in March 1997, '''OCLUG''' is incorporated as a non-profit organisation.==External Links==[http://www.oclug.on.ca/ OCLUG website]...')
- 22:50, 18 Dec 2004 Rlandmann deleted Steve Lieberman (content was: 'Genious')
- 22:48, 18 Dec 2004 Rlandmann deleted Why not believe in atlantis? (No meaningful content)
- 22:45, 18 Dec 2004 WhisperToMe deleted Cuisine of Canada (Moving Canadian cuisine here)
- 22:43, 18 Dec 2004 Joy Stovall deleted AJ Hanchett ( (target article has been deleted via VFD consensus) content was: '#REDIRECT [[A. J. Hanchett]]')
- 22:41, 18 Dec 2004 Neutrality deleted Halfpenny Marvel (content was: 'Billy Bunter')
- 22:40, 18 Dec 2004 Neutrality deleted Melodikrysset (content was: '{{delete}}Weekly radioprogramme, on saturady mornings, that has been running for over 30 eyars on Radio Sweden. The show is a crossword puzzle, with m...')
- 22:25, 18 Dec 2004 Cyrius deleted Butane Fumes (content was: '[[Category:Albums]]{{cleanup}}'''Butane Fumes''' is an album.{{substub}}')
- 22:24, 18 Dec 2004 Joy Stovall deleted Aaron Levine (vfd consensus to delete)
- 22:22, 18 Dec 2004 Cyrius deleted Bukit Merah (CSD - no context/definition)
- 22:20, 18 Dec 2004 Joy Stovall deleted Kelly Milligan (vfd consensus to delete)
- 22:16, 18 Dec 2004 MacGyverMagic deleted Poopius maximus (content was: '{{del}}The term Poopius Maximus comes from the american word [(poop)]Which comes from shitwhich came from crapwhich accidently came from carpwhi...')
- 22:16, 18 Dec 2004 Quadell deleted Image:Barracuda with prey small.jpg (Image has errors and will not display)
- 22:13, 18 Dec 2004 Quadell deleted Image:Barkskibs staende rigning2sm.png (scaled-down duplicate image)
- 22:12, 18 Dec 2004 Niteowlneils deleted Image:Page 1 of the Constitution.jpg (orphan, user req, 15M!)
- 22:12, 18 Dec 2004 Quadell deleted Image:Bar-headed.goose.250pix.jpg (scaled-down duplicate image)
- 22:11, 18 Dec 2004 Quadell deleted Image:BannerRecords.jpg (scaled-down duplicate image)
- 22:08, 18 Dec 2004 Quadell deleted Image:Banderaextremadura-thb.png (scaled-down duplicate image)
- 22:08, 18 Dec 2004 Joy Stovall deleted Justice maximism (vfd consensus to delete)
- 22:05, 18 Dec 2004 Quadell deleted Image:Baltic sea map small.jpg (scaled-down duplicate image)
- 22:05, 18 Dec 2004 Quadell deleted Image:Balsamroot in Fossil Butte NM-300px.JPG (scaled-down duplicate image)
- 22:03, 18 Dec 2004 Quadell deleted Image:Balkans-political map.png (Unused duplicate image)
- 22:02, 18 Dec 2004 Joy Stovall deleted A. J. Hanchett ((vfd consensus to delete) content was: '{{vfd}}'''A. J. Hanchett''' is an artist and creator of 'AJime', a scaled-down, less detailed version of [[anime]], and his preferred drawing style.')
- 22:01, 18 Dec 2004 Niteowlneils deleted Sunset & Vine (content was: '{{del}}==External Links==*[http://www.sunsetvine.co.uk/ Sunset & Vine]')
- 21:58, 18 Dec 2004 Joy Stovall deleted AJime ((VFD consensus to delete) content was: '{{vfd}}A drawing style which is scaled-down anime. Read from left to right like traditional Western comics (instead of right to left like japanese m...')
- 21:57, 18 Dec 2004 Quadell deleted Image:Bae.nimrod.250pix.jpg (Duplicate, scaled-down image. Unused.)
- 21:55, 18 Dec 2004 Cyrius deleted Braddell (CSD - no context/definition)
- 21:55, 18 Dec 2004 Denni deleted Image:Earlofhopetoun.jpg (uploader ststement)
- 21:54, 18 Dec 2004 Joy Stovall deleted Terry Kavanagh (VFD consensus to delete)
- 21:54, 18 Dec 2004 Quadell deleted Image:Bac.britannia.250pix.jpg (Unused scaled-down duplicate image)
- 21:53, 18 Dec 2004 Jrdioko deleted United Cracking Force (content was: '{{db|test page}}save page')
- 21:52, 18 Dec 2004 Joy Stovall deleted Talk:Terry Kavanagh ((article deleted by VFD consensus) content was: 'This little tome showed up verbatim a few months ago. It was completely bogus and deleted thanks to an overwhelming majority on VfD. - [[User:Lucky 6...')
- 21:51, 18 Dec 2004 Denni deleted Image:Earlepage.jpg (provider's request)
- 21:42, 18 Dec 2004 Ahoerstemeier deleted Fred l hess (content was: 'Now I'm in Wikipedia. Officialy here, thanks!')
- 21:41, 18 Dec 2004 Rossami restored "Dux,_CA"
- 21:22, 18 Dec 2004 Hadal deleted Ban me (content was: '{{delete}}>BAN ME>>I WANTS TEH BAN>INDEED>>BAN ME')
- 21:17, 18 Dec 2004 Jrdioko deleted Viral lysis (content was: '== Headline text ==Fdjaklfdjl;sjfdkljflkdjkfjldkjfdkjfkldjlkfjkld;sajfkldsjflkd;sajfdklsa;fjkds;ajfkdsl;kjfdkjfkthe re dkfjkf;lkd fjkdkj gknjmd fijf...')
- 21:16, 18 Dec 2004 Jrdioko deleted Sysops wank sheep (content was: '{{delete}}')
- 21:15, 18 Dec 2004 Jrdioko deleted Sysops wank sheep (content was: 'System ops are pathetic little nerds that live with there moms!!they want to be gay, but no gays will go near them so they wank the sheep instead, p...')
- 21:13, 18 Dec 2004 Cyrius deleted Bedok (CSD - no context/definition - a couple of infoboxes, no text.)
- 21:08, 18 Dec 2004 Cyrius deleted Gametalk.com (content was: '{{d}}Gametalk.com is a website that was formerly in the ownership of Mike Pooler (read: Jew)Some dude named Gumba Gumba then stole it, and had ana...')
- 20:59, 18 Dec 2004 Flockmeal deleted Bobby Heenan (content was: 'he's fucking mint. very hilarious. i enjoy still watxhing him. specially good in royal rumble 1992, the one when flair won, diggit.')
- 20:43, 18 Dec 2004 Ahoerstemeier deleted Paul Canoville (content was: '{{delete}}')
- 20:41, 18 Dec 2004 Adam Bishop deleted Bomi, Liberia (junk)
- 20:40, 18 Dec 2004 Adam Bishop deleted Paul Canoville (content was: 'nhhgh')
- 20:25, 18 Dec 2004 Niteowlneils deleted Image:LocationCanada.png (moved to commons under same name)
- 20:25, 18 Dec 2004 Niteowlneils deleted Image:LocationFiji.png (moved to commons under same name)
- 20:25, 18 Dec 2004 Niteowlneils deleted Image:LocationGuatemala.png (moved to commons under same name)
- 20:25, 18 Dec 2004 Niteowlneils deleted Image:LocationIsrael.png (moved to commons under same name)
- 20:25, 18 Dec 2004 Niteowlneils deleted Image:LocationJapan.png (moved to commons under same name)
- 20:25, 18 Dec 2004 Niteowlneils deleted Image:LocationMexico.png (moved to commons under same name)
- 20:25, 18 Dec 2004 Niteowlneils deleted Image:LocationPakistan.png (moved to commons under same name)
- 20:23, 18 Dec 2004 Niteowlneils deleted User:Oven Fresh/w (content was: '{{db|I want it to be.}}')
- 20:23, 18 Dec 2004 Niteowlneils deleted User:Halibutt/Image gallery (moved to commons)
- 20:22, 18 Dec 2004 Niteowlneils deleted User talk:Vacuum/Old (content was: '{{del}}')
- 20:22, 18 Dec 2004 Niteowlneils deleted User:Vacuum/sandbox (content was: '{{del}}My own personal sandbox.=Sigtests=[[User:Vacuum|{{User:Vacuum/sig}}]] 17:00, Dec 11, 2004 (UTC)[[User:Vacuum|{{User:Vacuum/sig}}]] 17:02, ...')
- 20:14, 18 Dec 2004 Ahoerstemeier deleted Tornado (integrated development environment) (content was: 'Tornado')
- 20:06, 18 Dec 2004 Jpgordon deleted "MAD GROOVES" (content was: '{{del}}CD COMPILATION released in 1995 from the [[MAD Magazine]]')
- 20:06, 18 Dec 2004 Ahoerstemeier deleted 3797 (content was nonsense - Nostradum never gave any dates: 'Nostradamus believes the world will end on this year. No specific date for reason is given however.')
- 20:06, 18 Dec 2004 Jpgordon deleted C:csd (content was: '{{db|You can't redirect to a category? How odd. }}#redirect [[:Category:Candidates for speedy deletion]]')
- 20:05, 18 Dec 2004 Ahoerstemeier deleted Vin Baker (content was: 'New York Knicks Player, alcoholic')
- 20:05, 18 Dec 2004 Jpgordon deleted Cofradia cortes (Speedy case 7: Foreign language articles that already exist on...)
- 20:05, 18 Dec 2004 Ahoerstemeier deleted 3797 (content was nonsense - Nostradamus did never give any numbers: 'Nostradamus believes the world will end on this year. No specific date for reason is given however.')
- 20:03, 18 Dec 2004 Jpgordon deleted Gabriela Aredhel (content was: '{{delete}}')
- 20:03, 18 Dec 2004 Jpgordon deleted Lit - Atomic (content was: '{{del}}')
- 19:59, 18 Dec 2004 Jpgordon deleted Orlando Anderson (content was: '{{delete}}Orlando Anderson shot tupac 232392329329 times in the eye')
- 19:59, 18 Dec 2004 Jpgordon deleted Peach Girl (content was: '{{delete}}Peach girl is a manga (mon-guh)series about a high school girl that tans easily. And because her skin becomes dark, most people believe s...')
- 19:56, 18 Dec 2004 Ahoerstemeier deleted Matt Dupere (content was: 'One of the most creative visual artists of our generation.')
- 19:49, 18 Dec 2004 Cyrius deleted Friedrichsruh (content was: 'The city where Rich Fried Chicken was invented.')
- 19:47, 18 Dec 2004 Cyrius deleted Copenhagen University College of Engineering (content was: 'undergraduates admission requirements.')
- 19:46, 18 Dec 2004 Cyrius deleted L33t programming language/Temp (content was: '{{delete}}c4n7 13 f12i3nd2 w17h 3v3ry1')
- 19:46, 18 Dec 2004 Jrdioko deleted Shuri (content was: '{{db|Slight apology accepted}}karate is my secet, bare no weapons, slight apology')
- 19:46, 18 Dec 2004 Cyrius deleted 20th Century Masters: Millennium Collection (content was: '{{delete}}a')
- 19:45, 18 Dec 2004 Mikkalai deleted Emelian I. Pugachev (content was: '#REDIRECT [[Yemelian Ivanovich Pugachev]]')
- 19:44, 18 Dec 2004 Jrdioko deleted Pay-to-play (content was: '{{nonsense}}<nowiki>Insert non-formatted text here</----------------[[Image:Example.jpg]][[Image:Example.jpg]][[Link title]]tfrrdgdgfdgdgddf'''Bo...')
- 19:43, 18 Dec 2004 Jrdioko deleted Postulio (content was: '{{delete}}Rude bastard that trolls the Digital Press forums.')
- 19:43, 18 Dec 2004 Cyrius deleted Ginger Fish (content was: '{{delete}}Ginger Fish - Kenny WilsonBorn: September 28')
- 19:41, 18 Dec 2004 Jrdioko deleted My self (content was: '{{del}}Young boy barely over the age of ten that saw this article and decide wow how easy would it be to alter this article to something that has no ...')
- 19:41, 18 Dec 2004 Jrdioko deleted Monterey Shock Incarceration Correctional Facility (content was: 'gary holmes {{del}}')
- 19:40, 18 Dec 2004 Jrdioko deleted Al Ghurair University (content was: '{{del}}i will kindly like to join the al ghurair university')
- 19:33, 18 Dec 2004 Cyrius restored "Dysthymia"
- 19:31, 18 Dec 2004 Cyrius deleted Bullshitdetector (redelete - CSD nonsense / newbie test / vandalism)
- 19:30, 18 Dec 2004 Ahoerstemeier deleted Yaaaaa u wan qaley waqatiga (content was: '#REDIRECT [[Galguduud]]' - created while fixing a page move vandalism)
- 19:29, 18 Dec 2004 Ahoerstemeier deleted Any (content was: '#redirect [[Yaaaaa u wan qaley waqatiga]]' - created while fixing a page move vandalism)
- 19:29, 18 Dec 2004 Cyrius restored "Bullshitdetector"
- 19:28, 18 Dec 2004 Ahoerstemeier deleted Galguduud (deleting to make space for a page move)
- 19:27, 18 Dec 2004 Ahoerstemeier deleted The End of the World (content was: ''''Aaaaa'''')
- 19:26, 18 Dec 2004 Cyrius deleted Bullshitdetector (CSD - nonsense)
- 19:23, 18 Dec 2004 Cyrius restored "Choccolocco,_Alabama"
- 19:23, 18 Dec 2004 Ahoerstemeier deleted Choccolocco, Alabama (content was: 'Located in Calhoun County')
- 19:18, 18 Dec 2004 Mikkalai deleted Zaporizhzhia (for move; content was: '#REDIRECT [[Zaporizhzhia, Ukraine]]')
- 19:14, 18 Dec 2004 Ahoerstemeier deleted Agent Pixel (content was: 'a VERY fun game on [[nick.com!!!!!!!!!]]')
- 19:13, 18 Dec 2004 Cyrius deleted Wikiwoe (feature request?)
- 18:59, 18 Dec 2004 SimonP deleted Spud gun (prep for move)
- 18:49, 18 Dec 2004 Charles Matthews deleted Happy Happy Happy (nonsense)
- 18:40, 18 Dec 2004 Ahoerstemeier deleted Howard Hughes will (content was: 'hello')
- 18:30, 18 Dec 2004 Ahoerstemeier deleted Chapman, Alabama (content was: '{{del}}Located in Butler County')
- 18:29, 18 Dec 2004 Ahoerstemeier deleted Ebida (content was: 'sdfgsartgerg asdfb rtbr awrtb twe barwetweretawert bweatwet etg')
- 18:27, 18 Dec 2004 Ahoerstemeier deleted William Schneider (content was: 'article')
- 18:26, 18 Dec 2004 Ahoerstemeier deleted Hudson Motor Company (content was: 'hudson straight 8')
- 18:23, 18 Dec 2004 Ahoerstemeier deleted Muessigmann (content was: 'looking for muessigmann in the black forest')
- 17:46, 18 Dec 2004 Ahoerstemeier deleted Pakistani Airforce (content was nonsense: 'The Pakistani Air Force sucks balls.Life sucks, but Pakistanis suck even more. All they can do is shoot a poor UAV with a Sidewinder...')
- 17:46, 18 Dec 2004 Ahoerstemeier deleted Fred The French (content was: 'Fred is da best French ever.')
- 17:46, 18 Dec 2004 Ahoerstemeier deleted Dvir (content was: AKA Kaki Metumtam, is an expiriment of the Israeli government about how a low IQ affects the human being.')
- 17:44, 18 Dec 2004 Adam Bishop deleted Willy on Wheels (junk)
- 17:36, 18 Dec 2004 SimonP deleted Tyler Swenson (content was: '[[Inappropriate article]]{{Tyler Swenson is not deserving of bandwidth}}')
- 17:36, 18 Dec 2004 SimonP deleted Student syndrome (content was: 'the tendency to start work at the very last possible moment if not later.')
- 17:33, 18 Dec 2004 SimonP deleted Uthradom Thirunal Marthanda Varma (content was: '== == Soorya is the best == ==== Headline text ==soorya is great')
- 17:27, 18 Dec 2004 Hadal deleted Pakistani Airforce (content was: 'The Pakistani Air Force sucks balls.sucks sucks sucks sucks sucks sucks sucks sucks sucks sucks sucks sucks sucks sucks sucks sucks sucks')
- 17:25, 18 Dec 2004 SimonP deleted Elvis Presley (album) (content was: '''Italic text'' ElViS PrEsLeY ThE KiNg! AnD My KiNg!')
- 17:22, 18 Dec 2004 Joy Stovall deleted William Rafti (VFD consensus to delete)
- 17:21, 18 Dec 2004 Hadal deleted Pakistani Airforce (content was: 'Puppetmaster is nice.The Pakistani Air Force sucks balls.')
- 17:19, 18 Dec 2004 SimonP deleted Synchaea (content was: 'hfdasjfoaisfj oawiecjfosaijfoas;idjcdsoafj sa')
- 17:18, 18 Dec 2004 Infrogmation deleted Henry S. Bienen (WP:CP listed since 7 Dec; content was: '{{copyvio|url= http://nusports.collegesports.com/school-bio/nw-bienen.html}}')
- 17:16, 18 Dec 2004 Joy Stovall deleted Larry Booth (vfd consensus to delete)
- 17:13, 18 Dec 2004 SimonP deleted British South Africa (vandalism)
- 17:13, 18 Dec 2004 Infrogmation deleted Special Zone (WP:CP listed since 1 Dec; content was: '{{copyvio1}}'''Appears to be a text dump from an unknown online source.'''{{copyvio2}}')
- 17:13, 18 Dec 2004 Infrogmation deleted Jan riske (WPCP listed since 3 Dec; content was: '{{copyvio1}}'''Appears to be a partially copied fragment of a larger article.'''{{copyvio2}}')
- 17:11, 18 Dec 2004 Jpgordon deleted Girder (content was: '{{delete}}girder')
- 17:08, 18 Dec 2004 SimonP deleted Khmer people (content was: '{{cleanup}}')
- 17:08, 18 Dec 2004 SimonP deleted List of municipalities in Quebec (content was: '----')
- 17:04, 18 Dec 2004 Infrogmation deleted Image:SirWilliamFergusonMassey.png (Listed on WP:CP since May; not used in his article)
- 17:02, 18 Dec 2004 SimonP deleted Evolution of prokaryotes (content before blanking was: 'Evolution is a good thing.')
- 17:01, 18 Dec 2004 SimonP deleted Héctor y Tito (content before blanking was: 'Hector y Tito are best known in Puerto Rico for there singing in reggaeton. With song as Baile Morena and Felina. They are all very Sexy')
- 17:00, 18 Dec 2004 SimonP deleted CT-33 Silver Star (content before blanking was: '#REDIRECT [[Lockheed T-33]]')
- 17:00, 18 Dec 2004 SimonP deleted Berman v. Parker (content before blanking was: 'kkmfwfd jfja sjf dsaf aa d f f fadfjdfjd afj wfewaudixc b nvfjghfa bxcb ;Ajfdchbvcb cBFbv nvszbzscxbkzasnkavclc fjsdahbflksdfzslvdsflvbdsjlvlsdanks ...')
- 16:59, 18 Dec 2004 TUF-KAT deleted Tiffany winn (long nonsense)
- 16:59, 18 Dec 2004 Infrogmation deleted Image:NormanKirk.png (Listed on WP:CP since May; not used in article)
- 16:59, 18 Dec 2004 TUF-KAT deleted Assiniboine language (content was: '{{del}}How do you read this?')
- 16:58, 18 Dec 2004 TUF-KAT deleted Please don't find me (content was: '{{delete}}ACK! oh no.Boo Hoo!')
- 16:54, 18 Dec 2004 Infrogmation deleted Image:JohnBalance.png (Listed on WP:CP since May, not used in article)
- 16:54, 18 Dec 2004 Infrogmation deleted Image:JohnBallance.png (Listed on WP:CP since May; not used in article.)
- 16:52, 18 Dec 2004 TUF-KAT deleted Meaning Of Names (content was: '{{delete}}Kristin')
- 16:47, 18 Dec 2004 Jpgordon deleted Shahab-5 (content was: '{{delete}}shahab-5')
- 16:45, 18 Dec 2004 Jpgordon deleted Ohio State Penitentiary (content was: '{{delete}}inmate locater')
- 16:42, 18 Dec 2004 Hadal deleted Nizhny Novgorod State University (content was: ''''Nizhny Novgorod State University''' is a University in [[Russia]].{{deletebecause|No content}}')
- 16:42, 18 Dec 2004 Hadal deleted Producers Guild of America (content was: '{{delete}}thanks for giving me opportunity to talk to u... i m masuldar from mumbai-india my mobile no.0091-9819606604, email : love_itv@yahoo.co...')
- 16:41, 18 Dec 2004 Hadal deleted Plano west senior high school (content was: '{{delete}}i graduated from this hellish place.')
- 16:41, 18 Dec 2004 Hadal deleted Jared smith (content was: '{{delete}}happy joy joy monkey blood happy fuck.')
- 16:41, 18 Dec 2004 Hadal deleted Semyon Kirlian (content was: '{{delete}}== SEMYMON KIRLIAN =='''he used to fuck monkeez with broomsticks.'''')
- 16:38, 18 Dec 2004 Hadal deleted Ebida (content was: '{{delete}}Yo, he's a golfer in tiger woods PGA tour 2004. He's not that good, but with a little pratice, he will rock. He enjoys long walks on the g...')
- 16:38, 18 Dec 2004 Stan Shebs deleted Image:Stamp.novascotia.250pix.jpg (unused thumb)
- 16:38, 18 Dec 2004 Hadal deleted Andrew marcou (content was: 'see [[Ebida]]')
- 16:14, 18 Dec 2004 Chris 73 deleted Mario's Picross (content was: 'MARIO IS GAY')
- 16:12, 18 Dec 2004 Chris 73 deleted New Super Mario Bros. (content was: 'Maaaaaaaaaaaaaaaaaaaaaaaaaario')
- 15:54, 18 Dec 2004 Rbrwr deleted Talk:Paddy Ashdown (content was: 'we hate you!')
- 15:42, 18 Dec 2004 Rmhermen deleted Endre Sunndal Grønengen
- 15:41, 18 Dec 2004 Deb deleted Ella Davies (content was: '{{deletebecause|Hate article against a person}}== A brief history ==A bully and a tyrant, currently residing in [[Essex]], [[England]]. She is wi...')
- 15:37, 18 Dec 2004 Francs2000 deleted Taser International (content was: '{{deletebecause|obvious spam}}http://fire.prohosting.com/freeipd/')
- 15:37, 18 Dec 2004 Joy Stovall deleted Jeff Nomura (vfd consensus to delete)
- 15:35, 18 Dec 2004 Francs2000 deleted Prop wash (content was: '{{wiktionary}}a term for turbulent airflow coming from the aft end of a propeller.')
- 15:34, 18 Dec 2004 Francs2000 deleted Taser International (content was: 'http://fire.prohosting.com/freeipd/')
- 15:32, 18 Dec 2004 Francs2000 deleted Dick Moore (content was: 'dick moore')
- 15:32, 18 Dec 2004 Joy Stovall deleted Valerie Hawrylko (vfd consensus to delete)
- 15:29, 18 Dec 2004 ALoan restored "Wikipedia:Village_pump"
- 15:29, 18 Dec 2004 Francs2000 deleted Petey enterprises (oh dear oh dear)
- 15:28, 18 Dec 2004 ALoan restored "Millau_Viaduct"
- 15:28, 18 Dec 2004 Francs2000 deleted Petey enterprises (advertising)
- 15:27, 18 Dec 2004 Joy Stovall deleted K.C. James (vfd consensus to delete)
- 15:23, 18 Dec 2004 Francs2000 deleted Petey enterprises (advertising)
- 15:20, 18 Dec 2004 Joy Stovall deleted Stephanie Rich (vfd consensus to delete)
- 15:18, 18 Dec 2004 Joy Stovall deleted Alvin Williams (vfd consensus to delete)
- 15:18, 18 Dec 2004 Francs2000 deleted Petey enterprises (advertising)
- 15:17, 18 Dec 2004 Joy Stovall deleted Talk:Alvin Williams ((vfd consensus to delete article) content was: 'Why is there a basketball players link on the bottom of the page? This is a different Alvin Williams.')
- 15:15, 18 Dec 2004 Joy Stovall deleted "Kill You" (vfd consensus to delete)
- 15:13, 18 Dec 2004 LouI deleted William Duer (1805-1879 ) (moved recent typo: content was: '#REDIRECT [[William Duer (1805-1879)]]')
- 15:11, 18 Dec 2004 Francs2000 deleted Digital communication (content was: '{{del}}hi kemey alekum')
- 15:11, 18 Dec 2004 Francs2000 deleted Jump to internal page (content was: 'Another test')
- 15:10, 18 Dec 2004 Francs2000 deleted Colon Free Zone (content was: '{{nonsense}}The colon free zone is the second biggest 'free zone' on the World.Many people from all over america buy their wholesale goods.')
- 15:09, 18 Dec 2004 Joy Stovall deleted Pooter (vfd consensus to delete)
- 15:09, 18 Dec 2004 Joy Stovall deleted Talk:Pooter (vfd consensus to delete)
- 15:05, 18 Dec 2004 Francs2000 deleted Linguistic reductionism (content was: '{{del}}Anyway, just to reiterte my point, if you don't know what you are talking about, don't pretend you do.')
- 15:04, 18 Dec 2004 Francs2000 deleted Anthony Worral Thompson (content was: 'Antony Worral thompson was a right dick on i`m a celebrity get me out of here and all he did was sleep,eat and shite oh and also lead the big argument...')
- 15:02, 18 Dec 2004 Francs2000 deleted Linguistic reductionism (content was: '{{delete}}I couldn't care less.')
- 15:00, 18 Dec 2004 Francs2000 deleted The Fantasy Channel (content was: 'the fantasay channel has pussy')
- 15:00, 18 Dec 2004 Francs2000 deleted Rosa acicularis (content was: 'rosa acicularies')
- 14:59, 18 Dec 2004 Francs2000 deleted West Virginia Senate (content was: ' members of the west virginia state legislature')
- 14:59, 18 Dec 2004 Francs2000 deleted QDII (content was: ''''Qualified Domestic Institutional Investor'''[[zh:QDII]]')
- 14:49, 18 Dec 2004 Francs2000 deleted Turkije (test)
- 14:48, 18 Dec 2004 Francs2000 deleted QFII (content was: ''''Qualified Foreign Institutional Investor'''')
- 14:44, 18 Dec 2004 AlainV deleted Orwell's predictions (vague rant)
- 14:43, 18 Dec 2004 Sverdrup deleted Wild Force Rangers (speedy, nonsense. "The Red Wild FOrce Ranger is Cole. Cole was chosen by the Lion to become the Red Wild Force Ranger, otherwise known as the Red Lion Ranger. Using his Growl Phone, Cole can Morph into the Blazing Lion. In battle he can summon..." repeated with different names inserted)
- 14:42, 18 Dec 2004 Sverdrup deleted Rajah of Malwa (content was: '{{delete}}SEARCH FOR RAJAH OF MALWA IN WIKIPEDIA')
- 14:41, 18 Dec 2004 Sverdrup deleted I-mate SP3 (content was: '{{delete}}'''Bold text'''[[Link title]][[Image:Example.jpg]]<nowiki>Insert non-formatted text here</nowiki>----')
- 14:41, 18 Dec 2004 Francs2000 deleted QFII (content was: ''''Qualified Foreign Institutional Investor'''')
- 14:40, 18 Dec 2004 Sverdrup deleted Download best of entertainment (content was: '{{delete}}best of entertainment')
- 14:40, 18 Dec 2004 Francs2000 deleted Mark hedges (content was: 'Mark Hedges is a cunt')
- 14:40, 18 Dec 2004 Sverdrup deleted Jan Duchoslav (Redir points to non-existant article, deletion req. by author. ; content was: '{{delete}}#REDIRECT [[Jan Antonín Duchoslav]]')
- 14:40, 18 Dec 2004 Francs2000 deleted Sundi (nonsense vanity)
- 14:39, 18 Dec 2004 Sverdrup deleted Sri Gemilang TV (content was: 'i want to know all about sri gemilang tv{{db|wikipedia is not a forum}}')
- 14:39, 18 Dec 2004 Francs2000 deleted Dalby gif (content was: 'Fotbollslag utanför Lund. För närvarande i division sex men på väg uppåt. Ett mycket talangfullt lag med bl.a. passningsläggaren Magnus Rosen och drib...')
- 14:39, 18 Dec 2004 Sverdrup deleted List of Central Asian, Iranian, Caucasian and Tatar surnames (content was: 'kala{{delete}}')
- 14:39, 18 Dec 2004 Francs2000 deleted 100 Greatest Moments from TV Hell (content was: '{{delete}}ays')
- 14:38, 18 Dec 2004 Francs2000 deleted Vastus intermedius (content was: '{{delete}}vastus intermedius')
- 14:37, 18 Dec 2004 Stan Shebs deleted Image:Monturiol stamp.jpg (unused image, blown up from sufficient smaller version)
- 14:28, 18 Dec 2004 Jnc deleted Talk:Wisconsin and Southern/to do (pr request, redir, left over from fit of page renames)
- 14:25, 18 Dec 2004 Jnc deleted Wikkkipedia (pr request, redir, neologism)
- 14:19, 18 Dec 2004 Stan Shebs deleted Image:Postage stamp thumb.jpg (thumb no longer needed)
- 14:03, 18 Dec 2004 Jnc deleted Millimetre of mercury (pr request, redir, target of rename)
- 13:45, 18 Dec 2004 Ta bu shi da yu restored "Exploding_Wales"
- 13:35, 18 Dec 2004 Violetriga deleted Chris Rea/Temp (was a rewrite after a copyvio but not moved in it's place, moved to [[Chris Rea]] and deleting this)
- 12:07, 18 Dec 2004 Deb deleted Analyte (content was: '{{speedy}}Analyte')
- 12:00, 18 Dec 2004 Davidcannon deleted User:Davidcannon/Index-3 (One of my user pages. I'm reorganizing.)
- 11:56, 18 Dec 2004 Adam Bishop deleted The Seminar XX, Encore: On Feminine Sexuality, the Limits of Love and Knowledge (content was: 'on')
- 11:15, 18 Dec 2004 Cool Hand Luke deleted Trust Companies of Canada (content was: '[[Category:Trust Companies of Canada|Canada]]{{db|empty of content}}')
- 11:15, 18 Dec 2004 Cool Hand Luke deleted The Watsons (content was: '{{delete}}the watsons are really nice people.')
- 11:12, 18 Dec 2004 Cool Hand Luke deleted Ryan swagerty (content was: '{{delete}}'--was a test before being blanked)
- 11:11, 18 Dec 2004 Cool Hand Luke deleted Quo Tai-chi (content was: '{{delete}}wazzup there im May Oliverio')
- 11:11, 18 Dec 2004 Cool Hand Luke deleted Paul Ellis (content was: '{{delete}}A God amongst men.')
- 11:11, 18 Dec 2004 Cool Hand Luke deleted Nahor (content was: '{{db|toolbar test}}== Headline text ==<nowiki>Insert non-formatted text here</nowiki>--[[User:209.240.9.135|209.240.9.135]] 04:03, 18 Dec 2004 (UTC)...')
- 11:10, 18 Dec 2004 Cool Hand Luke deleted Libertarian resources (content was: '{{db|POV and non-encyclopedic}}This is a list of free-to-use '''Libertarian Resources'''[http://www.jk5.net JK5 - Exposing lies, corruption, hypoc...')
- 11:09, 18 Dec 2004 Cool Hand Luke deleted La Fuega d'Attila or Papa Leone ferma Attila (content was: '{{db|only content is toolbar experiment}}[[Image:Example.jpg]][[Image:Example.jpg]][[Image:Example.jpg]]')
- 11:09, 18 Dec 2004 Cool Hand Luke deleted Infertilate (content was: 'v. - To render one infertile.{{nonsense}}')
- 11:09, 18 Dec 2004 Cool Hand Luke deleted Haunnuka (content was: ''''''Jon is a douchebag!'''''... I mean I love you Jon...{{delete}}')
- 11:08, 18 Dec 2004 Cool Hand Luke deleted Give My Regards To Broadway (speedy test page)
- 11:08, 18 Dec 2004 Cool Hand Luke deleted Ghilzai/Khilji (content was: '{{delete}}'''Bold text'''MOHAMMAD ALI DURRANI == Headline text ==ALI BADIZAI [[Image:Example.jpg]][[Media:Example.ogg]]<math>Insert formula here...')
- 11:08, 18 Dec 2004 Cool Hand Luke deleted Fenton Mewly (content was: '{{db|toolbar experiment}}[[Image:Example.jpg]]')
- 11:08, 18 Dec 2004 Cool Hand Luke deleted Davfs2 (content was: '{{delete}}5454545')
- 11:08, 18 Dec 2004 Cool Hand Luke deleted Dylan Tinsley (content was: '{{delete}}Dylan Tinsley has X-Ray Ears. He can hear you breathing...')
- 11:08, 18 Dec 2004 Cool Hand Luke deleted Chad Wingerd (content was: '{{delete}}Uhhhhhhhh..............One of the Greatest Players in the world of Dark Age of Camelot, with characters he never made.')
- 11:07, 18 Dec 2004 Cool Hand Luke deleted Bootable (content was: '{{delete}}cup cakes')
- 11:07, 18 Dec 2004 Cool Hand Luke deleted Austrian Sign Language (content was: '{{delete}}me')
- 11:07, 18 Dec 2004 Cool Hand Luke deleted Anton Ambschel (content was: '{{delete}}are u a mathematician? we want to know who you are')
- 11:07, 18 Dec 2004 Cool Hand Luke deleted Amyrtaeus (content was: '{{delete}}'''Bold text'''')
- 11:06, 18 Dec 2004 Cool Hand Luke deleted Dan burleson (content was: '{{delete}}Dan Burleson currently resides in Orlando, FL.')
- 11:05, 18 Dec 2004 Cool Hand Luke deleted Howard Hughes will (content was: 'Howard Hughes will{{delete}}')
- 11:05, 18 Dec 2004 Cool Hand Luke deleted Headword (content was: 'QR5EYùLòM')
- 09:49, 18 Dec 2004 Everyking deleted Sollog (content was: '#redirect [[John Patrick Ennis]]' moving the page back here, to better title, apparently preferred on talk)
- 09:36, 18 Dec 2004 ALoan restored "Gramophone_record"
- 09:20, 18 Dec 2004 Theresa knott deleted Chad Wingerd (content was: 'Uhhhhhhhh..............One of the Greatest Players in the world of Dark Age of Camelot, with characters he never made.')
- 09:16, 18 Dec 2004 Theresa knott deleted Chad Wingerd (content was: 'Uhhhhhhhh..............')
- 09:07, 18 Dec 2004 SWAdair deleted Upstream transcription factor (test page)
- 08:58, 18 Dec 2004 Raul654 deleted Image:People-of-Chilmark-Benton-1920.jpg (Depricated thumbnail)
- 08:58, 18 Dec 2004 Raul654 deleted Image:People-of-Chilmark-Benton-1920-small.jpg (Depricated thumbnail)
- 08:47, 18 Dec 2004 SWAdair deleted Theodore Steinway (content was: '{{delete}}Duplex Scaling in current model of Schimmel Grand.')
- 08:46, 18 Dec 2004 SWAdair deleted Image talk:Gta3-pc-walking.jpeg (content was: '[[mario typing]][http://www.example.com link title]== Headline text ==[[Image:Example.jpg]][[Media:Example.ogg]]<nowiki>Insert non-formatted text her...')
- 08:35, 18 Dec 2004 SWAdair deleted Rearrangement (content was: '{{db|it is not even a sensible definition}}Rearrangement can be best thought of as a placement of a substance or a gathering of many substances from ...')
- 08:33, 18 Dec 2004 SWAdair deleted List of people by first name (content was: '{{delete}}maryellen')
- 08:19, 18 Dec 2004 Hemanshu deleted LEARN ALBANIAN LANGUAGE (content was: '{{delete}}'''LEARN ALBANIAN LANGUAGE'''I HATE PEOPLE WHO DON'T SPEAK [[Albanian_language|ALBANIAN]]!')
- 08:18, 18 Dec 2004 Rlandmann deleted De Havilland Canada (make way for page move)
- 08:12, 18 Dec 2004 SWAdair deleted Software industry (content was: 'dear sir, please give me the full information of software industry. thank you{{n...')
- 08:10, 18 Dec 2004 SWAdair deleted Abernant (content was: 'http://www.geocities.com/helluvaway/TOWERcache/2059exit100.html{{db|only a link}}')
- 08:08, 18 Dec 2004 Bryan Derksen deleted Talk:Enid Community Corrections Center (content was: 'I am a new hired correction officer ...' appears to be a message board style posting, of no relevance to Wikipedia)
- 08:06, 18 Dec 2004 Bryan Derksen deleted Enid Community Corrections Center (content was: '#REDIRECT [[Talk:Enid Community Corrections Center]]' - one edit, no encyclopedic content or relevance)
- 06:56, 18 Dec 2004 Neutrality deleted White Label (content was: 'White labels are independently produced records. They are pressed at a much smaller scale then music released by major-labels.')
- 06:55, 18 Dec 2004 Neutrality deleted Bludgeoning to death (content was: 'When victims are beaten with clubs, bats and other blunt objects until either hemmhoraging or death occurs')
- 06:54, 18 Dec 2004 Neutrality deleted Espanish (content was: '{{notenglish}}Somos una Iglesia Hispana en Fort myers, Iglesia Nueva Vision, nesesitamos, repardo o coverturaPastor Hernandez (239) 939-4349')
- 06:54, 18 Dec 2004 Neutrality deleted Lubang, Occidental Mindoro (content was: '{{delete}}maramki')
- 06:54, 18 Dec 2004 Arminius deleted Clay pickering (content was: '[['''ME GAY!''']]')
- 06:54, 18 Dec 2004 Neutrality deleted Rock song (content was: 'Achilles last stand, by led zeppelinenough saidodnarb')
- 06:53, 18 Dec 2004 Infrogmation deleted Elsie Leung (WP:CP listed since 7 Dec; content was: '{{copyvio|url = http://www.info.gov.hk/info/sj.htm}}')
- 06:53, 18 Dec 2004 Neutrality deleted "Encryption" (content was: 'this is to inform you that{{delete}}')
- 06:53, 18 Dec 2004 Neutrality deleted Plano west senior high school (content was: '== Headline text ==RUTHLESS PLANO WEST CONSUMTION 2000 FLEX PLUS'''Ruthlessness''' is the entirety of '''hate'''. As is Plano West. Nesteled in a s...')
- 06:50, 18 Dec 2004 SimonP deleted Canadian Bar Association (prep for move)
- 06:37, 18 Dec 2004 Infrogmation deleted Yadava (WP:CP listed since 7 Dec; content was: '{{copyvio|url=http://www.gyan.org/yadavhist.html}}')
- 06:32, 18 Dec 2004 Infrogmation deleted UCCF/Temp (Temp redirect no longer needed; content was: '#REDIRECT [[UCCF]]')
- 06:30, 18 Dec 2004 Infrogmation deleted UCCF (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.uccf.org.uk/about/index.php}}[[User:Matt Crypto|— Matt]] 18:03, 6 Dec 2004 (UTC)')
- 06:29, 18 Dec 2004 Infrogmation deleted John rankin rogers (WP:CP listed since 6 Dec; )
- 06:29, 18 Dec 2004 Infrogmation deleted Oginga Odinga (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://kenya740.tripod.com/jaramogi.html}}')
- 06:28, 18 Dec 2004 Infrogmation deleted That Obscure Object of Desire (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.amazon.com/exec/obidos/tg/feature/-/312664/}}')
- 06:28, 18 Dec 2004 Infrogmation deleted Den (Pharaoh) (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.thepharaohs.net/Ancient/Early_dynastic/PharaohsFull.cfm}}')
- 06:28, 18 Dec 2004 Infrogmation deleted Bassdrive (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.bassdrive.com/}}')
- 06:28, 18 Dec 2004 Infrogmation deleted Heart Island (WP:CP listed since 6 Dec; content was: '{{copyvio1}}http://www.ganboatline.com/900.html{{copyvio2}}')
- 06:27, 18 Dec 2004 Infrogmation deleted Xcbl (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.si.umich.edu/misq-stds/proceedings/137_135-146.pdf}}')
- 06:27, 18 Dec 2004 Infrogmation deleted Sarama and Panis (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://voi.org/books/rig/ch10.htm}}')
- 06:26, 18 Dec 2004 Niteowlneils deleted Tamil-Kannada-Telugu languages (content was: 'perimbum{{delete}}')
- 06:26, 18 Dec 2004 Niteowlneils deleted Raclede (content was: ''''[Image:http://www.img-corp.com/others/linux.jpg]== Raclede Rulz ==''' raclede_rulz@img-corp.comBorn: Sept. 11, 1983'''Interest:''' Computers...')
- 06:26, 18 Dec 2004 Infrogmation deleted Bren gun (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://world.guns.ru/machine/mg10-e.htm}}')
- 06:25, 18 Dec 2004 Infrogmation deleted Image:Andy kaufman.jpg (WP:CP listed since 6 Dec; )
- 06:25, 18 Dec 2004 Infrogmation deleted University of Art and Design Helsinki (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.uiah.fi/frontpage.asp?path=1866}}')
- 06:25, 18 Dec 2004 Infrogmation deleted Bloch oscillations (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://ppprs1.phy.tu-dresden.de/~rosam/kurzzeit/main/bloch/}}')
- 06:25, 18 Dec 2004 Niteowlneils deleted 2nd Battalion 8th Infantry (content was: '{{delete}}')
- 06:24, 18 Dec 2004 Infrogmation deleted RSPB Mawddach Valley (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/m/mawddachvalley/index.asp}}')
- 06:23, 18 Dec 2004 Infrogmation deleted RSPB Havergate Island (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/h/havergateisland/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker ...')
- 06:23, 18 Dec 2004 Infrogmation deleted Andreas wickstrom (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.mapinc.org/drugnews/v01.n2042.a02.html}}')
- 06:23, 18 Dec 2004 Infrogmation deleted Fairmont The Queen Elizabeth (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://honeymoons.about.com/cs/canadiangetaways/a/johnyoko.htm and http://www.fairmont.com/FA/en/CDA/Home/Hotels/AboutHotel/CDHotelHisto...')
- 06:23, 18 Dec 2004 Infrogmation deleted Punctuationism (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.antiessays.com/essay.php?eid=1830}}')
- 06:23, 18 Dec 2004 Infrogmation deleted Thrash rock (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://earthlink.com.com/2001-8668_32-0.html}}')
- 06:23, 18 Dec 2004 Infrogmation deleted Tri-State University (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.tristate.edu/}}')
- 06:23, 18 Dec 2004 Infrogmation deleted Transwiki:Istarion (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.istarion.com/biography.htm}}')
- 06:23, 18 Dec 2004 Infrogmation deleted National Cowboy Museum and western heritage center (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.nationalcowboymuseum.org/m_welc.html}}')
- 06:21, 18 Dec 2004 Infrogmation deleted RSPB Pulborough Brooks (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/p/pulboroughbrooks/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker &#...')
- 06:21, 18 Dec 2004 Infrogmation deleted RSPB Dungeness (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/d/dungeness/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]]...')
- 06:21, 18 Dec 2004 Infrogmation deleted RSPB Morcambe Bay (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/m/morecambebay/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ...')
- 06:21, 18 Dec 2004 Infrogmation deleted RSPB The Lodge (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/t/thelodge/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ...')
- 06:20, 18 Dec 2004 Infrogmation deleted RSPB Gwenffrwd & Dinas (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/d/dinas/}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ([[User talk...')
- 06:20, 18 Dec 2004 Infrogmation deleted Jana (WP:CP listed since 6 Dec; content was: '{{copyvio1}}The Woman's Encyclopedia of Myths and Secrets, Barbara G. Walker{{copyvio2}}')
- 06:20, 18 Dec 2004 Infrogmation deleted Cameron Duncan (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.listener.co.nz/default,1150.sm}} [[User:Joy Stovall|Joyous]] 03:38, Dec 6, 2004 (UTC)')
- 06:19, 18 Dec 2004 Infrogmation deleted RSPB Carngafallt (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/c/Carngafallt/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ...')
- 06:19, 18 Dec 2004 Infrogmation deleted RSPB Cwm Clydach (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/c/cwmclydach/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]...')
- 06:19, 18 Dec 2004 Infrogmation deleted RSPB Lake Vyrnwy (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/l/lakevyrnwy/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]...')
- 06:18, 18 Dec 2004 Infrogmation deleted RSPB Valley Wetlands (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/v/valleylakes/}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ([[Use...')
- 06:18, 18 Dec 2004 Infrogmation deleted RSPB Ynys-hir (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/y/ynys-hir/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ...')
- 06:17, 18 Dec 2004 Infrogmation deleted RSPB South Stack (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/s/southstack/}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ([[User...')
- 06:17, 18 Dec 2004 Infrogmation deleted RSPB Dee Estuary - Point of Air (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/p/pointofair/}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ([[User...')
- 06:17, 18 Dec 2004 Infrogmation deleted RSPB Lochwinnoch (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/l/lochwinnoch/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ...')
- 06:17, 18 Dec 2004 Infrogmation deleted RSPB Vane Farm (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/v/vanefarm/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ...')
- 06:17, 18 Dec 2004 Infrogmation deleted RSPB Conwy (WP:CP listed since 6 Dec; content was: '{{copyvio|url=http://www.rspb.org.uk/reserves/guide/c/conwy/index.asp}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ([[...')
- 06:15, 18 Dec 2004 Infrogmation deleted Image:Hind size.gif (listed on WP:PUI and tagged for deletion since 11 Nov)
- 06:04, 18 Dec 2004 SWAdair deleted A Child's Garden of Verses (content was: 'hhhhhhhhhhhh{{delete}}')
- 05:40, 18 Dec 2004 SWAdair deleted High Incarnate (content was: '{{speedy}}A Uber guy, aka 'High'')
- 05:40, 18 Dec 2004 Quadell deleted Image:2F00.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2F00.gif (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FBC.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FBB.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FBA.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FB9.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FB8.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FB7.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FB6.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FB5.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FB4.PNG (Listed on IfD since Dec 10)
- 05:39, 18 Dec 2004 Quadell deleted Image:2FB3.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FB2.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FB1.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FB0.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FAF.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FAE.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FAD.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FAC.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FAB.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FAA.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA9.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA8.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA7.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA6.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA5.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA4.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA3.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA2.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA1.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2FA0.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2F9F.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2F9E.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2F9D.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2F9C.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2F9B.PNG (Listed on IfD since Dec 10)
- 05:38, 18 Dec 2004 Quadell deleted Image:2F9A.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F99.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F98.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F97.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F96.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F95.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F94.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F93.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F92.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F91.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F90.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F8F.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F8E.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F8D.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F8C.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F8B.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F8A.PNG (Listed on IfD since Dec 10)
- 05:35, 18 Dec 2004 Quadell deleted Image:2F89.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F88.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F87.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F86.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F85.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F84.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F83.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F82.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F81.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F80.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F7F.PNG (Listed on IfD since Dec 10)
- 05:34, 18 Dec 2004 Quadell deleted Image:2F7E.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F7D.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F7C.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F7B.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F7A.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F79.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F78.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F77.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F76.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F75.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F74.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F73.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F72.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F71.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F70.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F6F.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F6E.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F6D.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F6C.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F6B.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F6A.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F69.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F68.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F67.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F66.PNG (Listed on IfD since Dec 10)
- 05:29, 18 Dec 2004 Quadell deleted Image:2F65.PNG (Listed on IfD since Dec 10)
- 05:27, 18 Dec 2004 SWAdair deleted Mitch (content was: 'mitch is a man womon i diont really know what he is but he can ro in hell after dieng a slow and painful death.have a nice day mitch:)[[fag]]{{delet...')
- 05:27, 18 Dec 2004 SWAdair deleted Asakura Mai (content was: 'fgf{{delete}}')
- 05:27, 18 Dec 2004 SWAdair deleted ZGMF-X56S Impulse Gundam (content was: '{{delete}}jkhkk')
- 05:27, 18 Dec 2004 SWAdair deleted Wolverhampton South East (content was: '{{db|it's a test page, fake election results}}British National Party 17565Labour Party 17569Conservative 17599')
- 05:26, 18 Dec 2004 Quadell deleted Image:2F64.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F63.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F62.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F61.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F60.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F5F.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F5E.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F5D.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F5C.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F5B.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F5A.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F59.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F58.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F57.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F56.PNG (Listed on IfD since Dec 10)
- 05:26, 18 Dec 2004 Quadell deleted Image:2F55.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F54.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F53.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F52.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F51.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F50.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F4F.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F4E.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F4D.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F4C.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F4B.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F4A.PNG (Listed on IfD since Dec 10)
- 05:25, 18 Dec 2004 Quadell deleted Image:2F49.PNG (Listed on IfD since Dec 10)
- 05:24, 18 Dec 2004 Arminius deleted Sanctuary lyrics (content was: 'SanctuaryLord, prepare me to be a SanctuaryPure and holy, tried and trueWith thanksgiving, I'll be a livingSanctuary for you')
- 05:22, 18 Dec 2004 Quadell deleted Image:2F48.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F47.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F46.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F45.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F44.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F43.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F42.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F41.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F40.PNG (Listed on IfD since Dec 10)
- 05:22, 18 Dec 2004 Quadell deleted Image:2F3F.PNG (Listed on IfD since Dec 10)
- 05:21, 18 Dec 2004 SWAdair deleted Susan Lee (content was: '{{delete}}Susan C. Lee 李鳳遷')
- 05:21, 18 Dec 2004 SWAdair deleted Steve Cardenas (content was: '[[Link title]]'rocky... you rock!{{delete}}')
- 05:21, 18 Dec 2004 SWAdair deleted Simeria (spam)
- 05:19, 18 Dec 2004 SWAdair deleted Scenario-weighted expected return (content was: 'whatsis it{{delete}}')
- 05:19, 18 Dec 2004 Quadell deleted Image:2F3E.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F3D.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F3C.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F3B.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F3A.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F39.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F38.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F37.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F36.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F35.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F33.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F32.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F31.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 Quadell deleted Image:2F34.PNG (Listed on IfD since Dec 10)
- 05:19, 18 Dec 2004 SWAdair deleted Phonetic in one language (content was: '{{del}}pho')
- 05:17, 18 Dec 2004 SWAdair deleted Nietzchians (content was: 'Nietzchians are the followers of Nietzch, and have no mind of their own. Instead of creating and cultivating their own values, they adopt those of a ...')
- 05:17, 18 Dec 2004 SWAdair deleted Lunenfeld (content was: '{{delete}}[[peter Lunenfeld]]')
- 05:17, 18 Dec 2004 Quadell deleted Image:2F25.PNG (Listed on IfD since Dec 10)
- 05:17, 18 Dec 2004 Quadell deleted Image:2F23.PNG (Listed on IfD since Dec 10)
- 05:17, 18 Dec 2004 Quadell deleted Image:2F22.PNG (Listed on IfD since Dec 10)
- 05:17, 18 Dec 2004 Quadell deleted Image:2F1F.PNG (Listed on IfD since Dec 10)
- 05:17, 18 Dec 2004 Quadell deleted Image:2F18.PNG (Listed on IfD since Dec 10)
- 05:17, 18 Dec 2004 Quadell deleted Image:2F17.PNG (Listed on IfD since Dec 10)
- 05:17, 18 Dec 2004 Quadell deleted Image:2F30.PNG (Listed on IfD since Dec 10)
- 05:17, 18 Dec 2004 Quadell deleted Image:2F2F.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F2E.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F2D.PNG (Listed on IfD since Dec 10 )
- 05:16, 18 Dec 2004 Quadell deleted Image:2F2C.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F2B.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F2A.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F29.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F28.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F27.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F26.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 SWAdair deleted Likhita (Quote that was blanked by author -- content was: '{{deletebecause|blanked by creator}}')
- 05:16, 18 Dec 2004 Quadell deleted Image:2F20.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F1D.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F1C.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F1B.PNG (Listed on IfD since Dec 10 )
- 05:16, 18 Dec 2004 Quadell deleted Image:2F1A.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 Quadell deleted Image:2F19.PNG (Listed on IfD since Dec 10)
- 05:16, 18 Dec 2004 SWAdair deleted KoЯn (misspelled duplicate of [[Korn]])
- 05:15, 18 Dec 2004 SWAdair deleted Kingston upon Hull East (content was: '{{delete}}Labour 49845Liberal 12111Cons 992')
- 05:15, 18 Dec 2004 SWAdair deleted John Hamilton (test page)
- 05:14, 18 Dec 2004 SWAdair deleted International Arcade Museum (content was: '{{deletebecause|Weblink placeholder}}The International Arcade MuseumTM is the world's largest museum of the art, inventions, and history of the amus...')
- 05:14, 18 Dec 2004 SWAdair deleted Ho Hung Kin (content was: '{{nonsense}}http://www.hku.hk/daao/hkuclass75/75name.htmHo Hung Kin PaulFaculty : Social SciencesDegree : BSocScMajor in : Accounting and Busin...')
- 05:14, 18 Dec 2004 SWAdair deleted GSigma (content was: '{{db| this is either ad-spam or nonsense}}'''Intellligent Manufacturing Systems Group'''We work on [[Virtual_Organization]]')
- 05:14, 18 Dec 2004 SWAdair deleted G4 (band) (content was: '{{del}}G4 are the biggest bunch of legends/cunts ever to walk to the earth, and Tamsin went to school with one of them. He was the biggest cunt. But ...')
- 05:13, 18 Dec 2004 SWAdair deleted Foresight Technologies, Inc. (spam)
- 05:13, 18 Dec 2004 SWAdair deleted Ernest "Chip" Floyd (content was: 'he played on Rushs Caress of Steel{{delete}}')
- 05:13, 18 Dec 2004 Quadell deleted Image:2F16.PNG (Listed on IfD since Dec 10)
- 05:13, 18 Dec 2004 Quadell deleted Image:2F15.PNG (Listed on IfD since Dec 10)
- 05:13, 18 Dec 2004 Quadell deleted Image:2F14.PNG (Listed on IfD since Dec 10)
- 05:13, 18 Dec 2004 Quadell deleted Image:2F13.PNG (Listed on IfD since Dec 10)
- 05:13, 18 Dec 2004 Quadell deleted Image:2F12.PNG (Listed on IfD since Dec 10)
- 05:13, 18 Dec 2004 Quadell deleted Image:2F11.PNG ( Listed on IfD since Dec 10)
- 05:13, 18 Dec 2004 Quadell deleted Image:2F10.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F0F.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F0E.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F0D.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F0C.PNG (Listed on IfD since Dec 10 )
- 05:12, 18 Dec 2004 Quadell deleted Image:2F0B.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F0A.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F09.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F08.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F07.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F06.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F05.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F04.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F03.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F02.PNG (Listed on IfD since Dec 10)
- 05:12, 18 Dec 2004 Quadell deleted Image:2F01.PNG (Listed on IfD since Dec 10)
- 05:10, 18 Dec 2004 Quadell deleted Image:P6230037.JPG (Listed on IfD since Dec 10)
- 05:10, 18 Dec 2004 Quadell deleted Image:P13-mitre1.jpg (Listed on IfD since Dec 10)
- 05:10, 18 Dec 2004 Quadell deleted Image:P0009493.small.jpg (Listed on IfD since Dec 10)
- 05:10, 18 Dec 2004 Quadell deleted Image:Aargau flag.jpg (Listed on IfD since Dec 10)
- 05:10, 18 Dec 2004 Quadell deleted Image:P-59 Airacomet.jpg (Listed on IfD since Dec 10)
- 05:10, 18 Dec 2004 Quadell deleted Image:Ozzy osbourne.jpeg (Listed on IfD since Dec 10)
- 05:10, 18 Dec 2004 Quadell deleted Image:OverseasBar.jpg (Listed on IfD since Dec 10)
- 05:09, 18 Dec 2004 Quadell deleted Image:6489 golevka-04.jpg (Listed on IfD since Dec 10)
- 05:09, 18 Dec 2004 Quadell deleted Image:61-A-Crew.gif (Listed on IfD since Dec 10)
- 05:09, 18 Dec 2004 Quadell deleted Image:Xiphophorus helleri 2 rev.png (Listed on IfD since Dec 10)
- 05:03, 18 Dec 2004 Adam Bishop deleted Talk:Tcforums (content was: 'Don't delete this page.')
- 05:03, 18 Dec 2004 Adam Bishop deleted Tcforums (stop creating this)
- 05:02, 18 Dec 2004 SWAdair deleted Deontodeclination (content was: '{{db|does not exist - zero hits on Google}}== What is Deontodeclination? ==[[Deontodeclination]] v. It is the action by which one rejects the exist...')
- 05:01, 18 Dec 2004 SWAdair deleted Delmar network group (content was: ''''DelMar Network Group''' is an Energy [[Consulting]] Firm specializing is [[renewable energy]] solutions.{{deletebecause|Advertising, spam.}}')
- 05:01, 18 Dec 2004 SWAdair deleted Crash Twinsanity (content was: '{{nonsense}}Hey what up everybody! this game is so cool![[Media:Example.ogg]]')
- 05:01, 18 Dec 2004 SWAdair deleted Cosmism (nonsense prognostication)
- 04:58, 18 Dec 2004 Adam Bishop deleted Talk:Tcforums (content was: 'Although 'It's not funny; it's not entertaining; it's not even educational.' this page serves as a reminder to those who frequent the site as to why t...')
- 04:58, 18 Dec 2004 Adam Bishop deleted Tcforums (junk again)
- 04:56, 18 Dec 2004 SWAdair deleted Bicton Woodland Railway (content was: '{{delete}}==External link==[http://www.bictongardens.co.uk/RAILWAY.htm Railway website]')
- 04:56, 18 Dec 2004 SWAdair deleted Arvid (content was: '{{deletebecause|The contents of this page have been moved to http://en.wiktionary.org/wiki/Transwiki:Arvid .}}ARVID Scandinavian first name for Bo...')
- 04:55, 18 Dec 2004 SWAdair deleted Anovulatory cycle (content was: 'fgfg{{delete}}')
- 04:55, 18 Dec 2004 SWAdair deleted Andrewics (content was: 'The Andrewics is a group of people angry about wars America has been in and won. They are very secret and evil.{{nonsense}}')
- 04:37, 18 Dec 2004 Cool Hand Luke deleted Abu Ghraib prisoner abuse/Censored (Delete unused subpage. content was: '#REDIRECT [[Abu Ghraib prisoner abuse/pictures suppressed]]')
- 04:35, 18 Dec 2004 Ambi deleted Category:Queensland politicians (empty duplicate category)
- 04:23, 18 Dec 2004 Rmhermen deleted Simon Birch (content was: '{{delete}}Hello how are you')
- 04:23, 18 Dec 2004 Rmhermen deleted Maeganh
- 04:22, 18 Dec 2004 Rmhermen deleted Bernard Porter (content was: '{{nonsense}}[http://www.example.com link title]whassup i'm be nard porter and i'm here representin tha block so hit me back at 548 6451. peace Ý')
- 04:22, 18 Dec 2004 Rmhermen deleted Brian Sackett (content was: '{{delete}}Brian Sackett is the best singer slash actor slash all around person and is especially better than his little brother, matt sackett, who has...')
- 04:22, 18 Dec 2004 Ta bu shi da yu deleted Add It Up (1981-1993) (content was: ' ''Add I+ Up'' is a full live and audio clip album.')
- 04:21, 18 Dec 2004 Rmhermen deleted Brian Morrison
- 04:20, 18 Dec 2004 Rmhermen deleted Why korea is the best
- 04:19, 18 Dec 2004 Rmhermen deleted Ben Stubbs
- 04:18, 18 Dec 2004 Rmhermen deleted Halloween II (movie) (content was: '{{deletebecause|test}}oooo')
- 04:18, 18 Dec 2004 Rmhermen deleted Alayambo (content was: '{{db|It's nonsensical AND was speedily deleted a short time ago and recreated bysame person with different content that's also nonsensical.}}that per...')
- 04:17, 18 Dec 2004 Rmhermen deleted Alex Partridge
- 04:17, 18 Dec 2004 Rmhermen deleted Greg Porter (content was: '{{deletebecause|self-blanked test page}}')
- 04:13, 18 Dec 2004 Jpgordon deleted John Penis (content was: '#REDIRECT [[John Patrick Ennis]]')
- 04:11, 18 Dec 2004 Ta bu shi da yu deleted Wikipedia:Sandbox/Monopoly (content was: 'Welcome to Monopoly. <==Please Do not Edit this page unless playing==>.==Monopoly: Players==1. Chris2. Alex3. Amanda4. Michael5. 6. 7...')
- 04:10, 18 Dec 2004 Adam Bishop deleted Tcforums (junk)
- 04:00, 18 Dec 2004 Cool Hand Luke restored "Abu_Ghraib_prisoner_abuse/pictures_suppressed"
- 03:58, 18 Dec 2004 Cool Hand Luke deleted Abu Ghraib prisoner abuse/pictures suppressed (content was: '{{deleteagain}}っっb')
- 03:58, 18 Dec 2004 Cool Hand Luke restored "Abu_Ghraib_prisoner_abuse/pictures_suppressed"
- 03:58, 18 Dec 2004 Cool Hand Luke deleted Abu Ghraib prisoner abuse/pictures suppressed (content was: '{{deleteagain}}っっb')
- 03:57, 18 Dec 2004 Cool Hand Luke restored "Abu_Ghraib_prisoner_abuse/pictures_suppressed"
- 03:40, 18 Dec 2004 Adam Bishop deleted Green bean (content was: 'green bean')
- 03:19, 18 Dec 2004 CJCurrie deleted Brandon East (Manitoba riding (created in error; page with proper title has been created)
- 03:12, 18 Dec 2004 Cyrius deleted Barberini Faun (CSD - lack of definition/context)
- 02:49, 18 Dec 2004 TheCustomOfLife deleted Cesar beats daniel (content was: '{{nonsense}}On december 17th cesar created a movie to show daniel that he should go watch nick cage')
- 02:43, 18 Dec 2004 DavidWBrooks deleted ARob (content was: '{{delete}}ARob was a nickname that was formed when a guy took the first letter of his name and the first 3 letters of his last name and added them to...')
- 02:42, 18 Dec 2004 DavidWBrooks deleted Deb Foskey (content was: '{{deletebecause|contentless}}[[image:http://www.act.greens.org.au/images/2004Foskey.jpg]]')
- 02:42, 18 Dec 2004 TheCustomOfLife deleted Talk:Mangina (This article no longer exists, please stop talking about it.)
- 02:41, 18 Dec 2004 DavidWBrooks deleted New Mc World (short essay, and a pretty crummy one at that)
- 02:41, 18 Dec 2004 DavidWBrooks deleted BERNIE VICIOUS (mis-capitalized duplicate)
- 02:40, 18 Dec 2004 DavidWBrooks deleted REASON CLEAN (content was: 'singer for Green Jello. )
- 02:40, 18 Dec 2004 Nunh-huh deleted Jorden (content was: vandalism)
- 02:37, 18 Dec 2004 TheCustomOfLife deleted Talk:Mangina (mangina article is dead, the talk will be deleted, too.)
- 02:36, 18 Dec 2004 DavidWBrooks deleted Newport productions (joke about a cartoon by "some kid who wanted his own show" )
- 02:36, 18 Dec 2004 TheCustomOfLife deleted Talk:Mangina (article is deleted, talk will be deleted, too)
- 02:35, 18 Dec 2004 TheCustomOfLife deleted Mangina (patent nonsense)
- 02:34, 18 Dec 2004 Nunh-huh deleted Mitch (vandalism.)
- 02:34, 18 Dec 2004 DavidWBrooks deleted A clinton (obcene joke)
- 02:30, 18 Dec 2004 DavidWBrooks deleted Fantabulous
- 02:30, 18 Dec 2004 DavidWBrooks deleted Bury South (content was: '{{delete}}LABOUR 29767TORY 2133')
- 02:20, 18 Dec 2004 Flockmeal deleted Forgasm (content was: '{{nonsense}}''Forgasm'', a term coined in late 2004 was coined by a young man named only 'Eric'. The word is derived by combining Fake and Orgasm in ...')
- 02:11, 18 Dec 2004 Niteowlneils deleted Andrei Gavrilov (content was: '{{delete}}test')
- 02:06, 18 Dec 2004 RadicalBender deleted Ken Anderson (Delete to redirect [[Kenneth Allan Anderson]] here)
- 02:00, 18 Dec 2004 Rdsmith4 deleted Wikipedia:Current surveys/FrBaArbQuality (hate to disappoint you, but this is speedy-delete nonsense.)
- 01:58, 18 Dec 2004 Mackensen deleted Wikipedia:Current surveys/FrBaArbQuality (Ad hominem attack on Fred Bauder)
- 01:50, 18 Dec 2004 Cyrius deleted Bahlbahl (CSD - nonsense (ball ball?))
- 01:49, 18 Dec 2004 Adam Bishop deleted Mati (content was: 'Mati is a stupid doucheface.')
- 01:48, 18 Dec 2004 Adam Bishop deleted Is there something you dont know? (content was: '{{deletebecause|I don't need to explain, actually.}}No.Wikipedia knows everything.')
- 01:46, 18 Dec 2004 Cyrius deleted BOCOG (CSD - lack of context/definition (acronym expansion + external link))
- 01:46, 18 Dec 2004 Niteowlneils deleted Seed Destiny Episode 10 (content was: '{{delete}}gjgjgj')
- 01:32, 18 Dec 2004 Mirv deleted Hulk Hogan: All-Time Champ (content was: '{{deletebecause|Very short article with obvious non-content. IMO, it doesn't even warrant a redirect to [[Hulk Hogan]].}}')
- 01:26, 18 Dec 2004 Jiang deleted Talk:Second Taiwan Strait Crisis (content before blanking was: '{{COTW}}')
- 01:24, 18 Dec 2004 Adam Bishop deleted WC (rapper) (content was: 'He is cool')
- 01:23, 18 Dec 2004 Niteowlneils deleted Victoria Wellington (from on-going vandal reg user--content was: '{{delete}}'Victoria Wellington' is a mutation of the genome project. The half pig half woman hybred that was formed in the early 1980s has gone awo...')
- 01:14, 18 Dec 2004 Neutrality deleted Transient tic disorder (content was: 'my name is elizabeth franzone.')
- 01:05, 18 Dec 2004 Cyrius deleted Template:Waytoomanyboxes (patent nonsense.)
- 01:03, 18 Dec 2004 Adam Bishop deleted Krusty Comics (content was: 'i no where u live')
- 01:02, 18 Dec 2004 Cyrius deleted Australian plague locust (CSD - no definition/context)
- 00:59, 18 Dec 2004 Stan Shebs deleted ID/LP grammar (content before blanking was: 'Lowes site visit intention was to provide opportunity for the final 3PLS to see their operations in action and to better understand how Lowe’s does bu...')
- 00:58, 18 Dec 2004 Gentgeen deleted California secessionists (VfD vote = 9-2 for deletion)
- 00:54, 18 Dec 2004 Cyrius deleted Asian Cup 1984 (CSD - no context/definition)
- 00:54, 18 Dec 2004 Cyrius deleted Asian Cup 1980 (CSD - no context/definition)
- 00:54, 18 Dec 2004 Cyrius deleted Asian Cup 1976 (CSD - no context/definition)
- 00:53, 18 Dec 2004 Cyrius deleted Asian Cup 1972 (CSD - no context/definition)
- 00:52, 18 Dec 2004 Mustafaa deleted Mohamed Hallaba (content was: 'Mohamed Hallaba loves men.not all men, just ones from spain')
- 00:45, 18 Dec 2004 Adam Bishop deleted Alayambo (content was: 'some girl on mirc chat')
- 00:45, 18 Dec 2004 Niteowlneils deleted Richmond Bread Riots (content was: '{{delete}}if you look at bread riots you can rearrange the letters to spell irate bords!')
- 00:44, 18 Dec 2004 Niteowlneils deleted Zoo Entertainment (content was: '{{db|Well, why not?}}Record Label.')
- 00:44, 18 Dec 2004 Cyrius deleted ASIP (CSD - lack of definition/context (acronym expansion and nothing more))
- 00:44, 18 Dec 2004 Niteowlneils deleted Chacachacare, Trinidad (content was: '{{delete}}http://archive.tri-cityherald.com/travel/stories/world/sadisland.html')
- 00:39, 18 Dec 2004 Adam Bishop deleted Notes from the Gallows (content was: 'notes from the gallows by julius fucik')
- 00:39, 18 Dec 2004 Adam Bishop deleted The NFL on CBS (content was: '{{sport-stub}}{{tv-stub}}')
- 00:34, 18 Dec 2004 ALoan restored "Fremantle_Football_Club"
- 00:34, 18 Dec 2004 Mustafaa deleted Pruritus ani (content was: '{{delete}}It is fun!')
- 00:33, 18 Dec 2004 ALoan deleted Fremantle Football Club (page move)
- 00:23, 18 Dec 2004 Everyking deleted Ocean's 12 (content was: '{{del}}GREAT FILM!!!!!!!!!!!!!!!')
- 00:21, 18 Dec 2004 Neutrality deleted Talk:Latin language (content was: '#REDIRECT [[Talk:Latin language/archive]]')
- 00:20, 18 Dec 2004 Evercat deleted Harvest festival (content was: 'Harvest festival')
- 00:18, 18 Dec 2004 Neutrality deleted Latin language (content was: '#REDIRECT [[Latin]]')
- 00:11, 18 Dec 2004 TheCustomOfLife deleted April Chest (content was: 'she has big nockers that will knock you out.')
- 00:09, 18 Dec 2004 ALoan deleted Arc programming language (content was: '#redirect [[Arc language]]' - page move)
- 00:05, 18 Dec 2004 Jiang deleted Political divisions of China (moving page back)
- 00:02, 18 Dec 2004 Deb deleted Canadian dollar Wikipedia article "Canadian dollar". (patent nonsense)
- 00:01, 18 Dec 2004 Deb deleted Self-righteous (user page copied onto article page by anon vandal)
- 23:58, 17 Dec 2004 ALoan deleted Political divisions of the People's Republic of China (content was: '#REDIRECT [[Political divisions of China]]' - page move)
- 23:56, 17 Dec 2004 Infrogmation deleted Political discurse (WP:CP listed since 3 Dec; content was: '{{copyvio1}}*http://www.pupress.princeton.edu/titles/366.html*http://perso.univ-lyon2.fr/~dlewis/lcpd.htm{{copyvio2}}- [[User:Evil saltine|Evil s...')
- 23:55, 17 Dec 2004 Ambi deleted History of rail transport in Canada (content was: '* [[Canadian Pacific Railway]]* [[Union Station(Toronto)]]* [[Union Station(Ottawa)]]')
- 23:55, 17 Dec 2004 Adam Bishop deleted Mitch (content was: '{{delete}}mitch is a fucking gay fag that has a fukin ugly bitch how is gong to break up with him and he like to hot on 10 year olds and elderly peo...')
- 23:54, 17 Dec 2004 Mirv deleted Talk:Fucking bastard religous twat (content was: '#redirect [[Talk:Jesus]]')
- 23:49, 17 Dec 2004 Infrogmation deleted Steve Holsten (content was: 'A well known Pedophile from Missouri')
- 23:49, 17 Dec 2004 Infrogmation deleted History of rail transport in Canada (substub with no article; content was: '* [[Canadian Pacific Railway]]')
- 23:48, 17 Dec 2004 Infrogmation deleted VONBLUVENS (blanked by original/only editor; content before blanking was: '[[Steve Holsten]]')
- 23:41, 17 Dec 2004 Deb deleted Icon of Sin (content was: '{{del}}[[Image:http://img96.exs.cx/img96/1272/avadoom47na.jpg]]')
- 23:32, 17 Dec 2004 Andrewa restored "Talk:Amos_Farquhar"
- 23:27, 17 Dec 2004 Dante Alighieri deleted Dux, CA (speedied under criteria 1 and 4, see VfD page for rationale)
- 23:19, 17 Dec 2004 Deb deleted Semkae (content was: 'Semkae Kilonzo was born in Tanzania{{db|non-notable student at the University of Bristol}}')
- 23:17, 17 Dec 2004 Deb deleted Wallens Ridge State Prison (content was: '{{deletebecause|More nonsense from a chronic vandal bot!}}Wallens Ridge State Prison')
- 23:17, 17 Dec 2004 Quadell deleted Image:Roman ring with one wormhole.PNG (Uploaded under wrong name)
- 23:15, 17 Dec 2004 Deb deleted Jeff nunn (content was: '{{delete}}A ragingly homesexual black man from missouri')
- 23:08, 17 Dec 2004 Deb deleted WTRG (content was: '{{delete}}'''WRVA'''')
- 23:07, 17 Dec 2004 Neutrality deleted Bill Manspeaker (content was: 'Bill Manspeaker is the singer for Green Jello / Green Jelly.Known as: MORONIC DICKTATOR or MORONIC DEGENERATE.Owns a club named Q-Topia.')
- 23:00, 17 Dec 2004 Academic Challenger deleted Ricardo Urreiztieta (content was: '{{deletebecause|No Google hits, seems to be vanity}}'''Ricardo Urreiztieta'''- Born on Feburay 13, either in [[Venezuela]] or [[Houston]], TX. rela...')
- 22:59, 17 Dec 2004 Neutrality deleted Talk:Abu Ghraib prisoner abuse/pictures suppressed (Delete as previously deleted article/inappropiate subpage)
- 22:59, 17 Dec 2004 Neutrality deleted Abu Ghraib prisoner abuse/pictures suppressed (Delete - previously deleted article)
- 22:54, 17 Dec 2004 Deb deleted The Bonnie Parker Story (content was: '{{del}}vdre')
- 22:53, 17 Dec 2004 David Gerard deleted Body thetan (delete no-history redirect for page move; content was: '#REDIRECT [[Body Thetans]]')
- 22:47, 17 Dec 2004 SimonP deleted Noah Melamed (content was: 'my best friend who now has his own wikipedia definitioncongrats!-Z')
- 22:44, 17 Dec 2004 SimonP deleted Edith Abney-Hastings, 12th Countess of Loudoun (content was: 'The Countess of Loudoun was called Edith Abney-Hastings.{{substub}}')
- 22:36, 17 Dec 2004 John Kenney deleted Alfred, Duke of Saxe-Coburg and Gotha (content was: '#REDIRECT: [[Alfred of Saxe-Coburg-Gotha]]')
- 22:32, 17 Dec 2004 Infrogmation deleted Canlis Restaurant (WP:CP listed since 3 Dec)
- 22:30, 17 Dec 2004 MacGyverMagic deleted Jumpin' Jupiter (content was: '{{deletebecause|Utter lack of content; predicate nominative at best}}Chuck Jones's last Sylvester cartoon.')
- 22:30, 17 Dec 2004 Infrogmation deleted Hope International University (WP:CP listed since 3 Dec; content was: '{{copyvio|url=http://catalog.hiu.edu/hiuwhoweare.php?inst_code=1}}')
- 22:30, 17 Dec 2004 Niteowlneils deleted New York State Highway 25 (content was: 'BOOOP! BOOOP! BOOOP! This is a napkin alert, Marzipan! I lost uh, my napkin! It's the one I always use when I eat buffalo wings, and I can't find it a...')
- 22:29, 17 Dec 2004 Infrogmation deleted Macario Sacay/Temp (Temp page redirect no longer needed; content was: '#REDIRECT [[Macario Sacay]]')
- 22:29, 17 Dec 2004 MacGyverMagic deleted Jomalig, Quezon (content was: '{{delete}}jomalig, Quezon')
- 22:29, 17 Dec 2004 Infrogmation deleted Talk:Macario Sacay (no longer needed; content was: 'stub version on [[Macario Sacay/Temp]]. [[User:Bluemask|Blue Mask]]|[[User talk:Bluemask|Talk]] 18:41, Dec 5, 2004 (UTC)')
- 22:29, 17 Dec 2004 Niteowlneils deleted Navision (content was: '== Headline text =={{db|nuffink to it}}')
- 22:28, 17 Dec 2004 Infrogmation deleted Macario Sacay (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.bibingka.com/phg/sakay/default.htm}}--[[User:Bluemask|Blue Mask]]|[[User talk:Bluemask|Talk]] 18:35, Dec 5, 2004 (UTC)')
- 22:27, 17 Dec 2004 MacGyverMagic deleted Joseph Fetis (content was: '{{deletebecause|Blank page}}')
- 22:25, 17 Dec 2004 Quadell deleted Image:Soapstone.lid.350pix.jpg (Scaled-down duplicate image)
- 22:24, 17 Dec 2004 Quadell deleted Image:Snow leopard-s.jpg (Scaled-down duplicate image)
- 22:22, 17 Dec 2004 Quadell deleted Image:Snoqualmiefalls-small.jpg (Scaled-down duplicate image)
- 22:22, 17 Dec 2004 Infrogmation deleted Plasma television/Temp (Temp redirect no longer needed; content was: '#REDIRECT [[Plasma television]]')
- 22:22, 17 Dec 2004 Infrogmation deleted Jesse Lee Peterson/Temp (Temp redirect no longer needed; content was: '#REDIRECT [[Jesse Lee Peterson]]')
- 22:21, 17 Dec 2004 MacGyverMagic deleted A rising international banker was gunned down at a McDonald's in 1984. (content was: 'a banker named hugo was gunned down by James Huberty at McDonald's in 1984.')
- 22:20, 17 Dec 2004 Infrogmation deleted Plasma television (WP:CP listed since 5 Dec; )
- 22:20, 17 Dec 2004 Rossami deleted Secrets of the Neopian World (My undeletion was out of order. I was working on old data.)
- 22:20, 17 Dec 2004 MacGyverMagic deleted Navision (content was: '== Headline text ==')
- 22:19, 17 Dec 2004 Rossami deleted Talk:Secrets of the Neopian World (content was: 'I would like this page to be deleted because of its informality.')
- 22:19, 17 Dec 2004 Infrogmation deleted Paulose mar gregorios (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.angelfire.com/folk/gregorians_muscat/BishopPaulose.html}}')
- 22:19, 17 Dec 2004 Infrogmation deleted Etienne Decroux (WP:CP listed since 5 Dec; )
- 22:19, 17 Dec 2004 Infrogmation deleted Tom Sotis (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.knifefighting.com/amok/tsotis.html}}')
- 22:18, 17 Dec 2004 Infrogmation deleted AMOK! South Africa (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.amok.co.za/AMOKText/HistoryText.htm}}')
- 22:18, 17 Dec 2004 Infrogmation deleted Kun Tao Silat (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.martialartsresource.com/anonftp/pub/eskrima/digests/fmafaq.htm}}')
- 22:18, 17 Dec 2004 Infrogmation deleted Yarmouk University (WP:CP listed since 5 Dec; content was: '{{copyvio1}}Staes in the text that it is by the ANIMA MEDIA CENTER{{copyvio2}}- [[User:SimonP|SimonP]] 21:36, Dec 4, 2004 (UTC)')
- 22:17, 17 Dec 2004 Infrogmation deleted Jesse Lee Peterson (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.bondinfo.org/aboutus/revjesseleepeterson/revjesseleepeterson.htm}}')
- 22:17, 17 Dec 2004 Infrogmation deleted Fair and accurate credit transactions (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.real-life-debt.com/blog/archives/000756.shtml}}')
- 22:17, 17 Dec 2004 Infrogmation deleted Michael davies (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.mdaviesonmedj.com/}}')
- 22:16, 17 Dec 2004 Infrogmation deleted Ken Ryker (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.imdb.com/name/nm0753296/bio}}')
- 22:16, 17 Dec 2004 Infrogmation deleted Michael davies/Temp (redirect to non-existant page; content was: '#REDIRECT [[Michael Davies]]')
- 22:14, 17 Dec 2004 Infrogmation deleted Yeat (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.letterboxing.org/BoxView.asp?boxnum=11777&boxname=YEAT}}')
- 22:14, 17 Dec 2004 Infrogmation deleted Yeat/Temp (sillyness)
- 22:13, 17 Dec 2004 Rossami restored "Secrets_of_the_Neopian_World"
- 22:13, 17 Dec 2004 Infrogmation deleted Nima Shirali (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.chowk.com/show_writer_page.cgi?pen_name=Nima%20Shirali}}')
- 22:13, 17 Dec 2004 Infrogmation deleted Republikud (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.lit.org/view/14886}}')
- 22:13, 17 Dec 2004 Infrogmation deleted Jeff Ward (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.obituariestoday.com/Obituaries/ObitShow.cfm?Obituary_ID=29612§ion=pin}}')
- 22:13, 17 Dec 2004 Infrogmation deleted Time Stranger kyoko (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.mikomi.net/strangers/story.php}}')
- 22:12, 17 Dec 2004 Geogre deleted Mark Howell (content was: '{{del}}Mark Howell is known for his giant... love for mathematics. His mastery of the calculator is unmatchable; he can simply whip it out and satisfy...')
- 22:12, 17 Dec 2004 Infrogmation deleted Islamic medicine (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.iedit.com/profiles/News-Media/irfan/573.html}}')
- 22:12, 17 Dec 2004 Infrogmation deleted Hydroinformatics (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.hydroinformatics.com}}')
- 22:12, 17 Dec 2004 Infrogmation deleted Scorelogix (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.scorelogix.com/about_us.asp}}')
- 22:11, 17 Dec 2004 Infrogmation deleted Unemployment Score (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.scorelogix.com/sample.asp and [http://www.scorelogix.com/ueScore_benefits.asp]}}[[User:Knowledge Seeker|[[User:Knowledge See...')
- 22:11, 17 Dec 2004 Infrogmation deleted Tony Hatch (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.spectropop.com/TonyHatch/}}[[User:Niteowlneils|Niteowlneils]] 17:57, 5 Dec 2004 (UTC)')
- 22:10, 17 Dec 2004 Infrogmation deleted Ropeyoga (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.ropeyoga.com/exercise.php}}')
- 22:10, 17 Dec 2004 Infrogmation deleted Birt-Hogg-Dube syndrome (WP:CP listed since 5 Dec; content was: '{{copyvio|url= http://www.birthoggdube.org/id1.html}}')
- 22:10, 17 Dec 2004 Infrogmation deleted SAARC THE SOURCE OF HOPE FOR THE PEOPLE OF SOUTH ASIA (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.saarc-sec.org}}')
- 22:10, 17 Dec 2004 Joy Stovall deleted Sebastian Sahla (VFD consensus to delete)
- 22:10, 17 Dec 2004 Infrogmation deleted IGA (supermarkets) (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.igainc.com/aboutIGA/international.asp}} --[[User:Rlandmann|Rlandmann]] 09:15, 5 Dec 2004 (UTC)')
- 22:10, 17 Dec 2004 Infrogmation deleted Isatis (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.thatschina.net/20049-p57.htm}}')
- 22:09, 17 Dec 2004 Neutrality deleted Porky's Badtime Story (content was: 'Bob Clampett's first cartoon as director.')
- 22:08, 17 Dec 2004 Infrogmation deleted Reading comprehension for special needs (WP:CP listed since 5 Dec; content was: '{{copyvio|url= http://www.edu.gov.on.ca/eng/general/elemsec/speced/planindep/17.html}}')
- 22:08, 17 Dec 2004 Geogre deleted Bhisham Harchandani (content was: '{{delete}}not a llama.')
- 22:08, 17 Dec 2004 Infrogmation deleted Transwarp Megazord (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.geocities.com/brode84/PRTF-Transwarp_Megazord.html}}')
- 22:08, 17 Dec 2004 Joy Stovall deleted Keane Li (VFD consensus to delete)
- 22:08, 17 Dec 2004 Infrogmation deleted Unrelated business activities (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://nonprofit.about.com/od/legalresources/a/unrelated_bus.htm}}--[[User:Rbrwr|rbrwr]][[User talk:Rbrwr|<sup>±</sup>]] 20:17,...')
- 22:08, 17 Dec 2004 Geogre deleted Deontodeclination (content was: '== What is Deontodeclination? ==[[Deontodeclination]] is the correct abbreviation of ''[[Deontological Declination]]'', which is the study of the re...')
- 22:08, 17 Dec 2004 Infrogmation deleted Sumith Wickramasinghe (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.allfreeessays.com/student/WSumith_Wickramasinghe_of_Sri_Lanka.html}}')
- 22:07, 17 Dec 2004 Geogre deleted Butyrylcholine (content was: '{{delete}}temp')
- 22:07, 17 Dec 2004 Infrogmation deleted Nobuyoshi Araki (WP:CP listed since 5 Dec; content was: '{{cleanup}}[[ja:荒木経惟]]{{copyvio|url=http://photojpn.org/news/modules.php?op=modload&name=Reviews&file=index&req=showcon...')
- 22:07, 17 Dec 2004 Infrogmation deleted Klaus Egge (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.classical-composers.org/cgi-bin/ccd.cgi?comp=egge}}')
- 22:07, 17 Dec 2004 Infrogmation deleted Bukharian Jews (WP:CP listed since 5 Dec; content was: '{{copyvio|url= http://www.bukharianjews.com/modules.php?op=modload&name=Sections&file=index&req=viewarticle&artid=2&page=1}}')
- 22:07, 17 Dec 2004 Infrogmation deleted William Roberts (athlete) (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www.parrswoodpress.com/athletics/iron.htm}}')
- 22:07, 17 Dec 2004 Infrogmation deleted Fort Monroe (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://www-tradoc.army.mil/museum/history.asp}}')
- 22:07, 17 Dec 2004 Infrogmation deleted Image:320x240.jpg (WP:CP listed since 5 Dec; )
- 22:06, 17 Dec 2004 Joy Stovall deleted Festizio (vfed consensus to delete)
- 22:06, 17 Dec 2004 Infrogmation deleted Image:Tas ship orbit2.jpg (WP:CP listed since 5 Dec; )
- 22:06, 17 Dec 2004 Infrogmation deleted Image:EnterpriseE.jpg (WP:CP listed since 5 Dec; )
- 22:06, 17 Dec 2004 Rmhermen deleted Ancient Martinist Order
- 22:05, 17 Dec 2004 Infrogmation deleted Image:Constitutionrefit.jpg (WP:CP listed since 5 Dec; )
- 22:05, 17 Dec 2004 Infrogmation deleted Kresge Auditorium (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://web.mit.edu/evolving/projects/kresge/}}[[User:Whosyourjudas|Whosyourjudas]] [[User talk:Whosyourjudas|(talk)]] 19:12, 5 Dec 200...')
- 22:05, 17 Dec 2004 Geogre deleted W. H. Freeman (content was: 's')
- 22:04, 17 Dec 2004 Rmhermen deleted The skaliens
- 22:04, 17 Dec 2004 Joy Stovall deleted The Last Wolf in Ireland (VFD consensus to delete)
- 22:02, 17 Dec 2004 Infrogmation deleted Curtis Warren (WP:CP listed since 5 Dec; content was: '{{copyvio|url=http://gangstersinc.tripod.com/CurtisWarren.html}} [[User:Joy Stovall|Joyous]] 17:25, Dec 5, 2004 (UTC)')
- 22:02, 17 Dec 2004 Joy Stovall deleted The Myshall Danish Path (VFD consensus to delete)
- 21:59, 17 Dec 2004 Joy Stovall deleted User:128.196.194.167/Communism (unanimous VFD consensus to delete)
- 21:58, 17 Dec 2004 Joy Stovall deleted User:128.196.194.167/Communism/Done (unanimous VFD consensus)
- 21:56, 17 Dec 2004 Joy Stovall deleted User:128.196.194.167/Done (unanimous VFD consensus)
- 21:54, 17 Dec 2004 Ike9898 deleted Testytesty (content was: 'Sorry - wrong post :(Can someone please delete it? I didn't find out how. Thanks a lot. Again, I'm very sorry, did that by accident! :(')
- 21:53, 17 Dec 2004 Rmhermen deleted Gui-in lee (content was: 'Gui-In Lee is a postdoctoral associate in Professor Andrew D. Hamilton's lab at Yale University.')
- 21:42, 17 Dec 2004 Adam Bishop deleted The skaliens (content was: '{{delete}}= The Skaliens ==')
- 21:33, 17 Dec 2004 Niteowlneils deleted Makaram (content was: '{{delete}}makaram')
- 21:32, 17 Dec 2004 Flockmeal deleted "Iquique" (content was: '== Headline text ==Iquique is in the north of Chile and it is called 'Tierra de Campeones' by 'Iquiqueños' because of many sport victories. Also,Iq...')
- 21:22, 17 Dec 2004 Adam Bishop deleted Deutsche Werft (content was: '{{delete}}ich weiss das du juden veshtext')
- 21:22, 17 Dec 2004 Adam Bishop deleted Deutsche Werft (content was: 'ich weiss das du juden veshtext')
- 21:17, 17 Dec 2004 Niteowlneils deleted Image:Bu-map.jpg (dupe of png)
- 21:16, 17 Dec 2004 Niteowlneils deleted Image:Yemen football association.gif (dupe/orphan)
- 21:15, 17 Dec 2004 Niteowlneils deleted Microsoft Codename Blackcomb (content was: '{{delete}}== Headline text ==hi lol')
- 21:15, 17 Dec 2004 Niteowlneils deleted Talk:Yin Fu (page deleted)
- 21:14, 17 Dec 2004 Niteowlneils deleted Old Elbe Tunnel (content was: '{{delete}}[[Media:Example.ogg]]<math>Insert formula here</math> sUpper cool')
- 21:13, 17 Dec 2004 Niteowlneils deleted Macon State Prison (content was: '{{delete}}macon state prisoner anthony b johnson')
- 21:13, 17 Dec 2004 Niteowlneils deleted Victims of Liberalism (content was: '{{delete}}'''The Victims of Liberalism'''')
- 21:13, 17 Dec 2004 Niteowlneils deleted WOLFFANG (content was: '{{delete}}== WOLFFANG ==JOHNNYS CHARACTOR CREATED BY WILL TO HELP IN TIMES OF NEED.== NO HARD FEELINGS ALRIGHT JOHNNY ==')
- 21:11, 17 Dec 2004 Niteowlneils deleted Lenègre's disease (content was: '{{deletebecause|nonsense}}ii')
- 21:11, 17 Dec 2004 Niteowlneils deleted Liberal Overlords (content was: '{{delete}}'''The Liberal Overlords'''')
- 21:11, 17 Dec 2004 Niteowlneils deleted Jennifer streiter (content was: '{{delete}}She is LAME!')
- 21:11, 17 Dec 2004 SimonP deleted Future Soldier (content was: '{{delete}}the future soldier will be very powerfull.')
- 21:10, 17 Dec 2004 Niteowlneils deleted Cartesian fallacy (content was: '{{deletebecause|blank page}}')
- 21:10, 17 Dec 2004 Niteowlneils deleted Bronagh Fitzpatrick (content was: '{{delete}}')
- 21:09, 17 Dec 2004 Niteowlneils deleted Anarchist Communitarian Network (content was: '{{delete}}Alls well ends well right? Not really in the political world. One day we shall prevail!!!!')
- 21:04, 17 Dec 2004 Christopher Mahan deleted Wild style (content was: 'fug guts'''Bold text'''[[Link title]]')
- 20:57, 17 Dec 2004 Jiang deleted Talk:Sun Ke (content was: '{{Possible China COTW}}')
- 20:54, 17 Dec 2004 Sannse deleted Fsfsafsfdsaasfdjlk; (content was: '#redirect [[Boninville, Ontario]]')
- 20:54, 17 Dec 2004 Fredrik deleted Fucking bastard religous twat (content was: '{{deletebecause|clearly abusive - used to be a redirect to Jesus}}')
- 20:53, 17 Dec 2004 Sannse deleted Fdasdffasdsdf (content was: '#redirect [[IS-2000]]')
- 20:53, 17 Dec 2004 Sannse deleted Fdafsfsfsdjlk (content was: '#redirect [[Orris root]]')
- 20:53, 17 Dec 2004 Flockmeal deleted Anarchist Communitarian Network (content was: 'Alls well ends well right? Not really in the political world. One day we shall prevail!!!!')
- 20:52, 17 Dec 2004 Sannse deleted Dfsasasfdsfdasfdk (content was: '#redirect [[RMS Baltic]]')
- 20:52, 17 Dec 2004 Sannse deleted Sfdsdsffsda (content was: '#redirect [[Holy Synod]]')
- 20:51, 17 Dec 2004 Sannse deleted "Fdfaafasdas" (content was: '#redirect [[Die Bajadere]]')
- 20:51, 17 Dec 2004 Sannse deleted Dfadfdsaljk (content was: '#redirect [[Hubert Selby Jr.]]')
- 20:50, 17 Dec 2004 Sannse deleted Affdsaskl (content was: '#redirect [[Hugh I of Cyprus]]')
- 20:50, 17 Dec 2004 Sannse deleted Asdsddfd (content was: '#redirect [[Ossie Clark]]')
- 20:50, 17 Dec 2004 Sannse deleted "Asdfdsafdsf" (content was: '#redirect [[Scoter]]')
- 20:50, 17 Dec 2004 Sannse deleted Sfdfsdasalj (content was: '#redirect [[Excalibur (comics)]]')
- 20:49, 17 Dec 2004 Sannse deleted "Dsffdsfadsfdas" (content was: '#redirect [[Linger (song)]]')
- 20:49, 17 Dec 2004 Sannse deleted "Addsfsdf" (content was: '#redirect [[Kuquenan Falls]]')
- 20:49, 17 Dec 2004 Sannse deleted "Fdasfddsfsdfsd" (content was: '#redirect [[Matamata-Piako (district), New Zealand]]')
- 20:49, 17 Dec 2004 Sannse deleted "Afdfdfdasafds" (content was: '#redirect [[Jacobs Field]]')
- 20:48, 17 Dec 2004 Sannse deleted "Asfdfdsafdsafdas" (content was: '#redirect [[Baron Burgh]]')
- 20:48, 17 Dec 2004 Sannse deleted "Sfddsfasadfs" (content was: '#redirect [[Leônidas da Silva]]')
- 20:48, 17 Dec 2004 Ed g2s deleted "Image:Coxs bazar.jpg" (Moving to commons)
- 20:47, 17 Dec 2004 Sannse deleted Gfssgdlk (content was: '#redirect [[John F. Seiberling Jr.]]')
- 20:47, 17 Dec 2004 Sannse deleted Sfdsdfasfdalk (content was: '#redirect [[Malayan Emergency]]')
- 20:47, 17 Dec 2004 Sannse deleted Ddssadf (content was: '#redirect [[Robert Wright (politician)]]')
- 20:47, 17 Dec 2004 Sannse deleted Sdffsfdasdfsaads (content was: '#redirect [[Stevens Thomson Mason (Virginia)]]')
- 20:46, 17 Dec 2004 Sannse deleted Talk:Dffddfasfds (content was: '#redirect [[Talk:Wilkes County, Georgia]]')
- 20:46, 17 Dec 2004 Sannse deleted Dffddfasfds (content was: '#redirect [[Wilkes County, Georgia]]')
- 20:45, 17 Dec 2004 Sannse deleted Talk:Afdfdaafdssfda (content was: '#redirect [[Talk:John Forrest (friar)]]')
- 20:45, 17 Dec 2004 Sannse deleted Afdfdaafdssfda (content was: '#redirect [[John Forrest (friar)]]')
- 20:45, 17 Dec 2004 Fredrik deleted Red Giant dwarf (content was: '{{delete}}== Headline text ==fg')
- 20:45, 17 Dec 2004 Sannse deleted Dasfsfddf (content was: '#redirect [[Julia Pardoe]]')
- 20:45, 17 Dec 2004 Fredrik deleted Green dwarf (content was: '{{delete}}== Headline text ==heeelo fkjasdklfj;aslkjf;lskjf;lksajdf;lksja;flkjsa;dlkfj;saldkjf;skf')
- 20:44, 17 Dec 2004 Sannse deleted Sfddfsfdfdsa (content was: '#redirect [[Invisible Man (novel)]]')
- 20:44, 17 Dec 2004 Sannse deleted Dfadfadad (content was: '#redirect [[Blanco y Negro Records]]')
- 20:43, 17 Dec 2004 Sannse deleted Afdfdasdsfadsf (content was: '#redirect [[The Masters Tournament]]')
- 20:43, 17 Dec 2004 Sannse deleted Asfdsfdfsa (content was: '#redirect [[Singapore Area Licensing Scheme]]')
- 20:42, 17 Dec 2004 Sannse deleted Asffsdsadfdfas (content was: '#redirect [[Elephant Six]]')
- 20:42, 17 Dec 2004 Sannse deleted Talk:Fafsaddsfdfs (content was: '#redirect [[Talk:Academia]]')
- 20:41, 17 Dec 2004 Sannse deleted Fafsaddsfdfs (content was: '#redirect [[Academia]]')
- 20:41, 17 Dec 2004 Sannse deleted Ffasfdsafds (content was: '#redirect [[Herschel Johnson]]')
- 20:41, 17 Dec 2004 Sannse deleted Afsdfafdsf (content was: '#redirect [[Kamapua'a]]')
- 20:40, 17 Dec 2004 Sannse deleted Asasfdssafdfd (content was: '#redirect [[Ekron]]')
- 20:39, 17 Dec 2004 Sannse deleted Safddfsadsfsda (content was: '#redirect [[Acts of Love]]')
- 20:36, 17 Dec 2004 Sannse deleted Fadfadfafdafd (content was: '#redirect [[Harold Loeffelmacher]]')
- 20:34, 17 Dec 2004 Sannse deleted Wikipedia talk:Requests for circumcism (content was: '#redirect [[Wikipedia talk:Requests for arbitration]]' page move vandalism)
- 20:34, 17 Dec 2004 Sannse deleted Wikipedia:Requests for circumcism (content was: '#redirect [[Wikipedia:Requests for arbitration]]' page move vandalism)
- 20:32, 17 Dec 2004 Sannse deleted Affsadsdf (content was: '#redirect [[Day of the Fight]]')
- 20:32, 17 Dec 2004 Adam Bishop deleted Bedford-Stuyvesant (content was: copyvio, 9 days old)
- 20:26, 17 Dec 2004 Ed g2s deleted Image:Coxs bazar small.jpg (Image already delete)
- 20:21, 17 Dec 2004 Christopher Mahan deleted Seiyu Group (content was: '#redirect [[The Seiyu, Ltd.]]')
- 20:16, 17 Dec 2004 Aranel deleted Category:Christian Eschatology (content was: '{{cfd}}This category has been moved to [[:Category:Christian eschatology]]. It may be deleted at any time by a administrator.')
- 20:15, 17 Dec 2004 Aranel deleted Category:U.S. federal Executive Branch electees (delete per cfd)
- 20:13, 17 Dec 2004 WhisperToMe deleted Shiina Ringo (Moving Shina Ringo here)
- 20:12, 17 Dec 2004 Aranel deleted Category:WTO member states (delete per cfd - see Category:WTO members)
- 20:08, 17 Dec 2004 SimonP deleted Birla Institute of Technology & Science, Pilani - Dubai Campus (content was: 'how to continue post graduate course after ug any cnetres in dubai')
- 20:06, 17 Dec 2004 SimonP deleted Stick Figures (content was: '[[Image:AN2.jpg]]Animation 2Lead Player: Bass Guitar(Mr. Stick)')
- 20:03, 17 Dec 2004 SimonP deleted UCLA School of Theater Film and Television (content was: 'i want to study in the film department, which website do i visit')
- 19:59, 17 Dec 2004 SimonP deleted Glass House (Connecticut) (content was: 'A house that places its inhabitant within nature.')
- 19:57, 17 Dec 2004 SimonP deleted Tuyen (content was: 'Tuyen la lap trinh vien o Cong ty Integra')
- 19:56, 17 Dec 2004 Malcolm Farmer deleted Shawn "The Clown" Crahan (content was: 'lalalalalalalalalaalallalalalaal')
- 19:56, 17 Dec 2004 SimonP deleted San Carlo alle Quattro Fontane (content was: ' mbm,kuluy,n,h,')
- 19:55, 17 Dec 2004 SimonP deleted National Cowboy & Western Heritage Museum (content was: 'igsoiuhoih')
- 19:55, 17 Dec 2004 Aranel deleted Category:Fortune telling (delete per cfd, see Category:Divination)
- 19:54, 17 Dec 2004 Aranel deleted Category:Sects (delete per cfd)
- 19:53, 17 Dec 2004 SimonP deleted Double Q PU (content before blanking was: 'The Xbox Live Gamertag of Thornton, CO, Resident, Stewart Williams.Abbreviation for Quilted Quicker Picker Upper.Prefered weapon: Sniper Rifle.Halo...')
- 19:53, 17 Dec 2004 Gamaliel deleted Ian Kimpton (content was: '{{delete}}Born in 1793 in Scotland, England, Kimpton was a ledgenary seafarer of the early 19th Century. He caught the biggest whale ever , weighing...')
- 19:53, 17 Dec 2004 SimonP deleted Heywood Floyd (content before blanking was: 'Heywood Floyd was a russian space agent in the book ''[[2010, A Space Odyssey]]''')
- 19:53, 17 Dec 2004 SimonP deleted KCOBAPS (foreign language article blanked by creator)
- 19:52, 17 Dec 2004 Aranel deleted Category:Israeli student (delete per cfd)
- 19:51, 17 Dec 2004 Aranel deleted Category:Legendary movie creature experts (delete per cfd)
- 19:50, 17 Dec 2004 SimonP deleted Masatran, R. (information moved to user namespace)
- 19:49, 17 Dec 2004 Gamaliel deleted T.Y. Li (content was: 'sdgfvsdf{{delete}}')
- 19:48, 17 Dec 2004 Everyking deleted 2-A (content was: '{{delete}}== 2-A ==DESLIKES JESTER GREATLY. JESTER DESERVES IT HE WAS AN IDIOT. HES SORRY')
- 19:48, 17 Dec 2004 Gamaliel deleted Pogromshchiki (content was: '{{speedy}}hey')
- 19:47, 17 Dec 2004 Everyking deleted Yoko Kurama (content was: '{{delete}}YOKO KURAMA== INFO ON YOKO == YOKO KURAMA IS THE LOCAL THEIF OF HELLHE IS CURENTLY INVOLVED WITH CHOAS HE IS PART MAN PART FOX DESPI...')
- 19:47, 17 Dec 2004 Everyking deleted PAIKU (nonsense)
- 19:46, 17 Dec 2004 Everyking deleted PAIKUS MASTER (content was: '== MASTER ==WE DONT LIKE HIM HE HIT PAIKU JESTER SENT NIGHTSHADE TO GO FIND HELP FOR PAIKU. HE FOUND WOLFFANG JOHNNYS CHARACTOR')
- 19:45, 17 Dec 2004 Christopher Mahan deleted Matt Sackett (content was: '''see Brian Sackett'''')
- 19:40, 17 Dec 2004 Christopher Mahan deleted JESTER BOKUMIA (content was: '== JESTER ==I HATE THE CRAP I GET MYSELF IN TO. I DONT KNOW HOW I DO IT HALF THE TIME')
- 19:30, 17 Dec 2004 Rmhermen deleted Www.roommateexpress.com (content was: 'we are a nationwide roommate matching service. over 1 million people have used our service since 1989. it's safe,fast and easy.www.roommateexpress.com...')
- 19:30, 17 Dec 2004 David.Monniaux deleted Image:Gendarmes mobiles FAMAS.jpg (license problem)
- 19:29, 17 Dec 2004 Rmhermen deleted When did Palestinian suicide bombings occur
- 19:28, 17 Dec 2004 Rmhermen deleted Second order philosophy (content was: '{{deletebecause|Near nonsensical, incomplete statement}}Second-order philosphical questions will be classification questions which do admit of true/f...')
- 19:28, 17 Dec 2004 Rmhermen deleted Sat4all (content was: 'Sat4all is an internet forum in the Dutch language( http://www.sat4all.com ) that informs people how to get a maximum use out of their receiver. Very ...')
- 19:27, 17 Dec 2004 Rmhermen deleted King's Contrivance, Columbia, Maryland
- 19:26, 17 Dec 2004 Rmhermen deleted Peter Achi
- 19:26, 17 Dec 2004 Rmhermen deleted BNP Paribas (Canada) (content was: 'Canadian operations of French bank BNP.{{deletebecause|No content}}')
- 19:25, 17 Dec 2004 Rmhermen deleted À tout prendre
- 19:25, 17 Dec 2004 Hadal deleted MILTO BAKA (nonsense)
- 19:23, 17 Dec 2004 Hadal deleted Great great gross (content was: 'A '''geat great gross''' is equal to a gross great [[gross]], i.e. 12 * 144 * 144 = 248832. There are a gross great great grosses in a [[great great g...')
- 19:22, 17 Dec 2004 Hadal deleted Great great great gross (content was: 'A '''geat great great gross''' is equal to a gross great great [[gross]], i.e. 12 * 144 * 144 * 144 = 35831808. There are a gross great great great g...')
- 19:22, 17 Dec 2004 Hadal deleted Great great great great gross (content was: '{{delete}}A ''geat great great great gross''' is equal to a gross great great great [[gross]], i.e. 12 * 144 * 144 * 144 * 144 = 5159780352. There ar...')
- 19:22, 17 Dec 2004 Hadal deleted Great great great great great gross (content was: '{{delete}}A ''geat great great great great gross''' is equal to a gross great great great great [[gross]], i.e. 12 * 144 * 144 * 144 * 144 * 144 = 74...')
- 19:22, 17 Dec 2004 Hadal deleted Great great great great great great great gross (content was: 'A ''geat great great great great great great gross''' is equal to a gross great great great great great great [[gross]], i.e. 12 * 144 * 144 * 144 * 1...')
- 19:22, 17 Dec 2004 Hadal deleted Great great great great great great great great gross (content was: 'A ''geat great great great great great great great gross''' is equal to a gross great great great great great great [[gross]], i.e. 12 * 144 * 144 * 1...')
- 19:21, 17 Dec 2004 MacGyverMagic deleted Great great great great great great gross (content was: '{{delete}}A ''geat great great great great great gross''' is equal to a gross great great great great great [[gross]], i.e. 12 * 144 * 144 * 144 * 1...')
- 19:18, 17 Dec 2004 Rmhermen deleted Jack Port (content was: '{{delete}}Jack Port is a gentleman. He is in the school chorus. He is a very smart boy and has many interests. One of them is World War 2. He al...')
- 19:17, 17 Dec 2004 Rmhermen deleted Geology A-level (content was: '#REDIRECT [[Geology A level]]')
- 19:17, 17 Dec 2004 Rmhermen deleted Geology A level
- 19:16, 17 Dec 2004 Rmhermen deleted Carl Tritt (content was: 'Carl Tritt is a small kid. He likes to annoy people by doing wierd things. He likes to play Star Wars Galaxies on the computer. He also likes baked...')
- 19:14, 17 Dec 2004 Rmhermen deleted Community site (content was: '{{delete}}Some examples of community sites (albeit commercial oriented) are '''ivillage.com and aarp.com'''.')
- 19:13, 17 Dec 2004 Rmhermen deleted Calvert family
- 18:53, 17 Dec 2004 Deb deleted Anuswuss (content was: 'a small territory in the southwest regime of spain and he loves the cock')
- 18:53, 17 Dec 2004 Deb deleted MarkusTest (content was: '{{db|Nonsense redirect}}#redirect [[w:Metasyntactic variable#Foo.2C Bar and Baz]]')
- 18:52, 17 Dec 2004 Deb deleted Skate unit (content was: '{{nonsense}}skate unit is cool')
- 18:52, 17 Dec 2004 Deb deleted Adam McCarthy (content was: 'Amazing Quarterback, Picks up all the fine Hoes!')
- 18:51, 17 Dec 2004 Deb deleted Al Bayan (newspaper) (content was: '{{nonsense}}tytyth')
- 18:51, 17 Dec 2004 Deb deleted Johnothon swift (content was: 'He a nice guy, a sensitive guy. he is a badass')
- 18:50, 17 Dec 2004 Deb deleted Louis conway (content was: 'Louis Conway was killed by falling cats on September much missed by all his chums')
- 18:49, 17 Dec 2004 Deb deleted Chaotic systems (content was: '{{delete}}ftgjhfdj')
- 18:46, 17 Dec 2004 UtherSRG deleted Sumatran Orangutan (content was: '#REDIRECT [[Orangutan]]')
- 18:46, 17 Dec 2004 UtherSRG deleted Bornean Orangutan (content was: '#REDIRECT [[Orangutan]]')
- 18:45, 17 Dec 2004 SimonP deleted Infestdead (listed on VfD, no objections to deletion)
- 18:44, 17 Dec 2004 SimonP deleted John Redmond Home Rule (listed on VfD, no objections to deletion)
- 18:44, 17 Dec 2004 SimonP deleted Andrew O'Neill DMP (listed on VfD, no objections to deletion)
- 18:43, 17 Dec 2004 SimonP deleted Vintage shirts (listed on VfD, votes 4-1 in favour of deletion)
- 18:43, 17 Dec 2004 SimonP deleted Kevin Glancy (listed on VfD, no objections to deletion)
- 18:37, 17 Dec 2004 SimonP deleted Super nerd (content was: '#redirect [[supernerd]]')
- 18:37, 17 Dec 2004 SimonP deleted Supernerd (listed on VfD, votes 16-2 in favour of deletion)
- 18:35, 17 Dec 2004 SimonP deleted Zacker (listed on VfD, no objections to deletion)
- 18:32, 17 Dec 2004 SimonP deleted Kade (listed on VfD, no objections to deletion)
- 18:31, 17 Dec 2004 SimonP deleted BenWing (listed on VfD, votes 5-1 in favour of deletion)
- 18:29, 17 Dec 2004 SimonP deleted Alfie Sykes (listed on VfD, no objections to deletion)
- 18:27, 17 Dec 2004 SimonP deleted Boojitsu (listed on VfD, votes 6-1 in favour of deletion)
- 18:24, 17 Dec 2004 SimonP deleted Martian Law (listed on VfD, votes 13-1 in favour of deletion)
- 18:23, 17 Dec 2004 SimonP deleted 911 the musical (listed on VfD, votes 11-1 in favour of deletion)
- 18:22, 17 Dec 2004 SimonP deleted Phaistos Networks (listed on VfD, no objections to deletion)
- 18:22, 17 Dec 2004 Deb deleted Nathen toft (content was: 'nathen is a hot sexy monster')
- 18:22, 17 Dec 2004 SimonP deleted Punk shirts (listed on VfD, no objections to deletion)
- 18:21, 17 Dec 2004 SimonP deleted Actualism Art Movement (listed on VfD, votes 5-1 in favour of deletion)
- 18:19, 17 Dec 2004 MacGyverMagic deleted I Wanna Live (copyrighted song lyrics)
- 18:18, 17 Dec 2004 SimonP deleted WikiGremlin (listed on VfD, votes 4-1 in favour of deletion)
- 18:17, 17 Dec 2004 MacGyverMagic deleted Desjardins Trust Inc. (content was: 'Desjardins Trust Inc. is a Quebec based trust company.{{deletebecause|Entirely lacking content.}}')
- 18:16, 17 Dec 2004 MacGyverMagic deleted Clarica Trust Company (content was: 'Clarica Trust Company is a unit of Waterloo ON based insurer Clarica.{{deletebecause|No content}}')
- 18:15, 17 Dec 2004 MacGyverMagic deleted Campion High School (content was: '{{db|no content}}My Dad attended Campion High School in Prarie du Chien.I am looking for alumni to correspond with.Bob Amann')
- 18:13, 17 Dec 2004 MacGyverMagic deleted Chase classen (content was: '{{delete}}Chase Classen== Headline text ==')
- 18:12, 17 Dec 2004 Elf deleted Champage gene (misspelling)
- 18:09, 17 Dec 2004 MacGyverMagic deleted "Elizabeth Robins" (accidently mistitled, creator corrected by creating correct page.)
- 18:08, 17 Dec 2004 MacGyverMagic deleted Talk:"Elizabeth Robins" (accidently mistitled, creator corrected by creating correct page. content was: 'mistakenly made this page with quotes in the title, correct page is [[Elizabeth Robins]]. added delete tag to flag for deletion.')
- 18:01, 17 Dec 2004 Academic Challenger deleted Zakaria (content was: '{{delete}}He loves to play with himself all day long. Not only that, he is good at fondling donkeys.')
- 17:59, 17 Dec 2004 Hadal deleted The weather in London (content was: 'It is usaully wet{{deletebecause|Meaningless stub that blocks the 'link to a nonexisting page' on [[Wikipedia:How to edit a page#Links and URLs]]}}')
- 17:57, 17 Dec 2004 Meelar deleted Icy hot stuntaz (content was: 'Internet fad of a group of three homosexual young men.')
- 17:56, 17 Dec 2004 TUF-KAT deleted Ebonics: The True Language of Black Folks (content was: '{{deletebecause|it's currently empty, and the last version was just nonsense}}')
- 17:56, 17 Dec 2004 Meelar deleted Talk:Ebonics: The True Language of Black Folks (content was: 'okra')
- 17:55, 17 Dec 2004 Deb deleted Punta del Este (content was: 'Punta del Este is the tip of Teagan Kane's Wang.')
- 17:54, 17 Dec 2004 Deb deleted Fintan's Grave (content was: '{{delete}}Where Fintan, the Salmon of Knowledge, hung out for a year.')
- 17:54, 17 Dec 2004 Deb deleted S.M.S (content was: '{{delete}}'''S.M.S''' means:it's when sang MISS sia.')
- 17:53, 17 Dec 2004 Deb deleted Ranajit Guha (content was: 'Historigraphy')
- 17:53, 17 Dec 2004 Meelar deleted USGL (content was: 'USGL (You Ess Jee Ell):''Stop being such a USGL!''Acronym. ''Under Seige Girl Lover''.')
- 17:53, 17 Dec 2004 Deb deleted Rafey (content was: 'Rafey (RawFay)''That guy is SUCH a Rafey!''See the definition of [[USGL]].')
- 17:53, 17 Dec 2004 Deb deleted Zang Tumb Tumb (content was: 'ZANG TUMB TUMB')
- 17:52, 17 Dec 2004 Deb deleted Sam Hupp (content was: ''''Sam Hupp''' -''noun''')
- 17:52, 17 Dec 2004 Deb deleted Mark Lewis (content was: 'he stinks of pie cos he is a pie man')
- 17:52, 17 Dec 2004 Deb deleted Gomi (content was: 'i pixie stick')
- 17:52, 17 Dec 2004 Deb deleted Panther-Wotan line (content was: '[[Image:Example.jpg]][[Image:Example.jpg]]')
- 17:51, 17 Dec 2004 Deb deleted Telophone communications (content was: 'used to talk')
- 17:48, 17 Dec 2004 Hadal deleted Jorden (content was: '{{delete}}jorden was a great and good looking man that all the ladies love and they are all his bitches :P jk ladie i love you all :) damn that man ...')
- 17:47, 17 Dec 2004 Hadal deleted Mitch (content was: 'mitch was a man gurl i dont quite know what he was but people discribe him as a dirty little monkey and loves to fuck other me *elderly men* man he w...')
- 17:41, 17 Dec 2004 Hadal deleted Mitch (content was: 'mitch was a man gurl i dont quite know what he was but people discribe him as a dirty little monkey and loves to fuck other me *elderly men* man he w...')
- 17:41, 17 Dec 2004 Hadal deleted Mitch (content was: 'mitch was the best playa of all time')
- 17:39, 17 Dec 2004 Adam Bishop deleted Mitch (content was: 'mtich was a man gurl i dont quite know what he was but people discribe him as a dirty little monkey and loves to fuck other me *elderly men* man he w...')
- 17:36, 17 Dec 2004 Hadal deleted Paul Nielsen (content was: 'is the man. no he just sucks.')
- 17:24, 17 Dec 2004 Everyking deleted Sarah Gadon (apparently stolen from imdb)
- 17:16, 17 Dec 2004 Quadell deleted Image:Washington, D.C. Tidal Basin cherry trees thumbnail.jpg (Scaled-down duplicate image)
- 17:16, 17 Dec 2004 Quadell deleted Image:Washington, D.C. Tidal Basin cherry trees 252.jpg (Scaled-down duplicate image)
- 17:15, 17 Dec 2004 Quadell deleted Image:Washer.250pix.jpg (Scaled-down duplicate image)
- 17:13, 17 Dec 2004 Quadell deleted Image:Warped.galaxy.arp.300pix.jpg (Scaled-down duplicate image)
- 17:11, 17 Dec 2004 Ta bu shi da yu deleted Wikipedia talk:Requests for comment/Netoholic 2 (removed also. )
- 17:05, 17 Dec 2004 Hadal deleted Talk:Mantua (no history - content was: '== Headline text ==== Headline text ==')
- 17:05, 17 Dec 2004 Quadell deleted Image:Wangdue Phodrang Dzong small.jpg (Scaled-down duplicate image)
- 17:04, 17 Dec 2004 Quadell deleted Image:Wallpaperreflectionkey.gif (Scaled-down duplicate image)
- 16:58, 17 Dec 2004 Niteowlneils deleted Tactical aircraft (content was: 'Aircraft Carrier Aircraft{{nonsense}}')
- 16:58, 17 Dec 2004 Niteowlneils deleted The Evening News (content was: 'Money Changers{{delete}}')
- 16:57, 17 Dec 2004 Niteowlneils deleted Iliocecal valve (content was: '{{delete}}one two three')
- 16:57, 17 Dec 2004 Niteowlneils deleted Adam Mathes (content was: 'A talentless hack{{delete}}')
- 16:56, 17 Dec 2004 Quadell deleted Image:Wagons 325.jpg (Scaled-down duplicate image)
- 16:56, 17 Dec 2004 Niteowlneils deleted Category:Grenadian music (content was: '{{deletebecause|duplicate category: [[:Category:Grenadan music]]}}')
- 16:56, 17 Dec 2004 Niteowlneils deleted Category:Grenadian sport (content was: '{{deletebecause|duplicate category: [[:Category:Grenadan sport]]}}')
- 16:55, 17 Dec 2004 Quadell deleted Image:WWEstatue 350.jpg (Scaled-down duplicate image)
- 16:55, 17 Dec 2004 Quadell deleted Image:WWEplaque 325.jpg (Scaled-down duplicate image)
- 16:55, 17 Dec 2004 Niteowlneils deleted Category:Bermudian people (content was: '{{deletebecause|duplicate category: [[:Category:Bermudan people]]}}')
- 16:55, 17 Dec 2004 Niteowlneils deleted Category:Bermudian football (content was: '{{deletebecause|duplicate category: [[:Category:Bermudan football]]}}')
- 16:55, 17 Dec 2004 Niteowlneils deleted Category:Bermudian footballers (content was: '{{deletebecause|duplicate category: [[:Category:Bermudan footballers]]}}')
- 16:55, 17 Dec 2004 Niteowlneils deleted Category:Bermudian sport (content was: '{{deletebecause|duplicate category: [[:Category:Bermudan sport]]}}')
- 16:55, 17 Dec 2004 Niteowlneils deleted Category:Grenadian culture (content was: '{{deletebecause|duplicate category: [[:Category:Grenadan culture]]}}')
- 16:51, 17 Dec 2004 Quadell deleted Image:Vulcan.xh558.sideelev.250pix.jpg (Scaled-down duplicate image)
- 16:51, 17 Dec 2004 Quadell deleted Image:Vulcan.xh558.banked.250pix.jpg (Scaled-down duplicate image)
- 16:51, 17 Dec 2004 Quadell deleted Image:Vulcan.xh558.abingdon.250pix.jpg (Scaled-down duplicate image)
- 16:51, 17 Dec 2004 Quadell deleted Image:Vulcan.planview.300pix.jpg (Scaled-down duplicate image)
- 16:51, 17 Dec 2004 Quadell deleted Image:Vulcan.filton.arp.300pix.jpg (Scaled-down duplicate image)
- 16:50, 17 Dec 2004 Hadal deleted Citizens Bank of Canada (content was: '[[Category: Banks of Canada]]')
- 16:49, 17 Dec 2004 Hadal deleted Co-operative Trust Company of Canada (content was: '[[Category: Banks of Canada]]')
- 16:49, 17 Dec 2004 Hadal deleted Bank West (content was: '{{db|a bank with no text}}[[Category: Banks of Canada]]')
- 16:49, 17 Dec 2004 Hadal deleted Community Trust Company (content was: '[[Category: Banks of Canada]]')
- 16:49, 17 Dec 2004 Hadal deleted Concentra Trust (content was: '[[Category: Banks of Canada]]')
- 16:49, 17 Dec 2004 Hadal deleted Computershare Trust Company of Canada (content was: '[[Category: Banks of Canada]]')
- 16:48, 17 Dec 2004 Hadal deleted BCPBank Canada (content was: '[[Category: Banks of Canada]]{{db|no text}}')
- 16:48, 17 Dec 2004 Mustafaa deleted Bushee (content was: 'big big volcano so big it almost kill god, jesus just barely pulled him out of way justin tyme. whew that was close said god.{{nonsense}}')
- 16:44, 17 Dec 2004 Quadell deleted Image:Volkswagen.beetle.new.300pix.jpg (Scaled-down duplicate image)
- 16:44, 17 Dec 2004 Quadell deleted Image:Vlt.kueyen.arp.300pix.jpg (Scaled-down duplicate image)
- 16:43, 17 Dec 2004 Quadell deleted Image:Vixen Geyser at Norris Geyser Basin in Yellowstone-300px.JPG (Scaled-down duplicate image)
- 16:43, 17 Dec 2004 Quadell deleted Image:Viscount.arp.300pix.jpg (Scaled-down duplicate image)
- 16:42, 17 Dec 2004 Quadell deleted Image:Visby waterfront-250px.jpg (Scaled-down duplicate image)
- 16:42, 17 Dec 2004 Niteowlneils deleted Category:Bermudian culture (content was: '{{deletebecause|duplicate category: [[:Category:Bermudan culture]]}}')
- 16:42, 17 Dec 2004 Quadell deleted Image:Virgo.arp.300pix.jpg (Scaled-down duplicate image)
- 16:35, 17 Dec 2004 Quadell deleted Image:View over Stockholm medium.jpg (Scaled-down duplicate image)
- 16:33, 17 Dec 2004 DropDeadGorgias deleted Carla Atwi (delete nonsense)
- 16:33, 17 Dec 2004 DropDeadGorgias deleted Apostolic (content was: '{{delete}}Shiloh Apostolic Temple, Inc.Founder: Bishop Robert Oliver Doub, Jr.August 22, 1948')
- 16:28, 17 Dec 2004 Niteowlneils deleted The Fox and Hounds (content was: '{{deletebecause|There are hundreds of pubs with this name, and the one-line ad... oops... article isn't clear which one it's recommending!}}A good pu...')
- 16:28, 17 Dec 2004 Niteowlneils deleted Roger Irrelevant (content was: 'Oh this is so irrelevant{{del}}')
- 16:26, 17 Dec 2004 Niteowlneils deleted WarthogsUNLTD (content was: '{{delete}}squort!')
- 16:26, 17 Dec 2004 Ta bu shi da yu deleted Wikipedia:Requests for comment/Netoholic 2 (Deleting RFC as it's not eligible. It would also be unfair to keep this around, even if Netoholic's talk page can get wiped a bit too quickly)
- 16:25, 17 Dec 2004 Niteowlneils deleted Genesio Morlacci (content was: '{{delete}}hello')
- 16:25, 17 Dec 2004 Niteowlneils deleted Image:Kardashevprojectionlowquality.jpg (unused possible copyvio)
- 16:23, 17 Dec 2004 Niteowlneils deleted Chris megaw (content was: '{{delete}}chris megaw sucks')
- 16:23, 17 Dec 2004 Niteowlneils deleted Talk:Chris megaw (content was: 'I believe that this definition should in fact be kept and saved as a treasure in Wikipedia. It is absolutely the truth. The rare breed of camel know...')
- 16:16, 17 Dec 2004 Mirv deleted Bitch Slammer (content was: 'INGREDIENTS FOR BITCH SLAMMER')
- 15:47, 17 Dec 2004 Ed g2s deleted Image:Wrightflyer.jpg (larger version on commons)
- 15:46, 17 Dec 2004 Thue deleted De Morgan's Law (content was: '{{delete}}De Morgan was a homosexual scientist who created scientific theories.')
- 15:45, 17 Dec 2004 Deb deleted Partial quote (content was: 'a partial quote is a very brief quote said by someone and paraphrased.')
- 15:44, 17 Dec 2004 Hadal deleted Topher (content was: '{{delete}}HE RUBS THE CHAPSTICK ON HIS LIPS, OR ELSE HE GETS THE HOSE AGAIN. NOW DO IT!!!!')
- 15:44, 17 Dec 2004 Thue deleted Andrew McCoy (content was: '{{delete}}Andrew McCoy kicks ass all of the time. His hobbies include kicking ass in the morning and takining names in the evening. He also enjoys t...')
- 15:43, 17 Dec 2004 Thue deleted Talk:Andrew McCoy (content was: 'I believe this boy has a strong potential and should be given lots of money.')
- 15:43, 17 Dec 2004 Thue deleted Return of the Pink Panther (content was: 'One of the funniest pictures ever made{{delete}}')
- 15:42, 17 Dec 2004 Thue deleted Mike Brooks (content was: '{{del}}The Most Awsomest Guy Ever...Rawr!WEWT!')
- 15:40, 17 Dec 2004 Duncharris deleted Paul Bouche (third time in as many minutes...)
- 15:37, 17 Dec 2004 Hadal deleted Talk:Salmonidae (no history - content was: 'this fish i nice')
- 15:33, 17 Dec 2004 Duncharris deleted Paul Bouche (vfded previously)
- 15:31, 17 Dec 2004 Stevenj deleted Image:Foodicon.jpg (deleted Cheung1303 copyvio image on sight (see [[Wikipedia:Requests for comment/Cheung1303]]))
- 15:30, 17 Dec 2004 Duncharris deleted Paul Bouche (previously vfded)
- 15:16, 17 Dec 2004 Hadal deleted Cupix (content was: 'cupix - rockband - from zurich')
- 15:12, 17 Dec 2004 Hadal deleted Berenguer de Cruïlles (content was: 'Primer presidente de Cataluña')
- 15:09, 17 Dec 2004 Thue deleted Trisomy 13 syndrom (content was: 'thjisis bdsawg')
- 15:09, 17 Dec 2004 Thue deleted Pattern 14 Rifle (content was: 'P14 rifle')
- 15:08, 17 Dec 2004 Thue deleted London in shakespeare time (content was: 'London in shakepeares time will make yo moma shake her tell feather and like a polaroid picture.')
- 15:07, 17 Dec 2004 Thue deleted Adwedfad (content before blanking was: 'A more complex version of Asdf, using the left hand to type it')
- 15:06, 17 Dec 2004 Thue deleted Every Man in His Humour (content was: 'he was gay')
- 14:59, 17 Dec 2004 Thue deleted Image:Raaf.roulettes.250pix.jpg (Thumb of [[:Image:Raaf.roulettes.750pix.jpg]])
- 14:59, 17 Dec 2004 Mustafaa deleted List of TV channels in India (content was: 'sony tv channel')
- 14:47, 17 Dec 2004 Thue deleted Shaw-Fujikawa (content was: 'Penis anal sex.{{speedy}}')
- 14:47, 17 Dec 2004 Thue deleted Talk:Amos Farquhar (nonsense, with a few "don't delete"s thrown in)
- 14:41, 17 Dec 2004 Thue deleted Talk:River slaney (talk page of deleted article, no important content)
- 14:40, 17 Dec 2004 Thue deleted Leposavic (content was: 'leposavic{{delete}}')
- 14:40, 17 Dec 2004 Thue deleted River slaney (Content pasted to [[River Slaney]] by author before blanking.)
- 14:39, 17 Dec 2004 Thue deleted Kapal (content was: 'He is the no-feature.This is becuase he is the only person to go to ampleforth college and have everyone to hate him.People think he should leave th...')
- 14:25, 17 Dec 2004 Hadal deleted Categ4635435 5t76567q (content was: 'mf54544444444444444444444 aiojfs;oia GO AWAY!!!kaslfj 9q3048e09 3w09r8wpi8rp90w809 e5w4e90 GO AWAY!!! soi;rjjjj09 43u09fguw09k 0,8rwtu')
- 14:17, 17 Dec 2004 Thue deleted Regina von Sachsen-Meiningen (content was: 'she is an aristocrat.')
- 14:16, 17 Dec 2004 MacGyverMagic deleted Josh Brown (hoax)
- 14:15, 17 Dec 2004 MacGyverMagic deleted Boy's Own Paper (content was: 'there is a boy who went in the bathroom what did he do')
- 14:15, 17 Dec 2004 Mirv deleted List of Good Jews (content was: ' {{deletebecause|it's both silly and offensive}} Mel Brooks[[Category:Jews]][[Category:Lists of Jews|Good Jews]]')
- 14:11, 17 Dec 2004 MacGyverMagic deleted List of Good Jews (content was: 'me[[Category:Jews]]')
- 14:05, 17 Dec 2004 MacGyverMagic deleted Talk:Mr Shell (related article already deleted)
- 14:05, 17 Dec 2004 MacGyverMagic deleted Celebration of the Lizard (content was: 'hfdeuwibfuweonbvuor')
- 14:04, 17 Dec 2004 MacGyverMagic deleted Mr Shell (content was: 'Mr shell is defined as an altruistic malignant little dwarf who cant find his ass with his entire class of 9th 10th and yes of course the mighty 11th...')
- 14:02, 17 Dec 2004 Thue deleted Katetine (content was: 'Queen of the toilet water born 1235 died 1345')
- 14:01, 17 Dec 2004 Thue deleted Louis Conway (content was: 'Lous Conway was a wondeful mathematician the end')
- 14:01, 17 Dec 2004 MacGyverMagic deleted Goldberg scale (content was: 'The Goldberg scale is retarted.')
- 14:00, 17 Dec 2004 MacGyverMagic deleted Hegemony and Socialist Strategy (content was: 'Hegemony and Socialist Strategy')
- 13:57, 17 Dec 2004 MacGyverMagic deleted Hen teaser (content was: 'What is a Hen Teaser?')
- 13:56, 17 Dec 2004 MacGyverMagic deleted Niko pirosmanashvili (content before blanking was: '#REDIRECT [[Niko Pirosmanashvili]]' (not needed))
- 13:55, 17 Dec 2004 MacGyverMagic deleted Essence of Decision (content was: '<nowiki>Insert non-formatted text here</nowiki>== Headline text ==[[Image:Example.jpg]][[Link title]][[Link title]][[Link title]][http://www.example...')
- 13:52, 17 Dec 2004 MacGyverMagic deleted Cupix (content was: 'cupix aus zürich spielt rockmal sehr direkt,dann wieder verspieltmal etwas hart,dann funkig und zartmanchmal brüllend - ohren füllendoder eher r...' (tells about the different ways the band plays music -soft loud etc. and hwo they entrance the audience))
- 13:44, 17 Dec 2004 MacGyverMagic deleted Grub haigh (content was: 'A great, big, BUM.')
- 13:43, 17 Dec 2004 MacGyverMagic deleted Mack 10 (content was: 'mack 10 is friends with Ice Cube')
- 13:40, 17 Dec 2004 MacGyverMagic deleted SpeedTree (content was: 'ssss')
- 13:35, 17 Dec 2004 MacGyverMagic deleted Priceless (content was: 'hello what a load of bollocks')
- 13:31, 17 Dec 2004 Ahoerstemeier deleted Harrow rail crash (content was: 'Harrow train crash')
- 13:30, 17 Dec 2004 MacGyverMagic deleted Cryotrap (content was: '{{del}} KELSEY IS A PIMP== Headline text ==------[[User:204.180.37.201|204.180.37.201]] 13:25, 17 Dec 2004 (UTC)<nowiki>Insert non-formatted text h...')
- 13:25, 17 Dec 2004 Magnus Manske deleted Image:Jhuseal..bmp (Double of [[:Image:Jhuseal.bmp]] (note the double dot here!))
- 13:24, 17 Dec 2004 MacGyverMagic deleted The Last in Line (content was: '1. We rock 2. The last in line 3. Breathless 4. I speed at night 5. One night in the city 6. Evil eyes 7. Mystery 8...deleted under criterium 4 for speedy deletion.)
- 13:16, 17 Dec 2004 Thue deleted Moscha (vanity/test page in german)
- 13:16, 17 Dec 2004 MacGyverMagic deleted Coneheads (content was: 'ouiuo[[Link title]]iyflui[[Media:Example.ogg]]ilui;iu;bjkb iput798/.ot78. 789')
- 13:15, 17 Dec 2004 MacGyverMagic deleted Qunu (content was: 'Qunu tastes yummy')
- 13:11, 17 Dec 2004 MacGyverMagic deleted Inner Circle (content was: 'Bad boys, bad boysWhatcha gonna do, whatcha gonna doWhen they come for you')
- 13:07, 17 Dec 2004 MacGyverMagic deleted Inner Circle (content was: 'bad boys what you gonna do?')
- 13:07, 17 Dec 2004 MacGyverMagic deleted Practicando (content was: 'www.visionsystems.com.mx')
- 13:02, 17 Dec 2004 MacGyverMagic deleted Mungled (content was: 'Mungled - To mash together, to cobble, the after effect of mungling.' dic def)
- 12:56, 17 Dec 2004 Zoney deleted Avoca (village), Wicklow, Ireland (Unrequired redirect. content was: '#REDIRECT [[Avoca]]')
- 12:56, 17 Dec 2004 Zoney restored "Avoca"
- 12:55, 17 Dec 2004 Zoney deleted Avoca (Delete in preparation for merge. content was: '#redirect [[Avoca (village), Wicklow, Ireland]]')
- 12:52, 17 Dec 2004 Ta bu shi da yu deleted Template:Dubious2 (No need for it. Got original author to use {{subst:dubious}})
- 12:49, 17 Dec 2004 Geogre deleted Quotations about Shakespeare (Otiose, result of a page move, no links: content was: '#REDIRECT [[Timeline of Shakespeare criticism]]')
- 12:42, 17 Dec 2004 Danny deleted Jamie Seager (content was: 'Fuck FuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckFuckF...')
- 12:35, 17 Dec 2004 Jnc deleted Joseph Jacinto "Jo" Mora (pr request, redir, non-existent target)
- 12:33, 17 Dec 2004 Jnc deleted Depot island (pr request, redir, non-existent target)
- 12:32, 17 Dec 2004 ALoan restored "Iranian_Revolution"
- 11:50, 17 Dec 2004 Ahoerstemeier deleted Persian dance (content was: '<nowiki>Insert non-formatted text here</nowiki>[[Media:Example.ogg]]<math>Insert formula here</math>'''Bold text'''''Italic text''[http://www.example....')
- 11:41, 17 Dec 2004 Mustafaa deleted The Historical Illuminatus Chronicles (content was: 'the illumiantes was a comic strip with bad tits[[Image:Example.jpg]][[Image:Example.jpg]]------[[User:217.84.85.191|217.84.85.191]] 10:57, 17 Dec 20...')
- 11:38, 17 Dec 2004 Mustafaa deleted Mark lewis (content was: '{{delete}}He is a rare breed of species he is terribly overweight and enjoys food,expecially pies')
- 11:33, 17 Dec 2004 MacGyverMagic deleted Basis points (content was: 'One hundredth of a share')
- 11:33, 17 Dec 2004 Ahoerstemeier deleted Pie Eaters (content was: 'There is a rare breed of people calle the pie eaters one of them is called mark lewis who eats his victims.')
- 11:31, 17 Dec 2004 Ahoerstemeier deleted M1 motorway (Ireland) (content was: 'Delete this')
- 11:26, 17 Dec 2004 Ahoerstemeier deleted Unfair game (content was no contents: '{{stub}} [[Category:Unfair games]]')
- 11:21, 17 Dec 2004 MacGyverMagic deleted 1900 in politics (content was: 'tergdhdgh')
- 11:12, 17 Dec 2004 MacGyverMagic deleted Turnabout Intruder (content was: '{{deleteagain}}[[Category:Star Trek: TOS episodes]]A mad scientist tries to take control of Enterprise by switching bodies with Captain Kirk.' was recreated after earlier deletion)
- 11:10, 17 Dec 2004 MacGyverMagic deleted Child beauty contest (content was: '{{delete}}Company's Act Chapter 486 Laws of Kenya')
- 11:04, 17 Dec 2004 MacGyverMagic deleted God and the universe and those horrible screaming monkeys (content was: '{{deleteagain}}Probably a reference to [[The Hitchhiker's Guide to the Galaxy]], which has a rather glib view about life and universe in general.')
- 11:03, 17 Dec 2004 MacGyverMagic deleted Higher being (content was: '{{db|A can of worm, singular? Yowch. Scary big worm.}}This is a can of worm someone else can edit.As used in reference to [[fafblog]]. Medium Lobs...' refers to prank article already deleted)
- 11:00, 17 Dec 2004 MacGyverMagic deleted Medium Lobster (content was: '{{db|Yes, that makes perfect sense. Or maybe not}}In reference to [[fafblog]], medium lobster is a higher being that appears to those confined in thr...' (patent nonsense))
- 10:58, 17 Dec 2004 MacGyverMagic deleted Nederlands verzet tegen duitsland (content was: '{{deletebecause|Non-English. (+personal vanity?)}}hallo mijn naam is houten klaas en ik heb een boggel tof he?verder ben ik zwaar mongolisch en ik ...'(patent nonsense))
- 10:57, 17 Dec 2004 MacGyverMagic deleted Image:Jk beatles george.jpg (exists on wiki commons)
- 10:54, 17 Dec 2004 MacGyverMagic deleted Image:IMG 0029.sized.jpg (uploaded by accident)
- 10:52, 17 Dec 2004 MacGyverMagic deleted Biblical theology (content was: '{{delete}}abraham')
- 10:51, 17 Dec 2004 MacGyverMagic deleted Talk:Gloucester (content was: '{{del}}should be capital of England' (no discussion in history))
- 10:50, 17 Dec 2004 MacGyverMagic deleted Talk:Clinton Nestle (content was: '{{del}}I LOVE THIS PLEASE KEEP IT ONIT PISSES ME OFFCLONTON' talk of deleted article)
- 10:49, 17 Dec 2004 MacGyverMagic deleted Talk:Homework (content was: '{{db|Revert move spree}}#REDIRECT [[Talk:Pantorno]]')
- 10:48, 17 Dec 2004 MacGyverMagic deleted WikiProject Latin alphabet (content was: '{{delete}}A B C D E F G H I J K L M N O P Q R S T U V W X Y Z')
- 10:47, 17 Dec 2004 MacGyverMagic deleted Wikipedia:Votes for deletion/765,000 volt power transmission line (content was: '{{delete}}Please delete, a deletion vote page for an article that's already been deleted, my mistake with acting too slowly. [[User:Solver|Solver]] ...' (was created after page was already deleted))
- 10:46, 17 Dec 2004 MacGyverMagic deleted Wikitition (duplicate of Six Degrees of Wikipedia)
- 10:45, 17 Dec 2004 MacGyverMagic deleted Talk:Wikitition (content was: 'Created by [[User:nrbelex]] while I'm at school.[[User:209.11.48.2|209.11.48.2]] 20:26, 15 Dec 2004 (UTC)I recently found that this is essentially...' (talk of dupe page))
- 10:43, 17 Dec 2004 MacGyverMagic deleted Talk:Pantorno (content was: '{{db|Rv move spree}}#REDIRECT [[Talk:Dsvfbbhrgfbhgftvvcb]]')
- 10:41, 17 Dec 2004 MacGyverMagic deleted Hollywood poker (deleted per VfD as advert)
- 10:39, 17 Dec 2004 Ambi deleted God and the universe and those horrible screaming monkeys (content was: 'This is likely to be in referrence to [[The Hitchhiker's Guide to the Galaxy]].')
- 10:37, 17 Dec 2004 MacGyverMagic deleted Secrets of the Neopian World (not an encyclopedia article, but a game guide.)
- 10:35, 17 Dec 2004 MacGyverMagic deleted Talk:Mouseman11713 (content was: '{{del}}#REDIRECT [[4boyz]]' - redirect to non-existing page)
- 10:33, 17 Dec 2004 MacGyverMagic deleted List of -uck words (consensus on VfD - similar list exists on Wiktionary)
- 10:20, 17 Dec 2004 Mirv deleted Gas fuel (content was: 'natural gas')
- 10:08, 17 Dec 2004 Ahoerstemeier deleted Scarlet sage (content was: 'Salvia splendens')
- 10:08, 17 Dec 2004 Ahoerstemeier deleted Federación Panameña de Fútbol (content was: 'news')
- 10:01, 17 Dec 2004 SWAdair deleted WIHAST (content was: '{{db|page consists entirely of a single external link}}[http://www.wihast.at]')
- 10:01, 17 Dec 2004 SWAdair deleted Tom Gehring (contents unrelated to title; unsalvagable)
- 10:00, 17 Dec 2004 SWAdair deleted The Scale of Dinosaurs (nonsense)
- 09:58, 17 Dec 2004 SWAdair deleted Texas a&m university system (content was: '{{deletebecause|To create a redirect to [[Texas A&M University System]].}}{{copyvio|url=http://tamusystem.tamu.edu/}}')
- 09:57, 17 Dec 2004 SWAdair deleted System Design Life Cycle (content was: 'vbvm{{delete}}')
- 09:57, 17 Dec 2004 SWAdair deleted Stuart schultz (nonsense tribute)
- 09:56, 17 Dec 2004 Charles Matthews deleted Asynchronous time-division multiplexing (content was: '{{delete}}errwerwwwwwwwwwwwwwww')
- 09:55, 17 Dec 2004 SWAdair deleted Reinvention of the wheel (content was: 'JAVA PROGRAMMING{{delete}}')
- 09:55, 17 Dec 2004 SWAdair deleted ProfNet (recreation of article that was deleted by VfD consensus)
- 09:54, 17 Dec 2004 SWAdair deleted Ploto (content was: '{{delete}}Jajaja')
- 09:54, 17 Dec 2004 SWAdair deleted Pablo mendigochea (content was: '{{delete}}Pablo mendigochea is a programmer working and living in californiaHe is known for his innovative software programs.His latest creation i...')
- 09:53, 17 Dec 2004 SWAdair deleted Markusa Bratus (content was: '{{delete}}He was a roman imperator, and the cousin of Caesar.')
- 09:53, 17 Dec 2004 SWAdair deleted Lysate (content was: '{{delete}}lysate')
- 09:53, 17 Dec 2004 SWAdair deleted Lisap (Page move vandalism spree)
- 09:50, 17 Dec 2004 SWAdair deleted Pantorno1 (Page move vandalism)
- 09:50, 17 Dec 2004 SWAdair deleted Talk:Pantorno1 (content was: '{{db|rv move spree}}#REDIRECT [[Lisap]]')
- 09:50, 17 Dec 2004 SWAdair deleted Talk:Dsvfbbhrgfbhgftvvcb (content was: '{{db|rv move spree}}#REDIRECT [[Pantorno1]]')
- 09:49, 17 Dec 2004 SWAdair deleted Howard Hughes will (content was: '{{delete}}hi')
- 09:48, 17 Dec 2004 SWAdair deleted Dsvfbbhrgfbhgftvvcb (content was: '#REDIRECT [[Homework]]')
- 09:48, 17 Dec 2004 SWAdair deleted Pantorno (Page move vandalism)
- 09:47, 17 Dec 2004 SWAdair deleted Homework (Page move vandalism -- Delete to replace with original article)
- 09:42, 17 Dec 2004 SWAdair deleted Handwritting (content was: '{{deletebecause|To create a redirect to [[Penmanship]].}}{{copyvio|url=http://www.connectschool.com/teacher/help_your_students/do_u_want_yr_students...')
- 09:41, 17 Dec 2004 SWAdair deleted Formal specification (content was: '{{delete}}'''''fdhgdf''''' d [[Media:hfg]] fg h')
- 09:41, 17 Dec 2004 SWAdair deleted Foreign currency (content was: 'The currency of a foreign nation. Sometimes gold is also included in this classification.{{db|no notable content}}')
- 09:40, 17 Dec 2004 SWAdair deleted Fintravel (content was: '{{db|it's just a commercial link}}== Fintravel ==Real company name is Fintravel Tour Operators Ltd. Wild and Free.Wild and Free is incoming tour o...')
- 09:40, 17 Dec 2004 SWAdair deleted Craig Brennan (content was: '{{delete}}== Status at workplace ==Chief Nerd')
- 09:39, 17 Dec 2004 SWAdair deleted Compact excavator (content was: '{{del}}Compact Excavators are just like ordinary excavatars, except while the normal excavatars are used for huge company type projects, comact excav...')
- 09:39, 17 Dec 2004 SWAdair deleted CRC Clan (copyvio vanity of online gaming clan -- no attempt at being an encyclopedia article)
- 09:35, 17 Dec 2004 MacGyverMagic deleted Kenny Blank (voice actress) (content was: '#REDIRECT [[Kenny Blank (voice actor)]]' incorrect title, all info at [[Kenny Blank]])
- 09:35, 17 Dec 2004 SWAdair deleted Burmeister, Paul (content was: '{{delete}}Paul Burmeister is a poopy head who lives in Massachusetts. He loves to play DDR.[[Image:Dancingpaul.jpg]]Artist's depiction')
- 09:35, 17 Dec 2004 SWAdair deleted Bethel African Methodis Episcopal Church (page name created by typo, article exists now at proper spelling)
- 09:35, 17 Dec 2004 David.Monniaux deleted Image:Gendarmes DSC00690.jpg (moved to commons)
- 09:34, 17 Dec 2004 SWAdair deleted Bernd Schartner (content was: '{{delete}}Eine Person, die Gerhard Kollinger jun. 6€80cent, und Faces of Death 1+2 schulded')
- 09:33, 17 Dec 2004 SWAdair deleted Bankers Trust Building (content was: '{{del}}I Wisht that the twin Towers never come I feel really sorry for the people how had died in the bulidings it is very sad. At the time i wish i ...')
- 09:33, 17 Dec 2004 SWAdair deleted Bakken (content was: '{{delete}}bakken er en supertissetass.')
- 09:33, 17 Dec 2004 SWAdair deleted 4boyz (content was: '{{db|Move spree}}#REDIRECT [[Checkwork]]')
- 09:30, 17 Dec 2004 MacGyverMagic restored "Kenny_Blank"
- 09:28, 17 Dec 2004 MacGyverMagic deleted Kenny Blank (deleting to merge page histories - back soon)
- 09:15, 17 Dec 2004 Ahoerstemeier deleted Eastern highlands moist deciduous forests (content was: 'TEMPERATE DECIDUOUS FORESTS IN INDIA')
- 09:15, 17 Dec 2004 TUF-KAT deleted European Parliament election, 1979 (content was: 'European Parliament election, 1979')
- 09:13, 17 Dec 2004 Ahoerstemeier deleted Me and the Colonel (content was: 'hello')
- 09:12, 17 Dec 2004 Ahoerstemeier deleted Dumbya (content was: 'Pejorative name for George W. 'Dubya' Bush.')
- 09:11, 17 Dec 2004 SWAdair deleted Diggity dank (content was: '{{deleteagain}}American slang. Especially American Mid-West. Meaning very(diggity) good(dank)')
- 09:05, 17 Dec 2004 Mikkalai deleted "political theory" (wrong title. also there is [[Political science]])
- 09:02, 17 Dec 2004 Ahoerstemeier deleted Dumbya (content was: 'Pejorative name for George W. 'Dubya' Bush.')
- 09:01, 17 Dec 2004 Mikkalai deleted Genome soldiers (MG:S) (content was: 'in 1999, November, in Alaska, there was an under ground base gaurded by genome sodliers. They gaurded..... Metal Gear Rexdum dum dum!!')
- 08:57, 17 Dec 2004 Mikkalai deleted Hole in the Wall Gang Camp (content was: '{{del}}It is a camp that all earrings go to charity and is run by Paul Newman')
- 08:56, 17 Dec 2004 MacGyverMagic deleted Fatima alim (content was: 'Fatima Alim is currently a biomedical engineering student at the University of California-Irvine. She wishes to become a teacher upon graduation.{{db...' (vanity))
- 08:54, 17 Dec 2004 Ferkelparade deleted Sociability (content was: 'The ability to socialize')
- 08:54, 17 Dec 2004 Ferkelparade deleted Coletas (content was: 'He is Maya Bee')
- 08:54, 17 Dec 2004 Mikkalai deleted Literatura de cordel (content was: '{{delete}}Small poorly-printed books usually sold in streets of northwestern cities, read by lower classes inhabitants.')
- 08:51, 17 Dec 2004 Mikkalai deleted Wolfgang William Van Halen (content was: '{{deletebecause|Completely lacking content; predicate nominative only}}Wolfgang William Van Halen born on March 16, 1991 son of [[Edward Van Halen]]...')
- 08:50, 17 Dec 2004 MacGyverMagic deleted Maximilian Reiff (content before blanking by creator was 'Gerhard Kollinger')
- 08:47, 17 Dec 2004 Mikkalai deleted First order philosophy (content was: '{{deletebecause|Near nonsensical, incomplete statement}}First order PhilosophyFirst-order philosophical questions will be classification questions...')
- 08:44, 17 Dec 2004 Mikkalai deleted Tommy Cookson
- 08:34, 17 Dec 2004 Mikkalai deleted Chaz Bufe (content was: '{{del}}Chaz Bufe is an [[anarchist]] writer published by Chaz Bufe.')
- 08:34, 17 Dec 2004 Mikkalai deleted A level subjects
- 08:34, 17 Dec 2004 Markalexander100 deleted Talk:Shojo-ai (content was: '#REDIRECT [[Talk:Yuritemp]]')
- 08:29, 17 Dec 2004 Ahoerstemeier deleted Headspace gas chromatogeaphy (content was: 'Headspace')
- 08:28, 17 Dec 2004 Ahoerstemeier deleted Verb Second (content was: 'I am hungry--[[User:80.142.172.246|80.142.172.246]] 07:57, 17 Dec 2004 (UTC)')
- 08:28, 17 Dec 2004 Markalexander100 deleted Yuri (content was: '#REDIRECT [[Shojo-ai]]')
- 08:27, 17 Dec 2004 Dysprosia deleted Template:Stepistub (recreated - content was: '----For an alternative article please see {{memoryalpha}}.')
- 08:24, 17 Dec 2004 Markalexander100 deleted Shojo-ai (content was: '#REDIRECT [[Yuritemp]]')
- 08:24, 17 Dec 2004 Mikkalai deleted Tabitha conkleton (content was: '{{del}}tabitha conkleton is a 12 year old seventh grader at stillwater middle school. she just recently moved to stillwater from langston.')
- 08:23, 17 Dec 2004 Mikkalai deleted Peter J. King (content was: '{{del}}Peter J. King is a young genius of 57. He is shacked up with the great Cartesian philosopher Andrea Christofidou.He is always right when it ...')
- 08:16, 17 Dec 2004 Markalexander100 deleted Mouseman11713 (content was: '{{deletebecause|check user history}} ********REMINDER********no remindersmdl')
- 08:07, 17 Dec 2004 Markalexander100 deleted Checkwork (content was: '{{del}}WWW.WFSD.K12.NY.US')
- 08:07, 17 Dec 2004 Markalexander100 deleted Ayalew Mesfin (content was: '{{deletebecause|May well be made-up.}}Ayalew Mesfin is famous singer. His most known song is ' Anch nesh hiwote, wudua bablebete' = your are my lif...')
- 08:06, 17 Dec 2004 Markalexander100 deleted Clinton Nestle (patent nonsense)
- 08:05, 17 Dec 2004 Markalexander100 deleted China city (content was: '{{del}}Çhínèsê Çítíés:There are many Chinese cities, the largest consisting of Shanghai, Xian, and Tibet. There are also many more, like Beijing, t...')
- 08:05, 17 Dec 2004 Mikkalai deleted Uriz (content was: '{{delete}}Uriz is a norwegian gamer.He joined the clan [cue] a couple of months ago.He likes FPS games, like Counter Strike and Call of Duty.[cue]...')
- 08:05, 17 Dec 2004 Markalexander100 deleted Cherie (content was: '{{delete}}== External Links==*[http://cheriemusic.com/main.htm/ The Official Site]')
- 08:04, 17 Dec 2004 Markalexander100 deleted Finishing a wood (content was: '{{db|lack of context, bad title}}FINISHING WOOD WRITEN BY: R.NILES ST.ROSE'S HIGH G/TOWN GUYANA.THIS IS THE PAINTING,SMOOTHING,SANDING SQUARING O...')
- 08:03, 17 Dec 2004 Markalexander100 deleted Invista (patent nonsense)
- 08:01, 17 Dec 2004 Mikkalai deleted James J. Kilpatrick (little info. content was: 'An journalist that is known for his editorial columns.')
- 07:50, 17 Dec 2004 Mikkalai deleted Texas roadhouse (content was: 'Texas Roadhouse is a [[restruant]].{{stub}}')
- 07:45, 17 Dec 2004 Mikkalai deleted Seville Expo '92 (content before blanking was: '#REDIRECT [[Expo '92]]')
- 07:44, 17 Dec 2004 Mikkalai deleted Institute of Business Administration (content was: ''''Institute of Business Administration''' in [[Karachi]] was developed by the YS -aid fund programe.{{stub}}==External links==[http://www.iba.edu....')
- 07:43, 17 Dec 2004 Mikkalai deleted Mrs.coyne (content was: '<b>Mrs. Coyne</b>DELETED!')
- 07:42, 17 Dec 2004 Mikkalai deleted PhpBB/viewtopic.php (gibberish)
- 07:36, 17 Dec 2004 Dysprosia deleted Template:Stepistub (anti-wiki and spam - content was: '----Note: Please avoid expanding this article. Instead see {{memoryalpha}} for a more comprehensive version.')
- 07:25, 17 Dec 2004 Meelar deleted Gerhard kollinger (content was: 'A Student of the HBLA Leoben, Who is Wrestling World Champion. But he is a little bit silly and very obese')
- 07:22, 17 Dec 2004 Meelar deleted Diet of Hodge the cat (content was: 'Oysters.* '''See also:''' [[Wikipedia:Votes_for_deletion/Secrets_of_the_Neopian_World]]')
- 07:21, 17 Dec 2004 Mikkalai deleted Jaybirds (content was: 'Who recorded for The Woolworth budget label Embassy.--[[User:62.252.224.12|62.252.224.12]] 20:23, 16 Dec 2004 (UTC)')
- 07:20, 17 Dec 2004 Mikkalai deleted Dutcher (gibberish)
- 06:56, 17 Dec 2004 Mikkalai deleted Category:Chemical substances (= cat:Chemicals content was: 'A '''chemical substance''' is a chemical description of a particular type of [[matter]]. It may include [[chemical element]]s such [[metal]]s or [[no...')
- 06:48, 17 Dec 2004 Adam Bishop deleted "New York Yankees" (junk)
- 06:47, 17 Dec 2004 Adam Bishop deleted Statistical modeling (content was: 'Who are You? WHo am I?')
- 06:44, 17 Dec 2004 Meelar deleted Garrett hickey (content was: '{{delete}}A man of few words, born in 1984, by age 16 he had killed 4 bears with his own hands. He once lived with a young man by the name of Ares G...')
- 06:44, 17 Dec 2004 Meelar deleted Talk:Garrett hickey (content was: 'I can vouche for it dude, you cant keep Garrett Hickey down. trust me its true')
- 06:37, 17 Dec 2004 Mikkalai deleted Chemical substance (for move. content was: '#REDIRECT[[chemical compound]]')
- 06:32, 17 Dec 2004 Mikkalai deleted Kraig (babble)
- 06:05, 17 Dec 2004 Francs2000 deleted Arifwala (content was: 'ARIFWALA is very beautiful city')
- 06:03, 17 Dec 2004 Mikkalai deleted Hearts of Iron II (Unreleased game. content was: 'Hearts of Iron II is strategy computer game developed by Paradox Entertainment and the successor to Hearts of Iron. The game lets you play any country...')
- 05:55, 17 Dec 2004 Mikkalai deleted Inheritance anomaly (content was: 'A problem involving concurrency and inheritance where child classes end up modifying their parents quite a bit due to concurrency models.')
- 05:52, 17 Dec 2004 Francs2000 deleted Pilar Primo de Rivera (content was: '{{delete}}')
- 05:48, 17 Dec 2004 Neutrality deleted Seawall (content was: '#REDIRECT [[Sea wall]]' (for page move))
- 05:45, 17 Dec 2004 Adam Bishop deleted Kyle Orlando Massey (content was: '== External Links ==*[http://www.celebritykidz.com/kylemassey/ Kyle Massey's Official Site]')
- 05:41, 17 Dec 2004 Niteowlneils deleted Bultokatchi (content was: '{{delete}}')
- 05:39, 17 Dec 2004 Francs2000 deleted Zach the G (content was: '{{delete}}Nigga Gangsta who is Casey's Manager.')
- 05:39, 17 Dec 2004 Francs2000 deleted Beddie (content was: 'BEDDIE THE ONE AND ONLY TRUE GANGSTA, AND GUESS WAT, HE IS WHITE, AND HE LOVES CASEY')
- 05:37, 17 Dec 2004 Francs2000 deleted Katistrophik (nonsense)
- 05:34, 17 Dec 2004 Francs2000 deleted Derivation rules (content was: 'dsgdfdsfsg')
- 05:22, 17 Dec 2004 Francs2000 deleted Turnabout Intruder (content was: '{{delete}}<nowiki>#Redirect http://www.memory-alpha.org/en/index.php/Turnabout_Intruder</nowiki>')
- 05:18, 17 Dec 2004 Francs2000 deleted Matthew Silva (content was: '#REDIRECT [[Silva, Matthew]]')
- 05:18, 17 Dec 2004 Francs2000 deleted Silva, Matthew (content was: '{{delete}}'''Matthew Silva''', (mäah-th-êw-sil-väa),(born April 15, 1980 in Montreal) was crowned 'The World's Best Boyfriend in the World' from Sep...')
- 05:17, 17 Dec 2004 Francs2000 deleted ClassFactory (content was: '== Headline text ==<math>Insert formula here</math>')
- 05:08, 17 Dec 2004 Francs2000 deleted Sam calkin (content was: 'Hero to some future leader to all Samule Benjamim Calkin')
- 05:05, 17 Dec 2004 Francs2000 deleted Kyle Kalkman (content was: 'Kyle Kalkman is a high school student in Saginaw, Michigan.')
- 05:04, 17 Dec 2004 Francs2000 deleted Cameron Tindall (content was: 'Cameron Tindall loves to suck balls, man balls!')
- 05:04, 17 Dec 2004 Francs2000 deleted Gay elves (content was: 'Elves, especially the one named Leafenryn... Are gay.~Fin~')
- 04:54, 17 Dec 2004 Francs2000 deleted Garet Garrett (content was: 'sdfg')
- 04:47, 17 Dec 2004 Francs2000 deleted Bellyfeel (some 1984 related rubbish)
- 04:46, 17 Dec 2004 Francs2000 deleted Bellyfeel (content was: 'i dont get it')
- 04:45, 17 Dec 2004 Francs2000 deleted Growth strategies (content was: 'growth strategies')
- 04:42, 17 Dec 2004 Francs2000 deleted Weston wamp (non notable high school student)
- 04:28, 17 Dec 2004 Cool Hand Luke deleted Cool Hand Luke/Sandbox/pictures suppressed (content was: '#REDIRECT [[User:Cool Hand Luke/Sandbox/pictures suppressed]]')
- 04:21, 17 Dec 2004 WhisperToMe deleted Kenji (emperor) (Not correct redirect)
- 04:20, 17 Dec 2004 Neutrality deleted Mike Hlebasko (content was: 'He's Short!!!!')
- 04:16, 17 Dec 2004 DJ Clayworth deleted Bultokatchi (content was: 'The occurence when a splash of water hits the cheeks of your buttocks after a large feces hits hard the water in the toilet bowl.')
- 04:08, 17 Dec 2004 DJ Clayworth deleted Paul lauger (content was: 'Mr. Paul Lauger is a guy who lives in Humboldt. He was born in the early 50's. Also he has one wife and four children.')
- 04:00, 17 Dec 2004 Paul A restored "Christopher_Priest_(British)"
- 03:59, 17 Dec 2004 Paul A deleted Christopher Priest (British) (starting page merge to correct copy-and-paste move)
- 03:57, 17 Dec 2004 Rdsmith4 deleted Borden Chemical (content was: 'borden chemical')
- 03:54, 17 Dec 2004 Francs2000 deleted Peperone (nonsense, i'm getting a bit fed up of deleting this)
- 03:54, 17 Dec 2004 Rdsmith4 deleted Geography of the United States Appalachian Highlands (content was: '{{delete}}KG')
- 03:53, 17 Dec 2004 Rdsmith4 deleted Gamma Crucis (content was: 'Gamma Crucis (gacrux)Gamma is the northernmost star in the latin cross 'Crux' [krooks].')
- 03:48, 17 Dec 2004 Evercat deleted Velvet hammer (content was: '{{del}}Velvet Hammer')
- 03:47, 17 Dec 2004 Neutrality deleted Al wilson jr. ((hoax, no Google hits) content was: 'Alvin Raymond Wilson Jr.(1930- ) is a former American Politician, actor, director, and movie set designer. He ran for senator in the early eighties, and later for governor of illinois, he was the democratic nominee for both films. 9among his films included the critically aclaimed film "Kennedy's Ireland" for which he was on set design and movie production. Among some of his roles were in the earlier zoro movies. He is now retired and lives with his wife Emolyn Wilson in Martinez, Georgia U.S.A.')
- 03:44, 17 Dec 2004 Evercat deleted Jason c (content was: 'never date a guy cause their all jerks especially jason!!!!!')
- 03:42, 17 Dec 2004 Neutrality deleted Mouseman11713 (content was: ' ********REMINDER******** NO REMINDERS MDL')
- 03:40, 17 Dec 2004 Neutrality deleted SGHWR (content was: 'steam-gen·er·at·ing heav·y-wa·ter re·ac·tor noun nuclear reactor with water as coolant: a nuclear reactor that uses ordinary water as the coola...')
- 03:40, 17 Dec 2004 Neutrality deleted Ipsi chess tournament (Previously speedy deleted, see below for full text.)
- 03:40, 17 Dec 2004 Evercat deleted Jason c (content was: 'never date a guy their all jerks especially jason!!!!!!!')
- 03:31, 17 Dec 2004 Neutrality deleted Gary Wolf (content was: 'Author of ''Who Censored Roger Rabbit?'' and ''Who P-P-P Plugged Roger Rabbit?: A Hare-Raising Mystery.''')
- 03:31, 17 Dec 2004 Neutrality deleted Ipsi chess tournament (content was: 'The IPSI chess tournament was a chess tournament involving The Peperones inside the highly competitive IPSI school environment. Organized by Abel Seura, the 1994 edition was a bloody battlefield. After a cold wiped out Chalo's winning expectations, Otto was proclaimed winner of the Chess problems contest after Subirana performed a clever guess in his favor. While Otto's masterplay seemed an unstoppable juggernaut in the 5' 1v1 Chess competition, Siol unexpectedly defeated his ordes and was proclaimed the winner. The 1995 edition was overcrowded and after two days of intensive rivalry, Siol won again as a result of a wrong analysis.')
- 03:30, 17 Dec 2004 Francs2000 deleted Clambo (content was: '{{del}}Clambo - A nickname for one who is obese or has a huge case of bitchiness.')
- 03:30, 17 Dec 2004 Francs2000 deleted Wai Yan (content was: '{{del}}Wai Yan is a gurl that has a big rectal region.wai yan's boifreind is MR. PETERS N CHANG.')
- 03:26, 17 Dec 2004 Francs2000 deleted Peperone (nonsense)
- 03:24, 17 Dec 2004 Neutrality deleted David Eisenhower (content was: '{{del}}----sfsdf--[[User:68.126.10.103|68.126.10.103]] 03:22, 17 Dec 2004 (UTC)fsdfsdf<nowiki>Insert non-formatted text here</nowiki>sdfsdfsdfsdf[[M...')
- 03:22, 17 Dec 2004 WhisperToMe restored "Shuichiro_Ohishi"
- 03:22, 17 Dec 2004 Neutrality deleted Tyler campbell (content was: '{{del}}A facetious individual whose capacity for annoyance is unrivaled in all the world. He also sings poorly.')
- 03:20, 17 Dec 2004 Denni deleted Image:Eagle Nebula.jpg (unused duplicate)
- 03:19, 17 Dec 2004 WhisperToMe deleted Shuichiro Ohishi (content was: '#REDIRECT [[Shuichiro Oishi]]')
- 03:16, 17 Dec 2004 Neutrality deleted Randy Gardner (content was: 'In 1964 Randy Gardner broke the record for consecutive sleeplessness. He stayed awake for 11 days in a row without sleeping and made it into the Guinn...')
- 03:15, 17 Dec 2004 Niteowlneils deleted Nick Olsen (content was: '{{db|Moved vanity to user page}}#REDIRECT [[User:Olsenn]]')
- 03:14, 17 Dec 2004 Niteowlneils deleted Oliver Ryan Phillips (content was: '{{del}}[http://profiles.myspace.com/users/3357773 Oliver Ryan Phillips on Myspace]')
- 03:13, 17 Dec 2004 Niteowlneils deleted European American Education Association (content was: '{{del}}[[Link title]]== Headline text =='''Bold text'''<nowiki>Insert non-formatted text here</nowiki><math>Insert formula here</math>Helllo how ar...')
- 03:12, 17 Dec 2004 Neutrality deleted Tyler Campell (content was: '{{delete}}A facetious individual whose capacity for annoyance is unrivaled in all the world. He also sings poorly.')
- 03:12, 17 Dec 2004 Neutrality deleted Absolut Engine (content was: 'I am a heroI am a angel')
- 03:10, 17 Dec 2004 Neutrality deleted National Re-Employment Service (content was: 'ahoooooyyyy')
- 03:10, 17 Dec 2004 Niteowlneils deleted Bezunesh Bekele (content was: '{{del}} now')
- 03:08, 17 Dec 2004 Neutrality deleted Rhodesia(British South African Company) (content was: '{{del}}In 1895, the territory was formally named Rhodesia, after Cecil Rhodes, under the British South Africa Company’s administration.')
- 03:07, 17 Dec 2004 Neutrality deleted Zumex (content was: '{{del}}a badass orange juicer.http://www.zumexusa.com/products.html')
- 03:06, 17 Dec 2004 Neutrality deleted Jeff Pezzati (content was: ''''Jeff Pezzati''' is a bass guitarist and singer. He was a member of the band [[Naked Raygun]].')
- 03:06, 17 Dec 2004 Neutrality deleted Cherdania (content was: '{{deletebecause|user test}}Cherdania is the unofficial name of the country, formerly know as Easter Island. on November 23rd 2002 Queen Cherdan other...')
- 03:06, 17 Dec 2004 ALoan restored "Template:Otheruses"
- 03:05, 17 Dec 2004 Neutrality deleted Facetious (content was: '{{del}}playfully jocular 'facitious remark'')
- 03:05, 17 Dec 2004 Neutrality deleted Sumu (content was: '{{delete}}Sumu')
- 03:05, 17 Dec 2004 Neutrality deleted Misurasata (content was: 'Misurasata')
- 03:05, 17 Dec 2004 Neutrality deleted Sumu (content was: '{{del}}Sumu')
- 03:01, 17 Dec 2004 Neutrality deleted Talk:Donald Worcester (content was: 'Everybody love worcester! ok, brilla too...')
- 02:59, 17 Dec 2004 Flockmeal deleted The Ring (movie) (content was: 'You really need to have this i really realllllly need it so call me back')
- 02:58, 17 Dec 2004 Flockmeal deleted Big Brother (virus hoax) (content was: 'vcjhg')
- 02:57, 17 Dec 2004 ALoan restored "Naval_warfare"
- 02:57, 17 Dec 2004 Infrogmation deleted Diggity dank (content was: '{{del}}Diggity Dank. American slang, especially Mid-west. Meaning, very(diggity) good(dank).')
- 02:55, 17 Dec 2004 Neutrality deleted Tom Sørensen (6-0 on VFD -- content was: '{{vfd}}Tom Sørensen, born 1982. He's the drummer in True Confession, a Norwegian punk-rock band! Read more on www.trueconfession.net[[Category:19...')
- 02:38, 17 Dec 2004 Mirv deleted Cum rag (content was: '{{del}}'''Cumrag''' - A rag or cloth in a family orientated room proudly hung up on the wall that can be taken down for time of ejaculation and be pl...')
- 02:36, 17 Dec 2004 Mirv deleted Miyavi (content was: '{{del}}==Miyavi==. . . i have no clue except he sreams at oranges and sometimes has blue hair. i'll get some info from my j-rock info sorce and post...')
- 02:24, 17 Dec 2004 Francs2000 deleted Apostolic (content was: '{{del}}fgcvjijdskfjlsadkfdskjhalksdfjhkdasf'dasf;asdf'sadf;sad';fasd'f;sda;fs'd;fsad';fasd;fsad;fs'df;sd';f')
- 02:22, 17 Dec 2004 Francs2000 deleted Peperone (nonsense)
- 02:21, 17 Dec 2004 Francs2000 deleted Arp poison (content was: 'hgkjhgk')
- 02:20, 17 Dec 2004 Francs2000 deleted Theognis (content was: 'Hello, Theognis is a guy who should be related to Ganymede probably somehow.')
- 02:20, 17 Dec 2004 Francs2000 deleted Mittereder (content was: '{{del}}brian mittereder is dumb.')
- 02:18, 17 Dec 2004 Francs2000 deleted Fort Mandan (content was: '{{del}}fort mandan was located in OREGONfort clasop in north dakota')
- 02:17, 17 Dec 2004 Francs2000 deleted Ancient Egyptians oasis (content was: '{{db|Thank you}}This is a great website!')
- 02:17, 17 Dec 2004 Francs2000 deleted Figuration (content was: '{{del}}<math>Insert formula here</math>6v=3[[Image:Example.jpg]]ewer<math>Insert formula here</math>6v=3')
- 02:16, 17 Dec 2004 Francs2000 deleted Quais Taraki (content was: '{{db|Stub for deletion}}Quais Taraki... stub for content.')
- 02:16, 17 Dec 2004 Francs2000 deleted Rata Blanca (content was: '{{del}}Grupo fenomenal argentino. Aguante el metal cheeeeee')
- 02:14, 17 Dec 2004 Fuzheado deleted Sasha Slutsker (nonsense)
- 02:12, 17 Dec 2004 Fuzheado deleted MINTED (content was: '{{delete}}'''Minted''''This is a slang word for [[rich]] people, but most commonly used by the lower classes, a tipical convosation using that part...')
- 02:12, 17 Dec 2004 Fuzheado deleted Oriental peripheral vision (content was: '{{del}}People of Oriental origins have bad perhipheral vison, but faster reactions, hence thier shocking ability on the road whilst riding bicycles.')
- 02:11, 17 Dec 2004 Fuzheado deleted Dave spangler (content was: '{{del}}Born in New York, Dave Spangler grew up in a very bad area. Treated poorly as a kid, Dave soon became a very angry and confused teenager. H...')
- 02:08, 17 Dec 2004 Mirv deleted Giant Armadililo (content was: '{{delete}}giant armadillo')
- 01:59, 17 Dec 2004 Hemanshu deleted Talk:Louis Joliet (content was: '{{del}}k;lzK';zkf;kzd;kf;ldkxf;kdxlkjfjklxgkxdfkljdxlkjkjgfx')
- 01:54, 17 Dec 2004 Adam Bishop deleted Peter John Horatio Nelson, 9th Earl Nelson (content was: 'he was a man and my name is tom and becca smells')
- 01:52, 17 Dec 2004 ALoan restored "Ancient_warfare"
- 01:49, 17 Dec 2004 Geogre deleted Yank (disambiguation) (Blanked, duplicate content now, and a dead end.)
- 01:46, 17 Dec 2004 Joy Stovall deleted Seizure Face (content was: '{{del}}Hey Dode! What's bia doing anyways? Bia likes to sit in his dad's chair with that special lotion that bia brother left behind just for me dode...')
- 01:38, 17 Dec 2004 Niteowlneils deleted Jeff udovic (content was: '{{del}}')
- 01:38, 17 Dec 2004 Joy Stovall deleted Kappa slapper (nonsense)
- 01:37, 17 Dec 2004 Niteowlneils deleted Tetsuya Nomura (content was: '{{del}}TETSUYA ROCKSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS...')
- 01:37, 17 Dec 2004 Niteowlneils deleted Bomboras (content was: '{{del}}BOMBORAS')
- 01:37, 17 Dec 2004 Rdsmith4 deleted Fruit names (content was: 'fruit names')
- 01:31, 17 Dec 2004 Neutrality deleted Highlands Middle School (content was: 'Highlands Middle School )
- 01:19, 17 Dec 2004 Niteowlneils deleted Category:Pennsylvanians (superceded by [[Category:People from Pennsylvania]]--content was: '[[Category:Pennsylvania]][[Category:People by U.S. state]]{{delete}}')
- 01:16, 17 Dec 2004 Niteowlneils deleted Potato spindle tuber viroid (content was: '{{deletebecause|Wikipedia is not a web guide.}}[http://www.defra.gov.uk/planth/pestnote/pstv.htm UK Department for EnvironmentFood and Rural Affair...')
- 01:16, 17 Dec 2004 Niteowlneils deleted Peter John Horatio Nelson, 9th Earl Nelson (content was: '{{del}}he was a man a')
- 01:11, 17 Dec 2004 Quadell deleted Image:Small open fire (small).jpg (Scaled-down duplicate image)
- 01:10, 17 Dec 2004 Quadell deleted Image:Small.mc.arp.300pix.jpg (Duplicate image)
- 01:02, 17 Dec 2004 Francs2000 deleted Mouse Menace (content was: '{{delete}}Art Davis's first cartoon as director.')
- 01:01, 17 Dec 2004 Francs2000 deleted Xebian (content was: '{{del}}[[List of distributions based on Debian]]See: http://www.xbox-linux.org/ for more information.')
- 01:00, 17 Dec 2004 Francs2000 deleted NOVJ (content was: ''''NOVJ''' - Narodnooslobodilačka vojska Jugoslavije')
- 00:58, 17 Dec 2004 Quadell deleted Image:Georgereid.gif (Listed on IfD since Dec 9)
- 00:58, 17 Dec 2004 Quadell deleted Image:Male Burmilla cat.png (Listed on IfD since Dec 9)
- 00:58, 17 Dec 2004 Niteowlneils deleted Talk:Female roles in the world wars (content was: '{{del}}Women rule')
- 00:58, 17 Dec 2004 Niteowlneils deleted Talk:Paul Bouche (vfd decision to delete)
- 00:58, 17 Dec 2004 Quadell deleted Image:Bing2.JPG (Listed on IfD since Dec 9)
- 00:58, 17 Dec 2004 Quadell deleted Image:Bing1.JPG (Listed on IfD since Dec 9)
- 00:58, 17 Dec 2004 Niteowlneils deleted Talk:Tornadoes and there wether (content was: '{{delete}}')
- 00:57, 17 Dec 2004 Quadell deleted Image:Violin-belonged to Frederick Douglass.jpeg (Image:Marseillaise.mid)
- 00:57, 17 Dec 2004 Niteowlneils deleted Paul Bouche (vfd decision to delete)
- 00:55, 17 Dec 2004 Quadell deleted Image:Marseillese.mid (Listed on IfD since Dec 9)
- 00:55, 17 Dec 2004 Quadell deleted Image:Nepal flag temp.png (Listed on IfD since Dec 9)
- 00:55, 17 Dec 2004 Quadell deleted Image:Morflag22.PNG (Listed on IfD since Dec 9 )
- 00:55, 17 Dec 2004 Quadell deleted Image:Montserrat flag medium.png (Listed on IfD since Dec 9)
- 00:55, 17 Dec 2004 Quadell deleted Image:Montrealflag.jpg (Listed on IfD since Dec 9)
- 00:55, 17 Dec 2004 Quadell deleted Image:Mongoliaflag342.gif (Listed on IfD since Dec 9)
- 00:54, 17 Dec 2004 Niteowlneils deleted Patrick Lozada (content was: '{{delete}}[[Image:Example.jpg]]')
- 00:54, 17 Dec 2004 Niteowlneils deleted Rysanek Jacob (content was: '{{delete}}')
- 00:54, 17 Dec 2004 Quadell deleted Image:Marty.jpg (Listed on IfD since Dec 9)
- 00:53, 17 Dec 2004 Niteowlneils deleted Where Are You Baby (content was: '{{delete}}This was a groovy pigeon called Alan.')
- 00:53, 17 Dec 2004 Niteowlneils deleted Mroz (content was: '{{del}}')
- 00:52, 17 Dec 2004 Niteowlneils deleted Wikipedia talk:Dirty front page (content was: '{{delete}}Hey')
- 00:51, 17 Dec 2004 Niteowlneils deleted The Janson Directive (content was: '{{del}} a very good novel')
- 00:51, 17 Dec 2004 Niteowlneils deleted Talk:Liar!! (talk page for deleted page)
- 00:50, 17 Dec 2004 Niteowlneils deleted Naci Mehmet (nonsense)
- 00:50, 17 Dec 2004 Niteowlneils deleted MITH (content was: '{{deletebecause|Consensus on [[WP:VFD|votes for deletion]] was to delete [[Motherfuckers in the House]], to which this page redirects.}}#REDIRECT [[...')
- 00:49, 17 Dec 2004 Mustafaa deleted W tgajeqwrjkwgaij (content was: 'r u stupid, r u stupid dododo!{{nonsense}}')
- 00:48, 17 Dec 2004 Niteowlneils deleted Visitor-pattern (content was: '{{delete}}what?')
- 00:47, 17 Dec 2004 Niteowlneils deleted Motherfuckers in the House (vfd decision to delete)
- 00:47, 17 Dec 2004 Niteowlneils deleted Talk:Motherfuckers in the House (content was: '{{deletebecause|Consensus on [[WP:VFD|votes for deletion]] was to delete [[Motherfuckers in the House]]; this is an associated page.}}Sæll Höddi, la...')
- 00:47, 17 Dec 2004 Arminius deleted Chuck Zito (content was: 'Some bellend who floored van damme')
- 00:46, 17 Dec 2004 Niteowlneils deleted Pecos (vfd decision to delete)
- 00:45, 17 Dec 2004 Niteowlneils deleted Great chesterford school (vdf decision to delete)
- 00:44, 17 Dec 2004 Niteowlneils deleted San Miguel Capital (content was: '{{delete}}you have got to be kidding be this is bullshit what kinda site is this')
- 00:44, 17 Dec 2004 Niteowlneils deleted Resistance fighter (content was: '{{nonsense}}do u lov me? i want to hug u,i want to kiss u...... NOT!!!!')
- 00:44, 17 Dec 2004 Quadell deleted Image:Slaskwroclaw.jpg (duplicate image)
- 00:42, 17 Dec 2004 Arminius deleted Tavros (content was: 'somewhere in greece, guy bought lord of the rings book from me lived there.')
- 00:41, 17 Dec 2004 Neutrality deleted Talk:Bancroft Hall (content was: 'great place')
- 00:39, 17 Dec 2004 Niteowlneils deleted Housekeeping Zombie (vfd decision to delete)
- 00:39, 17 Dec 2004 Arminius deleted Sago plum pudding (content was: '{{del}}SAGO PLUM PUDDING')
- 00:36, 17 Dec 2004 Quadell deleted Image:Iranflag2.png (Image has errors and will not display)
- 00:33, 17 Dec 2004 Niteowlneils deleted Montes (content was: '{{del}};')
- 00:33, 17 Dec 2004 Niteowlneils deleted Albor Tholus (content was: '{{delete}}[[Image:Example.jpg]]fggfgfgfgfg')
- 00:33, 17 Dec 2004 Quadell deleted Image:Skyway2.jpeg (Unused duplicate)
- 00:28, 17 Dec 2004 Jpgordon deleted Liar!! (content was: 'Go to [[Amos Farquhar]] in Wikipedia(tm) The free search encyclopedia and you will find complete lies! Lies I tell you! Lies!!! Muahahahaha!!!! If you...')
- 00:27, 17 Dec 2004 Quadell deleted Image:Skåne County.png (Image missing)
- 00:24, 17 Dec 2004 Quadell deleted Image:Skyraider.300pix.jpg (Scaled-down duplicate image)
- 00:22, 17 Dec 2004 Bryan Derksen deleted Image:Gunkata.jpg (superceded by [[:Image:Gunkata equilibrium.jpg]])
- 23:50, 16 Dec 2004 Postdlf deleted Prinph (content was: ''''Prinph'''Pronounced pr-inn-ffNoun Definition:1. A person who voluntarily extracts the dried balls of feces left-over after using the toilet from another person's anus with their teeth...')
- 23:48, 16 Dec 2004 Postdlf deleted Registered nurse (content was: 'registered nurse' (content of this deletion message was: "content was: 'registered nurse'"))
- 23:48, 16 Dec 2004 Schneelocke deleted Talk:Ciz (Bah, I'm stupid. Wrong namespace...)
- 23:48, 16 Dec 2004 Postdlf deleted Here comes mexico (content was: 'ÑHere Comes Mexico!Mexico is big,but not as big as...............RUSSIA!!!!!' (you get an A for geography and an F for wikipedia))
- 23:30, 16 Dec 2004 Ambi deleted User:Davegreening (Not an actual user page; test?)
- 23:21, 16 Dec 2004 Ferkelparade deleted Homer's Daughter (content was: 'm')
- 23:18, 16 Dec 2004 Ahoerstemeier deleted Ngiwal (content was: 'NGIWAL IS THE HOME OF THE BEST WARRIORS IN PALAU.')
- 23:17, 16 Dec 2004 Theresa knott deleted Tornadoes and there wether (content was: 'tornadoes and there wether')
- 23:17, 16 Dec 2004 Theresa knott deleted Ngiwal (content was: 'NGIWAL IS ONE OF THE BEST PLACES TO VIDIT IN PALAU.')
- 23:16, 16 Dec 2004 Theresa knott deleted Excitement (content was: '{{db|Yeah, that's pretty excited}}asdfdsaf')
- 23:16, 16 Dec 2004 Karada deleted Watch where the heart is (content was: '{{delete}}I would like to watch Where The Heart is online.')
- 23:13, 16 Dec 2004 Ferkelparade deleted Greenville RiverHawks (content was: 'i dkcmd ke kfr fkernvir cmsofm i jjdusdf fjhudjeriu ...')
- 23:08, 16 Dec 2004 Ahoerstemeier deleted Lauren Ewald (content was: 'is the cutest girl in the world')
- 23:08, 16 Dec 2004 Ahoerstemeier deleted Thomas Knoedler (content was: 'Tom is American')
- 23:06, 16 Dec 2004 Ahoerstemeier deleted Dale chin (content was vanity)
- 23:03, 16 Dec 2004 Theresa knott deleted 765,000 volt power transmission line (content was: '{{vfd}}A '''765,000-volt power transmission line'' is the highest voltage transmission line in the world. {stub}')
- 23:03, 16 Dec 2004 Theresa knott deleted The Art of Arglesmorsbord (content was: 'The Art of Arglesmorsbord is odd. If you say something like ' Poopmongler' You can say Arglesmorsbord, and you simply can add whatever you want to the...')
- 23:02, 16 Dec 2004 Theresa knott deleted Sara Trula (content was: '{{delete}}Dr. Trula is a first rate genius. She possesses the unique ability to talk complete bollocks and sound clever for many many hours.')
- 23:02, 16 Dec 2004 Theresa knott deleted Jimmy hit (made up nonsense )
- 23:02, 16 Dec 2004 Neutrality deleted Image:Ski Jackets.JPG (Unused/orphaned thumbnail. Probable copyvio.)
- 23:01, 16 Dec 2004 Neutrality deleted Image:Skipsea Castle.bmp (Unused/orphaned thumbnail. In .bmp and no source or licensing information.)
- 22:59, 16 Dec 2004 Theresa knott deleted Dale chin (made up nonsense)
- 22:57, 16 Dec 2004 Neutrality deleted Category:Botanic Gardens images (content was: '[[Category:Congress images]]' typo)
- 22:57, 16 Dec 2004 Theresa knott deleted Robert Sternberg (content was: 'fuck you!')
- 22:56, 16 Dec 2004 Neutrality deleted Category:Botanical Gardens images (content was: '[[Category:Congress images]]' Typo)
- 22:52, 16 Dec 2004 Ahoerstemeier deleted Lee Payne (content was: 'Lee is the coolest person in the world!!!')
- 22:52, 16 Dec 2004 Ahoerstemeier deleted William Leete (content was: '--[[User:24.187.30.183|24.187.30.183]] 22:49, 16 Dec 2004 (UTC)Crystie')
- 22:47, 16 Dec 2004 Niteowlneils deleted World Pea Shooting Championships (content was: '{{delete}}[http://www.witcham.org.uk Witcham Village Web you can find Pea Shooting Pages here]')
- 22:46, 16 Dec 2004 Niteowlneils deleted Mattias Tamar-Gill (content was: '{{delete}}best person in the room.')
- 22:46, 16 Dec 2004 Niteowlneils deleted Nithsdale Wanderers F.C. (content was: '{{delete}}[[Nithsdale Wanderers]]== The Dale ==[[The Team]]----------------[[Category:Scottish football clubs]]')
- 22:43, 16 Dec 2004 Niteowlneils deleted College Of Accounting And Management Sciences (content was: '{{delete}}www.cams.edu/pk')
- 22:38, 16 Dec 2004 David.Monniaux deleted Image:Military engineer mobile bridge DSC00859.jpg (moved to commons)
- 22:37, 16 Dec 2004 G-Man deleted Central New York Regional Transportation Authority (making way for re-direct)
- 22:33, 16 Dec 2004 Ahoerstemeier deleted Perfection (content was: '{{deletebecause|Perfection is attained not when there is nothing left to add, but when there is nothing left to take away.}}<!-- Sorry, but this was...')
- 22:31, 16 Dec 2004 Neutrality deleted Image:Unknown flower8 belize.jpg (Reuploaded under better filename.)
- 22:31, 16 Dec 2004 Stan Shebs deleted Rehan (content before blanking was: 'REhan is a stupid idiot who got a point off of my test in Kendy and Jose is mexican and James is an anorexic. Andy is stupid kid who can't pass geome...')
- 22:29, 16 Dec 2004 Ahoerstemeier deleted ASSBOAT (content was: 'SOMEBODY WITH A BOAT THHE SIZE OF AN AS..ER AN ASS THE SIZE OF A BOAT OK YEAH THATS WHAT I MEANT TO SAY')
- 22:29, 16 Dec 2004 Ahoerstemeier deleted Bucatini (content was: 'bucatini')
- 22:28, 16 Dec 2004 Ahoerstemeier deleted Xmastro (content was: 'A short demo to wish merry xmas. See [[demoscene]]')
- 22:28, 16 Dec 2004 Ahoerstemeier deleted The Village Green Preservation Society (content was: 'fadsfsdfasd')
- 22:28, 16 Dec 2004 Ahoerstemeier deleted Martin Mackin (content was: 'Irish political leader')
- 22:28, 16 Dec 2004 Ahoerstemeier deleted Metal Magic (content was: 'PIOJP;KL,M;L,OP[K')
- 22:20, 16 Dec 2004 Thue deleted Rzecz (content was: '{{delete}}{{vfd}}Polish has too many silent Zs. Rzecz Pzoszpowzliwzatzasz!')
- 22:14, 16 Dec 2004 Ahoerstemeier deleted Black Guan (content was: '{{delete}}'''Bold text'''poopie pants')
- 22:14, 16 Dec 2004 Ahoerstemeier deleted Two (band) (content was: '{{delete}}hasx0 x.x,d,www.judaspriest.com zek it outt !')
- 22:14, 16 Dec 2004 Ahoerstemeier deleted Fight (band) (content was: '{{delete}}yeye fight's a great band')
- 22:14, 16 Dec 2004 Ahoerstemeier deleted Ken Kragen (content was: '{{delete}}music producer')
- 22:14, 16 Dec 2004 Thue deleted Air Staff (content was: '{{del}}test')
- 22:14, 16 Dec 2004 Thue deleted Jake Brown (content was: '{{delete}}me')
- 22:14, 16 Dec 2004 Thue deleted Modana (content was: '{{delete}}blood orgy!!')
- 22:14, 16 Dec 2004 Thue deleted Yellowstone Plateau (content was: 'Shap{{delete}}')
- 22:13, 16 Dec 2004 Ahoerstemeier deleted Kwanzaa flag (content was: 'j;jkj')
- 22:13, 16 Dec 2004 Ahoerstemeier deleted Joe campbell (content was: 'joe is a fat shit hott ass dick loving sex man, i want your schlong big boy....signed adam wilson')
- 22:12, 16 Dec 2004 Thue deleted Paleo-Hebrew (content was: '{{delete}}hello')
- 22:12, 16 Dec 2004 Thue deleted Harley-Davidson Motor Company (content was: '{{delete}}hello i think harley's rock and I think since some people are complaining about them that you should allow chinese to take a look at the en...')
- 22:12, 16 Dec 2004 Thue deleted MrSpellingBeeChampion (content was: '{{delete}}not dp2.')
- 22:10, 16 Dec 2004 Gamaliel deleted Metaphors we live by (content was: 'A finished story, one that is a work of art, that is, a combination of craft and vision, is, finally, a metaphor for an archetypal condition of Man--s...')
- 22:08, 16 Dec 2004 Ahoerstemeier deleted Faggot ass nigger bitch (content was: 'his name will remain unrevealed, he is a short, fat white boy, 16 years old, dosnt have his drivers license, and he thinks hes tough//////...')
- 22:07, 16 Dec 2004 Ahoerstemeier deleted User:66.243.141.226 (deleting a copyright violation which does not belong here, and was reverted in [[Macedonia]] previously)
- 22:06, 16 Dec 2004 Gamaliel deleted Fagot ass nigger bitch (content was: 'his name will remain unrevealed, he is a short, fat white boy, 16 years old, dosnt have his drivers license, and he thinks hes tough//////////////////...')
- 21:56, 16 Dec 2004 Ilyanep deleted Gymnasium Haganum (spam)
- 21:54, 16 Dec 2004 Ahoerstemeier deleted Gay skinheads (content was: 'there is NO such thing as a fag skin, we do not tolerate your pussy shit//////////////I am Adam, Joe, are you there, Fuck the System, Fuck Nigglettes,...')
- 21:54, 16 Dec 2004 Charles Matthews deleted Bryleigh's Theorem (hoax nonsense)
- 21:53, 16 Dec 2004 Ahoerstemeier deleted Gay skinheads (content was: 'there is NO such thing as a fag skin, we do not tolerate your pussy shit//////////////I am Adam, Joe, are you there, Fuck the System, Fuck Nigglettes,...')
- 21:46, 16 Dec 2004 Theresa knott deleted Robot Patent (content was: 'Robot Patent')
- 21:41, 16 Dec 2004 Ahoerstemeier deleted Stiffness tensor (content was: '[[Image:Example.jpg]][[Media:Example.ogg]]--[[User:129.15.196.96|129.15.196.96]] 21:19, 16 Dec 2004 (UTC)----[[Media:Example.ogg]]== Head...')
- 21:38, 16 Dec 2004 Thue deleted Authorized Personnel Only: Part 1 (Alias episode) (content was: '{{delete}}< o > sugar cookie muffins!')
- 21:37, 16 Dec 2004 Thue deleted Yang Xiuqing (content was: '{{delete}}[[Media:Example.ogg]][[Image:Example.jpg]]')
- 21:37, 16 Dec 2004 Thue deleted The Orphan (Alias episode) (content was: '{{delete}}Hello')
- 21:24, 16 Dec 2004 Isomorphic deleted WP:SB/Hangman (content was: 'bender robot')
- 21:20, 16 Dec 2004 Isomorphic deleted Dixon Correctional Center (content was: 'This typing is just a test to see the quality that can be acchieved.')
- 21:18, 16 Dec 2004 Thue deleted Guilderland High School, Guilderland Center, New York (content was: '{{delete}}Guilderland High School is a school for young adults aged 13-18. It's not a bad school, actually. Except for math. Math isn't fun. I have ...')
- 21:17, 16 Dec 2004 Thue deleted Buttero (content was: '{{delete}}Your a littel cool')
- 21:17, 16 Dec 2004 Thue deleted Mastering the Art of French Cooking (content was: 'jfjfjf''ofcol''{{delete}}')
- 21:16, 16 Dec 2004 Thue deleted Leonard Carlo (content was: '{{delete}}he said fuck alot')
- 21:16, 16 Dec 2004 Thue deleted Pobedry (blanked by creator)
- 21:14, 16 Dec 2004 Thue deleted DIN 48830 (content was: '{{delete}}smell my butt')
- 21:12, 16 Dec 2004 Thue deleted User:Masterhomer/Main Page (deletion requested by user)
- 21:11, 16 Dec 2004 Thue deleted Jessica Fawley (content was: '{{delete}}== Headline text ==Jessica Fawley. . . the coolest girl on the planet.')
- 21:11, 16 Dec 2004 Thue deleted Short-haul (content was: '{{delete}}What is this? cool huh? man oh man...')
- 21:11, 16 Dec 2004 Thue deleted Pseudopotto (content was: '{{delete}}THIS DICK!!! HAHAHHAHAHAHAHAHHAHAHAHAHAHAHAHAHA!!!')
- 21:11, 16 Dec 2004 Quadell deleted Image:Rafted block in Valentine Cave in Lava Beds NM-300px.JPG (Scaled-down duplicate image)
- 21:08, 16 Dec 2004 Quadell deleted Image:Paris.landsat.arp.400pix.jpg (Scaled-down duplicate image)
- 21:06, 16 Dec 2004 Quadell deleted Image:ENC plate 1-143 300px.jpg (Scaled-down duplicate image)
- 21:02, 16 Dec 2004 Adam Bishop deleted Perineal urethra (content was: ''''ansarnet'''')
- 20:54, 16 Dec 2004 Quadell deleted Image:Docklands light railway small.png (Scaled-down duplicate image)
- 20:53, 16 Dec 2004 Quadell deleted Image:Doktorschnabel 300px.jpg (Scaled-down duplicate image)
- 20:51, 16 Dec 2004 Quadell deleted Image:Do You Know Stuff Small.png (Scaled-down duplicate image)
- 20:51, 16 Dec 2004 Quadell deleted Image:Diller Canyon on Mt Shastina from Weed, California-750px.JPG (Scaled-down duplicate image )
- 20:51, 16 Dec 2004 Quadell deleted Image:Diller Canyon on Mt Shastina from Weed, California-300px.JPG (Scaled-down duplicate image)
- 20:50, 16 Dec 2004 Ike9898 deleted Gift Album (content was: '1. Smile2. Again & Again3. Emotional Times4. Now 5. 1 Nite Stand 6. Believed 7. Mentobe 8. I 9. Mirror's Reflection 10. Dragged Down ...')
- 20:48, 16 Dec 2004 Meelar deleted Chef salad (transwikied)
- 20:48, 16 Dec 2004 Quadell deleted Image:Devils Homestead in Lava Beds NM-750px.jpg (Scaled-down duplicate image )
- 20:48, 16 Dec 2004 Quadell deleted Image:Devils Homestead in Lava Beds NM-300px.jpg (Scaled-down duplicate image)
- 20:48, 16 Dec 2004 Quadell deleted Image:Devil's Slide on west side of Yellowstone River just outside the Park-300px.JPG (Scaled-down duplicate image)
- 20:47, 16 Dec 2004 Quadell deleted Image:Desert-rose-small.jpg (Scaled-down duplicate image)
- 20:46, 16 Dec 2004 Ike9898 deleted Welcome album (content was: '[[Atlantic Records]] 20021. Mine 2. Poem 3. Everything 4. Art 5. Myself 6. When 7. Fault 8. Sumtimes 9. Breathe 10. Like 11. Dr...')
- 20:41, 16 Dec 2004 Ike9898 deleted Hydrology studies (content was: 'Hello students,TodaY IS THE day where we learn about science. Its awesome.{{delete}}')
- 20:38, 16 Dec 2004 Quadell deleted Image:Georgia flag medium (old).png (Scaled-down duplicate image)
- 20:35, 16 Dec 2004 Ahoerstemeier deleted Talk:Tad wasowicz (content was: 'don't delete tad, it just needs more added to it!')
- 20:34, 16 Dec 2004 Ahoerstemeier deleted Tad wasowicz (content was: 'Tad's cool!!!')
- 20:34, 16 Dec 2004 Ahoerstemeier deleted Air Staff (content before blanking was: 'test')
- 20:32, 16 Dec 2004 Quadell deleted Image:13 colonies in 1775 (small).png (Scaled-down duplicate image)
- 20:29, 16 Dec 2004 Quadell deleted Image:11-M.jpeg (Duplicate scaled-up image)
- 20:26, 16 Dec 2004 Mustafaa deleted Cypriot Maronite Arabic (content was: '{{copyvio|url=http://www.csmonitor.com/2004/0129/p07s02-wome.html}}'. Old copyvio; all relevant material copied into new page.)
- 20:20, 16 Dec 2004 SimonP deleted Talk:Princess of Wales (content was: 'boo')
- 20:12, 16 Dec 2004 Niteowlneils deleted Image:LocationLiechtenstein.png (moved to commons under same name)
- 20:12, 16 Dec 2004 Niteowlneils deleted Image:LocationMalta.png (moved to commons under same name)
- 20:11, 16 Dec 2004 Niteowlneils deleted Image:LocationMonaco.png (moved to commons under same name)
- 20:11, 16 Dec 2004 Niteowlneils deleted Image:LocationUnitedKingdom.png (moved to commons under same name)
- 20:11, 16 Dec 2004 Niteowlneils deleted Image:LocationVaticanCity.png (moved to commons under same name)
- 20:11, 16 Dec 2004 Niteowlneils deleted Image talk:LocationVaticanCity.png (content was: 'why')
- 20:10, 16 Dec 2004 Ahoerstemeier deleted Skatoolaki (content was: 'Greek for 'little shithead'.')
- 20:09, 16 Dec 2004 Ahoerstemeier deleted Brian Mittereder (content was: 'what up yo')
- 20:09, 16 Dec 2004 Ahoerstemeier deleted Yuquiyú (content was: 'GREGORIO DUTCHER ES ESTUPIDO')
- 20:08, 16 Dec 2004 Mirv deleted 9/11 the musical (content was: ''''This page was deleted out of process by known troll [[User:Mirv | Mirv]]. Instead of actually deleting it, as was requested on [[WP:VFD | votes for...' -- you're thinking of [[911 the musical]], this page only exists because of a Mike Church sockpuppet's page move vandalism)
- 20:05, 16 Dec 2004 Ahoerstemeier deleted Melita,Manitoba (content was: '[http://www.melitamb.ca/ Melita,Manitoba Website]')
- 20:05, 16 Dec 2004 Ahoerstemeier deleted Melita, Manitoba (content was: '[http://www.melitamb.ca/ Melita Manitoba Website]')
- 20:03, 16 Dec 2004 Ahoerstemeier deleted Hysteroid (content were editing experiments)
- 20:02, 16 Dec 2004 Mirv deleted Wikipedia:Requests for comment/Carrp (uncertified/rescinded, deleting at request of initiator)
- 20:01, 16 Dec 2004 Ahoerstemeier deleted Image talk:Lh-map.png (content were editing experiments)
- 20:00, 16 Dec 2004 David.Monniaux deleted Image:Milice ecole.jpg (moved to commons)
- 20:00, 16 Dec 2004 David.Monniaux deleted Image:Milice poster.jpg (moved to commons)
- 19:57, 16 Dec 2004 Thue deleted Domitila de Castro Canto e Mello, Marquis of Santos (content was: '{{delete}}what a hell going on here')
- 19:56, 16 Dec 2004 Thue deleted Coopers Premium Ale (content was: 'Remember how a good version of your home brew tasted?Well this is it. Complete with dead yeast sediment in the bottom of the bottle.')
- 19:56, 16 Dec 2004 Thue deleted John Kennedy (engineer) (content was: 'ffdfdfdfd')
- 19:51, 16 Dec 2004 Rhobite deleted Homomorf (ambiguous ascii art)
- 19:50, 16 Dec 2004 Mirv deleted Talk:Bib cock (content was: 'i want a big dick' -- no accompanying article in any case)
- 19:50, 16 Dec 2004 Michael Snow deleted Category:Indo-European languaes (content was: '#REDIRECT [[Indo-European languages]]')
- 19:43, 16 Dec 2004 Rdsmith4 deleted User:Rdsmith4/monobook.css (starting over)
- 19:41, 16 Dec 2004 DavidWBrooks deleted Rio Players (content was: 'SAVE')
- 19:41, 16 Dec 2004 Niteowlneils deleted Talk:Mr Shell (content was: '{{delete}}Isn`t he gay?imsorry this page should stay up becasue he is undoubtedly homosexualitsall of our opinions it should stayyeahyeahME...')
- 19:41, 16 Dec 2004 Mirv deleted Talk:Teledildonicism (content was: '#REDIRECT [[User talk:Isomorphic/Minions of the Church]]')
- 19:40, 16 Dec 2004 Mirv deleted Teledildonicism (content was: '#REDIRECT [[User:Isomorphic/Minions of the Church]]')
- 19:40, 16 Dec 2004 Niteowlneils deleted Mary Gruber (content was: '{{delete}}Crandon Elementary School teacher and mother of [[Carl Gruber]].')
- 19:40, 16 Dec 2004 Niteowlneils deleted Post Danmark (content was: '{{delete}}?')
- 19:39, 16 Dec 2004 Niteowlneils deleted Jeffery Myers (content was: '{{delete}}Friend to the most awesome person in the world.(See Christopher Roland Smith) Enjoys playing soccer, being in a band, being mean, and hit...')
- 19:39, 16 Dec 2004 Mirv deleted Wikipedia talk:Another nowhere (content was: '#REDIRECT [[Special:Randompage]]')
- 19:39, 16 Dec 2004 Mirv deleted Wikipedia talk:Not there yet (content was: '#REDIRECT [[Special:Randompage]]')
- 19:39, 16 Dec 2004 Mirv deleted Wikipedia:Not there yet (content was: '#REDIRECT [[Special:Randompage]]')
- 19:39, 16 Dec 2004 Mirv deleted Wikipedia:Another nowhere (content was: '#REDIRECT [[Special:Randompage]]')
- 19:38, 16 Dec 2004 Mirv deleted Wikipedia talk:Some nothing place (content was: '#REDIRECT [[Special:Randompage]]')
- 19:38, 16 Dec 2004 Mirv deleted Wikipedia:Some nothing place (content was: '#REDIRECT [[Special:Randompage]]')
- 19:38, 16 Dec 2004 Mirv deleted User talk:Isomorphic/Minions of the Church (content was: '#REDIRECT [[Special:Randompage]]')
- 19:38, 16 Dec 2004 Mirv deleted User:Isomorphic/Minions of the Church (content was: '#REDIRECT [[Special:Randompage]]')
- 19:38, 16 Dec 2004 DavidWBrooks deleted Carl Gruber (non-notable, friends' joke (part II))
- 19:38, 16 Dec 2004 DavidWBrooks deleted John Gruber (non-notable, friends' joke )
- 19:37, 16 Dec 2004 Niteowlneils deleted Bay Area Wireless Users Group (content was: '{{deleteagain}}Hello World')
- 19:36, 16 Dec 2004 Niteowlneils deleted Christopher Roland Smith (content was: '{{delete}}The most awesome person in the world. King of awesome and superbulous.')
- 19:36, 16 Dec 2004 Mirv deleted 9/11 the musical (content was: '#REDIRECT [[Talk:Ambition (card game)]]')
- 19:35, 16 Dec 2004 Niteowlneils deleted Al-Jabr wa-al-Muqabilah (content was: '{{deleteagain}}what is algabr wa la muqabilah in english')
- 19:35, 16 Dec 2004 DavidWBrooks deleted Monastic vow (content before blanking was: 'Lppppp'''Bold text''''''Bold text'''')
- 19:35, 16 Dec 2004 DavidWBrooks deleted Isaac adediran (content was: '{{delete}}was born on january 15 1987, the name Adediran was derived from nigerian royal names. He is currently attending university of wisconsin ri...')
- 19:32, 16 Dec 2004 DavidWBrooks deleted Paris liberated (French-language discussion)
- 19:30, 16 Dec 2004 Deb deleted Handle your meat (content was: '{{vfd}}to Man handle your 'meat' or 'wang'orto touch yourself in a rude mannerorspanking the buddyor waxing the one eyed weasel those ...')
- 19:30, 16 Dec 2004 Mirv deleted Wikipedia:Middle of nowhere (content was: '#REDIRECT [[Special:Randompage]]')
- 19:29, 16 Dec 2004 Mirv deleted Talk:Ambition (card game) (content was: '#REDIRECT [[Special:Randompage]]')
- 19:26, 16 Dec 2004 Duncharris deleted The Two Vanrevels (content was: '{{delete}}hello my name is brittney tarkington.-I am booth tarkingtons great grand daugter history will follow in time')
- 19:25, 16 Dec 2004 Duncharris deleted S/N ratio (content was: '{{delete}}[[Adam Buehrens]] has sex with goats... I have proof')
- 19:25, 16 Dec 2004 Deb deleted Neil Robinson (content was: '{{delete}}Greatest man alive...')
- 19:24, 16 Dec 2004 Duncharris deleted Ryan Bunda (content was: '{{delete}}Friend to the most awesome person in the world.(See Christopher Roland Smith) Enjoys playing soccer, basketball, being creepy, and funny.')
- 19:24, 16 Dec 2004 Duncharris deleted Mandra Gruber (content was: '{{delete}}Wife of [[Carl Gruber]].')
- 19:23, 16 Dec 2004 Deb deleted Krause end-bulb (content was: '{{delete}}cold sesory')
- 19:22, 16 Dec 2004 Deb deleted Chemistry, (content was: 'a science')
- 19:20, 16 Dec 2004 DavidWBrooks deleted Harris Papyrus (content was: 'Isis Cosemtics Because we all want to look like an Egyptian QueenEyeliner - $5.25 a tube Mascara - $7.00Rouge - $5.89Saturday Sale %20 of...')
- 19:18, 16 Dec 2004 Niteowlneils deleted Brian osbun (content was: '{{delete}}')
- 19:11, 16 Dec 2004 Deb deleted Vladko Macek
- 19:11, 16 Dec 2004 Deb deleted Paul Lauger (content was: '{{deleteagain}}Paul Lauger is a great math dude. He was born on May 19, 1932.')
- 19:09, 16 Dec 2004 Deb deleted Mr Shell (content was: '{{delete}}A Big Gay Faggot!!!!!!!!!!')
- 19:04, 16 Dec 2004 Deb deleted Timothy Roland Smith (content was: '{{delete}}Father to the most awesome person in the world.(See Christopher Roland Smith) Grand Father of awesome.')
- 19:03, 16 Dec 2004 Deb deleted Scott Jackson Smith (content was: '{{delete}}Little brother to most awesome person in the world.(See Christopher Roland Smith) Prince of awesome.')
- 19:02, 16 Dec 2004 Deb deleted Marissa May Gruber (content was: '{{delete}}Daughter of [[Carl Gruber]] and [[Mandra Gruber]] born on September 16th 2004.')
- 19:01, 16 Dec 2004 Deb deleted Caitlin Amy Dahlgren (content was: '{{delete}}Caitlin is not as cool as Chris!')
- 18:54, 16 Dec 2004 Deb deleted Constance Lynn Smith (content was: '{{delete}}Mother to the most awesome person in the world.(See Christopher Roland Smith) Grand Mother of awesome.')
- 18:54, 16 Dec 2004 Deb deleted Carrie Quinn Dolin (content was: '{{delete}}whore')
- 18:42, 16 Dec 2004 Deb deleted Mesityl (content was: 'mesityl oxide')
- 18:39, 16 Dec 2004 Deb deleted Splash page (content was: '{{stub}}')
- 18:37, 16 Dec 2004 Deb deleted Old Icelandic (content was: 'Hello')
- 18:35, 16 Dec 2004 Deb deleted Christopher Roland Smith (content was: 'The most awesomest person in the world.')
- 18:34, 16 Dec 2004 Deb deleted Boo, Washington (content was: '{{delete}}This is Boo, Washington. A town I established in my backyard.')
- 18:32, 16 Dec 2004 Deb deleted Two-page spread (content was: '{{stub}}')
- 18:25, 16 Dec 2004 Quadell deleted Image:Arctic Hare small.jpg (Scaled-down duplicate image)
- 18:25, 16 Dec 2004 Quadell deleted Image:Arctic terns small.jpg (Scaled-down duplicate image)
- 18:25, 16 Dec 2004 Quadell deleted Image:Arco, Idaho-300px.JPG (Scaled-down duplicate image)
- 18:10, 16 Dec 2004 Jimbo Wales deleted Image:Jimbo, child.jpg (Deleting photo of my daughter for personal security reasons)
- 18:05, 16 Dec 2004 Jimbo Wales deleted Image:WikimeetlondonPic6-17.jpg (For reasons of personal security, I am removing photos of my daughter from the web whenever I can)
- 18:04, 16 Dec 2004 Niteowlneils deleted Template:Planet:Erra:Alien (content was: '{{db|nonsense}}''I am an alien from the planet Erra. I would appreciate you '''not''' editing this article, as this is part of the Erran 'Operation ...')
- 18:04, 16 Dec 2004 Niteowlneils deleted Talk:Eanorel (content was: '{{delete}}Non-Greeks will only be able to recognize Dodoni by its classical name Dodona. A simple reference '(modern Dodoni)' in the Dodona entry mi...')
- 18:02, 16 Dec 2004 DropDeadGorgias deleted We will we will rock you sock you pick you up and drop you (content was: '{{nonsense}}His name is dan. dan likes to study. why does dan like to study? no one knows. sean does not like dan. dan is a monkey with glasses. sea...')
- 18:02, 16 Dec 2004 DropDeadGorgias deleted Gosearch (content was: '{{nonsense}}There was once a boy named colin. colin's friend told him to go on the internet, but colin would not go on the internet. finally colin w...')
- 18:02, 16 Dec 2004 Niteowlneils deleted Maria Miloslavskaya (content was: '{{delete}}hi allI dont know who she is but i can guess. She was phat. That girl is banging and that accent is so sexy. thanks yep')
- 18:02, 16 Dec 2004 Niteowlneils deleted Paul Lauger (content was: '{{delete}}I frickin love this maniac.He has big glasses. And is the 'MAN'!!!Its always fun in Laugerville... Can he even teach?')
- 18:02, 16 Dec 2004 Niteowlneils deleted Martin Brown (murder victim) (content was: 'ojonjnihjnhbubuhblmlmkpoij9ouh8ygtym l'm'lkj[oi{{delete}}')
- 18:02, 16 Dec 2004 Deb deleted William Hayes Fisher, 1st Baron Downham (content was: 'lord dowmham was a schmuck')
- 18:01, 16 Dec 2004 Quadell deleted Image:Aqueduct-segovia-thumbnail.jpg (Scaled-down duplicate image)
- 18:01, 16 Dec 2004 Quadell deleted Image:Aqueduct-pont-du-gard-thumbnail.jpg (Scaled-down duplicate image)
- 18:01, 16 Dec 2004 Quadell deleted Image:Aqueduct-aqua-claudia-thumbnail.jpg (Scaled-down duplicate image)
- 18:00, 16 Dec 2004 Niteowlneils deleted Golovchin (content was: 'OhSo you want to know about Golovchin, eh?In 1697 it was hoppinest club that side of the baltic seaplenty of puff puff to go around{{delete}}')
- 18:00, 16 Dec 2004 Niteowlneils deleted Google Community (content was: '{{delete}}----'''errrrr'''i dont know wether this will work')
- 17:57, 16 Dec 2004 Deb deleted Bernhardt Stroh (content was: 'Strohs kicks ass.')
- 17:50, 16 Dec 2004 Quadell deleted Image:Apache.ah64.250pix.jpg (scaled-down duplicate image)
- 17:50, 16 Dec 2004 Quadell deleted Image:Antonov.an2.250pix.jpg (scaled-down duplicate image)
- 17:50, 16 Dec 2004 Quadell deleted Image:Anticline near Salt Lake City-300px.JPG (scaled-down duplicate image)
- 17:49, 16 Dec 2004 Quadell deleted Image:Andean.goose.250pix.jpg (scaled-down duplicate image)
- 17:45, 16 Dec 2004 Warofdreams deleted Slotch (content was: 'Slotch is EVIL')
- 17:43, 16 Dec 2004 Warofdreams deleted Jornal Record (content was: '[http://www.record.pt]')
- 17:43, 16 Dec 2004 Warofdreams deleted Dan smells (content was: '{{delete}}Dan smells. He smells like rotten cheese. I like cheese. Cars aren't made from cheese.')
- 17:09, 16 Dec 2004 Charles Matthews deleted Transcend Method (advertising - content was: 'To access the method Go to 'http://www.transcend.org/' and locate the transcent manual in the menu.')
- 17:08, 16 Dec 2004 Joy Stovall deleted Now We Are Six (content was: 'go away you stupid website{{delete}}')
- 17:06, 16 Dec 2004 Joy Stovall deleted The Souls of Black Folk (content was: 'hi my name is billy')
- 16:59, 16 Dec 2004 UtherSRG deleted Talk:A way to lure a woman (content was: 'It worked for me!')
- 16:57, 16 Dec 2004 UtherSRG deleted "A way to lure a woman" (content was: 'Fart alot if you want to get bitches.<math>farts^2+money+balls=bitches</math>')
- 16:48, 16 Dec 2004 Ambi deleted A way to lure a woman (content was: 'Fart alot if you want to get bitches.<math>farts^2+money+balls=bitches</math>')
- 16:36, 16 Dec 2004 ALoan restored "Freedom_of_Information_Act_2000"
- 16:32, 16 Dec 2004 Deb deleted Jeff Hollender (content was: 'One Sexy Mofo. Great and cool kid. Known as a god')
- 16:31, 16 Dec 2004 Infrogmation deleted Image:DominoSleeveSmall.jpg (old thumbnail no longer needed)
- 16:30, 16 Dec 2004 Ahoerstemeier deleted Venustraphobia (content was patent nonsense)
- 16:28, 16 Dec 2004 Deb deleted "Oshawa City Council" (content was: 'OSHAWA!')
- 16:26, 16 Dec 2004 Mikkalai deleted Pcbibrevbooks (merged with main article)
- 16:25, 16 Dec 2004 Deb deleted Mack brewery (content was: ''''i'm going to tromso on saturday :-D yay'''{{delete}}')
- 16:24, 16 Dec 2004 Deb deleted "Powerballin'" (content was: 'I LOVE CHINGY I WOUOLD DO HIM IN A SECONDDDDDDDDDDD!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!')
- 16:22, 16 Dec 2004 DropDeadGorgias deleted "Waist-hip ratio" (content was: '{{delete}}45 55')
- 16:22, 16 Dec 2004 DropDeadGorgias deleted Military camp (content was: 'je cherche gilles daniel delong. je veux que tu sache---je t'aimerais toujours gilles, et je le regrette. donna logan{{db|ceci n'est pas en Anglais...')
- 16:22, 16 Dec 2004 Deb deleted Pliska (content was: ''''BLB'''')
- 16:19, 16 Dec 2004 DropDeadGorgias deleted Amber Gietter (content was: '{{db|Search turns up noone by this name}}one cool kid')
- 16:19, 16 Dec 2004 Mikkalai restored "Pcbibrevbooks"
- 16:13, 16 Dec 2004 Deb deleted The peace sign position (content was: 'Peace Sign{{delete}}')
- 16:05, 16 Dec 2004 Quadell deleted Image:Andean.goose.arp.500pix.jpg (scaled-down duplicate image)
- 16:05, 16 Dec 2004 Quadell deleted Image:AntarcticaSatelliteImageSmall.jpg (scaled-down duplicate image)
- 16:05, 16 Dec 2004 Quadell deleted Image:Andean.goose.arp.1.500pix.jpg (scaled-down duplicate image)
- 16:00, 16 Dec 2004 Ferkelparade deleted "Wealth tax" (content was: 'hello Ben,I wonder if there is any fotball on tonight?thanks')
- 15:56, 16 Dec 2004 Ferkelparade deleted Legend of Legaia (content was: 'fuckity fuck fuck')
- 15:50, 16 Dec 2004 Quadell deleted Image:AnchorsAweighSmall.jpeg (scaled-down duplicate image)
- 15:47, 16 Dec 2004 ClockworkSoul deleted "Live burial" (Substub)
- 15:44, 16 Dec 2004 Quadell deleted Image:Ammonite.250pix.jpg (Scaled-down duplicate image)
- 15:44, 16 Dec 2004 Quadell deleted Image:Amethyst.bed.250pix.jpg (Scaled-down duplicate imaeg)
- 15:44, 16 Dec 2004 Quadell deleted Image:Americanwoodcocksm.JPG (Scaled-down duplicate image)
- 15:43, 16 Dec 2004 Quadell deleted "Image:Americanfrog reduced.jpg" (scaled-down duplicate image)
- 15:42, 16 Dec 2004 Ferkelparade deleted Schmidt telescope (content was: 'is great and makes things look bigger. what would we do without it? Hmmmm?!?!')
- 15:38, 16 Dec 2004 Quadell deleted Image:American white ibis small.jpg (Scaled-down duplicate image)
- 15:35, 16 Dec 2004 Mustafaa deleted Saran wrap (content was: 'saran wrap')
- 15:34, 16 Dec 2004 Ferkelparade deleted User:Supernerd ("User" page created to circumvent Vfd consensus to delete [[Supernerd]], User "Supernerd" does not exist)
- 15:32, 16 Dec 2004 Ferkelparade deleted San Bernardino Mountain (content was: 'elevations and summits')
- 15:04, 16 Dec 2004 DavidWBrooks deleted Moylgrove (content was: ' Moylgrove is a v...')
- 15:04, 16 Dec 2004 DavidWBrooks deleted Lolism (patent nonsense)
- 15:02, 16 Dec 2004 DavidWBrooks deleted Katie Bostdorff (content was: 'A spectacular hero who should be admired for her monumentous contributions.')
- 15:02, 16 Dec 2004 DavidWBrooks deleted David Morier (content was: ''''Bold text'''''Italic text''[[Link title]]== Headline text ==')
- 15:01, 16 Dec 2004 DavidWBrooks deleted Bigger & Blacker (content was: 'Chris Rocks bigger and blacker is some funny shit. If your hurt i suggest you pour some tusin on it and go find the big piece of chicken.')
- 15:01, 16 Dec 2004 DavidWBrooks deleted Ragab (content was: 'Ragab Omran')
- 15:00, 16 Dec 2004 Quadell deleted Image:Alternate06.jpg (scaled-down duplicate of existing image)
- 15:00, 16 Dec 2004 Quadell deleted Image:Alternate02.jpg (ununsed thumb)
- 14:59, 16 Dec 2004 Quadell deleted Image:Altair 8800 small.jpg (duplicate thumb)
- 14:58, 16 Dec 2004 Quadell deleted Image:Alpha-D-glucose-6 phosphate.png (Duplicate image)
- 14:33, 16 Dec 2004 Kosebamse deleted Amber Gietter (content was: 'one cool kid')
- 14:30, 16 Dec 2004 Deb deleted Need 4 SPeed (content was: ''''Bold text'''Hello thus is Alan Noname and i have the need for speed babydo u like it like that? uhuh uhuhHomestarrunner is a site with very edu...')
- 14:29, 16 Dec 2004 Magnus Manske deleted Image:Johnny Speight.jpg (No image here)
- 14:29, 16 Dec 2004 Deb deleted Reckoning (content was: ''''Reckoning''' is usually known as ''dead reckoning''')
- 14:28, 16 Dec 2004 Deb deleted Michael song (content was: '{{delete}}michael song is the smartest bestest person in the world')
- 14:28, 16 Dec 2004 Deb deleted Sloreactor (content was: '{{delete}}sloreactor je najboljsi in najbolje obiskan forum v sloveniji. www.sloreactor.com')
- 14:26, 16 Dec 2004 Deb deleted Street racing (content was: '{{delete}}')
- 14:26, 16 Dec 2004 ALoan restored "NAACP"
- 14:25, 16 Dec 2004 Deb deleted Whistle tips (content was: '{{delete}}the quick brown fox jumped over the lazy dog.')
- 14:24, 16 Dec 2004 Deb deleted Crocodylus (content was: '{{}}|~ |||||||||äÑß[[]]')
- 14:19, 16 Dec 2004 Zoney restored "Talk:Constitution_of_Ireland"
- 14:19, 16 Dec 2004 Stan Shebs deleted Cypriniformes (content was: '#REDIRECT [[Cypriniform]]', prep for move)
- 14:19, 16 Dec 2004 Zoney deleted Talk:Constitution of Ireland (Delete in preparation for merge)
- 14:17, 16 Dec 2004 Ferkelparade deleted Rob HUll (patent nonsense, content was: 'Rob H.KeithBeasemanand teachman == Headline text ==Sniperoth territory')
- 14:16, 16 Dec 2004 Zoney restored "Constitution_of_Ireland"
- 14:15, 16 Dec 2004 Zoney deleted Constitution of Ireland (Delete in preparation for merge)
- 14:14, 16 Dec 2004 Stan Shebs deleted California Pizza Kitchen (content was: 'pocahantas')
- 14:09, 16 Dec 2004 Ferkelparade deleted Mil Mi-12 (content was: '{{delete}}Mil Mi-12')
- 14:05, 16 Dec 2004 Charles Matthews deleted Logically convex space (Hoax - gibberish mathematics and Raymond Paley died in 1933)
- 14:02, 16 Dec 2004 UtherSRG deleted Talk:Brent Lockhart (vadalism junk)
- 13:57, 16 Dec 2004 Magnus Manske deleted Image:JosephHiester.jpg (No image here)
- 13:56, 16 Dec 2004 Ferkelparade deleted Nacaome (content was: '{{delete}}Nacaome....Es la cabecera Departamental de Valle.')
- 13:56, 16 Dec 2004 Ferkelparade deleted Air Madrid (content was: 'Air Madrid')
- 13:49, 16 Dec 2004 Duncharris deleted Wooran's Web (left after vandal move, content was: '{{delete}}#redirect [[Wikipedia:How to fix cut and paste moves]]')
- 13:45, 16 Dec 2004 Duncharris deleted User:Vague Rant/Left (user's request content was: '{{delete}}<div style='float:left; margin-top:3px; border-style:solid; border-width:1px; border-color:#2F6FAB; color:#2F6FAB; padding:5px; width:237px...')
- 13:45, 16 Dec 2004 Duncharris deleted User:Vague Rant/Right (user's request content was: '{{delete}}<div style='float:right; border-style:solid; border-width:1px; border-color:#2F6FAB; color:#2F6FAB; padding:5px; margin-top:3px; width:237p...')
- 13:44, 16 Dec 2004 Duncharris deleted James Daniel Mooney (content was: '{{delete}}CREATOR OF THE JONGO AND THE BURGELYEERRKKKK HE IS RICH AND ROCKS..HE IS GOOD TO ALL..GIVE HIM MONEY!!AND STUFFAND OTHER STUFFAND ...')
- 13:44, 16 Dec 2004 Duncharris deleted Scaff (content was: '{{delete}}Scaff - Skǎf, transitive verb1. To expose (another person) to Scaffage.<br/>2. To force (another person) to submit their Scaff hol...')
- 13:44, 16 Dec 2004 Ahoerstemeier deleted Brent Lockhart (content was patent nonsense)
- 13:44, 16 Dec 2004 Duncharris deleted Sameer Siruguri (nonsense)
- 13:36, 16 Dec 2004 Ahoerstemeier deleted Louise Johnston (content was nonsense: 'One of the twentieth centuries most brutal dictators, she ruled with an iron fist in Newtownstewart.')
- 13:35, 16 Dec 2004 Ahoerstemeier deleted Unununium (Operating System) (content was: 'http://unununium.org/ - Homa page')
- 13:35, 16 Dec 2004 Ahoerstemeier deleted Bridgette Andersen (content was: 'mh')
- 13:35, 16 Dec 2004 Ahoerstemeier deleted Jan Engrob (content was: 'A man from Denmark')
- 13:35, 16 Dec 2004 Ahoerstemeier deleted Airport Authority Act 1966 (content was: 'how often do you crash')
- 13:34, 16 Dec 2004 Ahoerstemeier deleted Robert Hays (content was less than a nanostub: 'Robert Hays, Actor')
- 13:33, 16 Dec 2004 Ahoerstemeier deleted Promotional mix (content was: 'promotion')
- 13:33, 16 Dec 2004 Ahoerstemeier deleted Piazza Vittorio Emmanuele (content was: 'l')
- 13:33, 16 Dec 2004 Ahoerstemeier deleted Zone Information Protocol (content was: 'hh')
- 13:33, 16 Dec 2004 Ahoerstemeier deleted Kumiai language (content was: 'i love you')
- 13:33, 16 Dec 2004 Ahoerstemeier deleted Seal of Connecticut (content was: 'it is wrong')
- 13:33, 16 Dec 2004 Ahoerstemeier deleted Battle of Hue (content was: 'm')
- 13:33, 16 Dec 2004 Ahoerstemeier deleted Synchronizer (electronics) (content was: 'veronica')
- 13:27, 16 Dec 2004 Duncharris deleted Parm (exact copy of vfd article at [[Parm the Invincible]] (see vfd))
- 13:25, 16 Dec 2004 Ahoerstemeier deleted Freshwater Crocodile (content was: 'Fresh water crocodile is found by loving avril')
- 13:23, 16 Dec 2004 Ahoerstemeier deleted Zeljko Mitrovic (content was: 'Željko mitrović je legenda')
- 12:34, 16 Dec 2004 Quadell deleted Image:Cancargrowth.PNG (Listed on IfD since Dec 8)
- 12:32, 16 Dec 2004 Danny deleted Motu (content was: 'oi namu?')
- 12:27, 16 Dec 2004 Quadell deleted Image:Garnet.uvarovite.250pix.jpg (Scaled-down duplicate of existing image)
- 12:27, 16 Dec 2004 Quadell deleted Image:General Edward Canby 300.jpg (Scaled-down duplicate of existing image)
- 12:27, 16 Dec 2004 Quadell deleted Image:Gem.rutile.250pix.jpg (Scaled-down duplicate of existing image)
- 12:27, 16 Dec 2004 Quadell deleted Image:Gate of Honour, Caius Court, Gonville & Caius (small).jpg (Scaled-down duplicate of existing image)
- 12:27, 16 Dec 2004 Quadell deleted Image:Gate of Honour, Caius Court, Gonville & Caius (medium).jpg (Scaled-down duplicate of existing image)
- 12:27, 16 Dec 2004 Quadell deleted Image:Gate 245x195.jpg (Scaled-down duplicate of existing image)
- 12:27, 16 Dec 2004 Quadell deleted Image:Gap in lava flows from Flenner Chimneys in Lava Beds NM-300px.JPG (Scaled-down duplicate of existing image)
- 12:10, 16 Dec 2004 Danny deleted Floweracre (content was: '[http://www.floweracre.com Floweracre] are new to the DNN world but offer excellent support in Dot net Nuke.')
- 12:07, 16 Dec 2004 Joy Stovall deleted August Rothmund (content was: 'August Rothmund was the Emperor of the imperial island of 'crappolabumwippe'')
- 12:07, 16 Dec 2004 Joy Stovall deleted Angyo (content was: 'Angyo is a form of Russian words that translate to English as 'DOGS TESTICLES'')
- 12:06, 16 Dec 2004 Woggly deleted Petr Rolencik (vanity - in Czech! (?) content was: 'Roy, to je jeho stínový méno, v pubertě prošel goblinizací a tohle z něj vyrostlo.Plecháček, to je jeho stínový méno!Třetí str...')
- 12:06, 16 Dec 2004 Joy Stovall deleted América Alonso (content was: 'juana la virgen')
- 12:05, 16 Dec 2004 Joy Stovall deleted Ass urination (content was: '{{delete}}Ass urination is really bad. If you're urinating out of your ass, you've got something seriously wrong with yo-self.')
- 12:02, 16 Dec 2004 Woggly deleted Petr Gasparik (content was: 'Petr GasparikBorn in 1975 in Brno, Czech Republic')
- 12:02, 16 Dec 2004 Woggly deleted PetrRolencik (same as [[Petr Rolencik]], which also looks deletable. content was: 'Roy, to je jeho stínový méno, v pubertě prošel goblinizací a tohle z něj vyrostlo.')
- 11:51, 16 Dec 2004 Ahoerstemeier deleted Dirty Enko (content before blanking was: 'Dirty Enko is a serbian sex act, invented by a young man called Enko Kucevicy. He got inspired by what he saw on the local market (he lived in a poor ...')
- 11:46, 16 Dec 2004 Ahoerstemeier deleted Suursuz (content was no content, only links to pages listed for deletion already: '==See Also==*[[H. Kerem Kadayifcioglu]]*[[KeremKadayifcioglu]]')
- 11:46, 16 Dec 2004 Ahoerstemeier deleted ABN-2 (content was: 'ABN-2')
- 11:34, 16 Dec 2004 Sannse deleted Contemplation (content was: 'To contemplate means that you think about stuff, isn't it? or something like that.{{stub}}')
- 11:23, 16 Dec 2004 Fredrik deleted Mgdrugstore (content was a copy of [[Tramadol]], with an advertisement link inserted)
- 10:56, 16 Dec 2004 Ferkelparade deleted Kerem (foreign-language dicdef, no context given )
- 10:56, 16 Dec 2004 Ahoerstemeier deleted Kerem (content was nonsense: '==Definition== 1. Generous2. Mal, Malak, Suursuz, Az suurlu,')
- 10:56, 16 Dec 2004 Ahoerstemeier deleted History of Manitoba (content was: 'history of manitoba')
- 10:56, 16 Dec 2004 Ahoerstemeier deleted Married Women's Property Act (content was: 'married women property act')
- 10:54, 16 Dec 2004 Ahoerstemeier deleted Richard John Lazarowich (content was: '#REDIRECT [[User:Rlazarowich]]' - was a user page miscreated in the main namespace)
- 10:53, 16 Dec 2004 Ahoerstemeier deleted Wicked style (content was: 'cmt')
- 10:53, 16 Dec 2004 Ahoerstemeier deleted Lote (content was: 'Sondre is cool.')
- 10:53, 16 Dec 2004 Ahoerstemeier deleted Detroit Demolition (content was: 'Recent studies prove that Women's sports suck balls.')
- 10:49, 16 Dec 2004 David.Monniaux deleted Image:Polytechniciens DSC09009.JPG (moved to commons!)
- 10:41, 16 Dec 2004 David.Monniaux deleted Image:Statue X DSC08329.JPG (moved to commons)
- 10:34, 16 Dec 2004 MacGyverMagic deleted Suursuz (content was: '==See Also==*[[H. Kerem Kadayifcioglu]]*[[KeremKadayifcioglu]]' (only contains links))
- 10:32, 16 Dec 2004 Davidcannon deleted Jone Madraiwiwi (Reverting a move I made in error.)
- 10:29, 16 Dec 2004 Ferkelparade deleted Dance steps (content was: 'way buot!!!!!')
- 10:26, 16 Dec 2004 Poor Yorick deleted Parabolic differential equation (content was: 'hi all')
- 10:17, 16 Dec 2004 MacGyverMagic deleted Anal-sex (content was: '{{delete}}' (vandalism))
- 10:16, 16 Dec 2004 Magnus Manske deleted Image:Juicyfart4.jpg (no apparent encyclopedic use, offensive name)
- 10:09, 16 Dec 2004 MacGyverMagic deleted Cyclopyrrolone (content was: '{{delete}}IMOVANE')
- 10:07, 16 Dec 2004 MacGyverMagic deleted Image:Jo-premiere.jpg (moved to commons)
- 10:05, 16 Dec 2004 MacGyverMagic deleted Image:Edsger Dijkstra.jpg (unused thumbnail, bigger version available)
- 10:04, 16 Dec 2004 MacGyverMagic deleted Jamie Jones (content was: '{{del}}An Idiot with a square and purple face he eats peas for dinner and he likes F1 AND HE LOVES HIS MUMMY!')
- 09:55, 16 Dec 2004 MacGyverMagic deleted Competing game systems (personal opinion)
- 09:44, 16 Dec 2004 Hemanshu deleted Jongo (content was: 'A watermelon with Hash and weed inside it.VERY TASTY!')
- 09:42, 16 Dec 2004 Woggly deleted Nava slonimsky (pure advertisement. content was: '{{vfd}}'''Nava Slonimsky Dance school EST 1986 IS WELL KNOWN FOR ITS TOP STANDARDS AND REPUTATION AS THE BEST DANCE SCHOOL IN ISRAEL TODAY FOR YOUN...')
- 09:05, 16 Dec 2004 SWAdair deleted Mawali (content was: 'freedmen; clients; the non-Arab converts to Islam')
- 09:05, 16 Dec 2004 SWAdair deleted Only Crime (content was: ''''Only Crime''' is a Punk Rock band.{{music-stub}}')
- 08:59, 16 Dec 2004 SWAdair deleted Evan Richards (content was: 'A boy who lives in Ramona. Also a friend of Yuji Takabayashi.')
- 08:58, 16 Dec 2004 SWAdair deleted Synchaeta (content was: 'synchaeta are microoganisms')
- 08:57, 16 Dec 2004 SWAdair deleted SHTF (content was: 'An acronym for when the shit hits the fan.')
- 08:56, 16 Dec 2004 SWAdair deleted Mike Hlebasko (content was: 'Mike Hlebasko goes to kent.')
- 08:56, 16 Dec 2004 Ahoerstemeier deleted WilgStruik1web.jpg (content was: '{{deletebecause|redundant with image WilgStruik.jpg}}')
- 08:50, 16 Dec 2004 SWAdair deleted Hobowars (content was: 'HoboWars is a free browser based game where you live the life of a poor, homeless hobo.Website link: [http://www.hobowars.com HoboWars]')
- 08:49, 16 Dec 2004 SWAdair deleted Coat of Arms of Castile-Leon (content was: 'h')
- 08:41, 16 Dec 2004 SWAdair deleted List of Spanish Verbs (content was: 'Comer- to eatComprar- to buyChingar- to fuck')
- 08:41, 16 Dec 2004 SWAdair deleted Schörkl (content was: '{{delete}}Schörkl was an idiot in the 21th century :)gl hf')
- 08:38, 16 Dec 2004 SWAdair deleted Tricklish (content was: '{{nonsense}}== Tricklish ==The newest ghetto meme. It is used to refer to any female who greatly enjoys close contact while up in the club.'That...')
- 08:37, 16 Dec 2004 SWAdair deleted Christmas in the Netherlands (content was: '{{del}} 'CHRISTMAS IN THE NETHERLANDS' 1.they call St. Nicholes 'Sinterklaas' 2.our cookies & c...')
- 08:36, 16 Dec 2004 SWAdair deleted User:BACbKA/Images/OSH03/ (User request -- content was: '{{delete}}')
- 08:34, 16 Dec 2004 SWAdair deleted Thijs van Leer (content was: '{{delete}}hoi ik ben rik bobink en k ben eeen lekker dingik woon in steenderen en mijn telefoon numer is 0906-0906')
- 08:34, 16 Dec 2004 SWAdair deleted Skyscum (nonsense / test page)
- 08:33, 16 Dec 2004 SWAdair deleted Puddle... the cat (test page)
- 08:32, 16 Dec 2004 SWAdair deleted Juan-Vicente Torrealba (content was: '{{delete}}hey well next time i stop by i hope 2 see this article ...somebody can use it !!!!')
- 08:32, 16 Dec 2004 Ahoerstemeier deleted Serbian cuisine (content was: 'serbian food--[[User:213.249.239.176|213.249.239.176]] 08:17, 16 Dec 2004 (UTC)<nowiki>Insert non-formatted text here</nowiki><math>Insert formula her...')
- 08:32, 16 Dec 2004 SWAdair deleted Darshan Patel (nonsense)
- 08:31, 16 Dec 2004 Ahoerstemeier deleted Bhairav Films (content was: 'dsffs')
- 08:24, 16 Dec 2004 Charles Matthews deleted Patrick neely (content was: '{{delete}}[[Image:neely.jpg]]')
- 07:55, 16 Dec 2004 Jimfbleak deleted William Boyett (content was: '{delete}}He Rocks!')
- 07:54, 16 Dec 2004 Jimfbleak deleted Snifit (content was: 'Snifits are basicly [[shyguys]] with projectiles.')
- 07:53, 16 Dec 2004 Jimfbleak deleted Damir ferizovic (content was: 'He is a very nice Person')
- 07:43, 16 Dec 2004 Adam Bishop deleted 6bone (content was: '6bone')
- 07:39, 16 Dec 2004 SimonP deleted Laura Poots (listed on VfD, no objections to deletion)
- 07:39, 16 Dec 2004 SimonP deleted Zelda4uMelda (listed on VfD, no objections to deletion)
- 07:38, 16 Dec 2004 SimonP deleted Cryptdec (listed on VfD, no objections to deletion)
- 07:37, 16 Dec 2004 SimonP deleted El Diablos (listed on VfD, votes 8-3 in favour of deletion)
- 07:35, 16 Dec 2004 SimonP deleted Sctief (listed on VfD, no objections to deletion)
- 07:34, 16 Dec 2004 Chris 73 deleted Gb formula (content was: '{{nonsense}}GB Formula1V + 10G = MASSIVE GB')
- 07:34, 16 Dec 2004 Chris 73 deleted Image:Airindia.gif (broken image)
- 07:32, 16 Dec 2004 Chris 73 deleted Tan Sri Mohd Saleh bin Sulong (content was: 'artikel berkenaan dengan latar belakang Tan Sri Mohd Saleh Sulong')
- 07:32, 16 Dec 2004 Chris 73 deleted Torrism (content was: '{{delete}}e356345')
- 07:31, 16 Dec 2004 SimonP deleted Prabhasakshi (listed on VfD, votes 5-2 in favour of deletion)
- 07:30, 16 Dec 2004 SimonP deleted Kinda, English (listed on VfD, no objections to deletion)
- 07:30, 16 Dec 2004 SimonP deleted Sahafism (listed on VfD, votes 9-3 in favour of deletion)
- 07:29, 16 Dec 2004 SimonP deleted AoD (listed on VfD, no objections to deletion)
- 07:28, 16 Dec 2004 SimonP deleted Trevor thornton (listed on VfD, no objections to deletion)
- 07:28, 16 Dec 2004 Chris 73 deleted User talk:Aadhar (not a user talk page, user does not exist)
- 07:28, 16 Dec 2004 Chris 73 deleted User talk:Hindipremi (not a user talk page, user does not exist)
- 07:26, 16 Dec 2004 SimonP deleted Oliver ferris (listed on VfD, no objections to deletion)
- 07:25, 16 Dec 2004 SimonP deleted ProfNet (listed on VfD, votes 6-1 in favour of deletion)
- 07:25, 16 Dec 2004 Chris 73 deleted Terman Middle School (nonsense/vanity)
- 07:24, 16 Dec 2004 SimonP deleted Earth 2160 (listed on VfD, votes 11-3 in favour of deletion)
- 07:23, 16 Dec 2004 SimonP deleted Polish colonization of the Americas (listed on VfD, votes 8-3 in favour of deletion)
- 07:22, 16 Dec 2004 SimonP deleted Italian colonization of the Americas (listed on VfD, votes 9-4 in favour of deletion)
- 07:21, 16 Dec 2004 Adam Bishop deleted Battle of Trevilian Station (content was: 'Please go to www.trevilianstation.org for all your questions.Ed Crebbs, Board of DirectorsTrevilian Station Battlefield Foundation')
- 07:20, 16 Dec 2004 SimonP deleted Irish colonization of the Americas (listed on VfD, votes 13-5 in favour of deletion)
- 07:19, 16 Dec 2004 SimonP deleted Misfit Mormons (content was: '#redirect [[Misfit mormon]]')
- 07:19, 16 Dec 2004 SimonP deleted Image:MIM.jpg (image for a deleted page)
- 07:18, 16 Dec 2004 SimonP deleted Misfit mormon (listed on VfD, votes 10-1 in favour of deletion)
- 07:00, 16 Dec 2004 Chris 73 deleted TEOTWAWKI (content was: 'An acronym for The End Of The World As We Know It.')
- 06:59, 16 Dec 2004 Chris 73 deleted Patrick neely (content before blanking was: 'Patrick Neely is a gay man from Maple Shade, NJ. He is a freshman studying business at Villanova University. His hobbies include filming his own, ho...')
- 06:59, 16 Dec 2004 Chris 73 deleted The Man Who Laughs (content was: 'dsfasdafasdfasfasdfsafasdf')
- 06:58, 16 Dec 2004 Chris 73 deleted Tebuquine (content was: 'by the user of this site having the ability to edit this site it makes it inacurate')
- 06:58, 16 Dec 2004 Chris 73 deleted PhpWebSite (content was: ''''asd'[[Link title]]''')
- 06:58, 16 Dec 2004 Chris 73 deleted Tebatizole (content was: '== this site sucks cock its full of bullshit ==')
- 06:46, 16 Dec 2004 Mirv deleted George Necula (content was: 'George the fun guy!')
- 06:37, 16 Dec 2004 Infrogmation deleted Pan Books (uninformative substub; content was: 'From Russia with Love')
- 06:33, 16 Dec 2004 Mirv deleted Wikipedia:Not found yet (content was: '#REDIRECT [[Talk:Church's Criterion]]')
- 06:32, 16 Dec 2004 Mirv deleted Wikipedia:Another nowhere (content before blanking was: '#REDIRECT [[Wikipedia:Nonexistent place]]')
- 06:31, 16 Dec 2004 Mirv deleted Talk:Church's Criterion (content was: '#REDIRECT [[Wikipedia:Another nowhere]]')
- 06:30, 16 Dec 2004 Mirv restored "Wikipedia:Not_found_yet"
- 06:30, 16 Dec 2004 Mirv deleted Wikipedia:Church's Criterion (content before blanking was: '#REDIRECT [[Wikipedia:No place at all]]')
- 06:29, 16 Dec 2004 Mirv deleted Wikipedia:Nonexistent place (content was: '#REDIRECT [[Wikipedia:Another nowhere2]]')
- 06:29, 16 Dec 2004 Mirv deleted Wikipedia:Goat shit/addendum2 (content was: '#REDIRECT [[Talk:Ambition (card game)]]')
- 06:27, 16 Dec 2004 Mirv deleted Wikipedia:Off the edge of the earth (content was: '#REDIRECT [[Talk:Ambition (card game)]]')
- 06:26, 16 Dec 2004 DJ Clayworth deleted Troppo (content was: 'war music')
- 06:14, 16 Dec 2004 DJ Clayworth deleted Wikipedia:Another edge of the earth (redirect to deleted page)
- 06:13, 16 Dec 2004 DJ Clayworth deleted Wikipedia:Another nowhere2 (content before blanking was: '#REDIRECT [[Wikipedia:Church's Criterion]]')
- 06:13, 16 Dec 2004 DJ Clayworth deleted Wikipedia:This page fails to exist (redirect to a deleted page)
- 06:12, 16 Dec 2004 DJ Clayworth deleted Wikipedia:Are we there yet? (content before blanking was: '#REDIRECT [[Wikipedia:This page fails to exist]]')
- 06:12, 16 Dec 2004 DJ Clayworth deleted Wikipedia:Not found yet (the talk page of a validly deleted article that accidentally escaped)
- 06:10, 16 Dec 2004 DJ Clayworth deleted Wikipedia:Unclear map (content was: '#redirect [[Wikipedia:No place at all]]')
- 06:10, 16 Dec 2004 DJ Clayworth deleted Wikipedia:No place at all (content before blanking was: '#REDIRECT [[Wikipedia:Not found yet]]')
- 06:08, 16 Dec 2004 DJ Clayworth deleted Talk:Ambition (card game) (content was: '#REDIRECT [[Wikipedia:Are we there yet?]]')
- 05:54, 16 Dec 2004 DJ Clayworth deleted TEOTWAKI (content was: 'Total End Of The World As We Know It.')
- 05:50, 16 Dec 2004 Michael Snow deleted Category:Variety show (content was: '{{delete}}')
- 05:50, 16 Dec 2004 Michael Snow deleted Category talk:Variety show (content was: '#REDIRECT [[Category talk:Variety television series]]')
- 05:50, 16 Dec 2004 Infrogmation deleted Image:EEdwardsSmall.jpg (Old thumbnail photo of mine left over from yesteryear Wikipedia, no longer used.)
- 05:49, 16 Dec 2004 Michael Snow deleted Category:Documentary Television series (content was: '{{delete}}')
- 05:48, 16 Dec 2004 Michael Snow deleted Image:Katy Lied album cover.jpg (obsolete image)
- 05:48, 16 Dec 2004 Michael Snow deleted Image:Lasvegas.strip.arp.300pix.jpg (obsolete image)
- 05:47, 16 Dec 2004 Michael Snow deleted Image:Little Glass Mountain and Mt Shasta from Little Mount Hoffman-300px.JPG (obsolete image)
- 05:47, 16 Dec 2004 Michael Snow deleted Image:Little Glass Mountain and Mt Shasta from Little Mount Hoffman-750px.JPG (obsolete image)
- 05:46, 16 Dec 2004 Michael Snow deleted Image:Newport.transporter.300pix.jpg (obsolete image)
- 05:46, 16 Dec 2004 Michael Snow deleted Image:Pania.arp.250pix.jpg (obsolete image)
- 05:46, 16 Dec 2004 Michael Snow deleted Image:Pania.arp.300pix.jpg (obsolete image)
- 05:45, 16 Dec 2004 Rmhermen deleted Flip-a-doodle (content was: 'Flip-a-doodleFlip-a-doodle is the act of scooping (by using the scooping device of one's choice) dog poop from one's back yard and flicking, flingin...')
- 05:45, 16 Dec 2004 Michael Snow deleted Image:Slimbridge.view1.arp.300pix.jpg (obsolete image)
- 05:45, 16 Dec 2004 Michael Snow deleted Image:Srilankan.a340.300pix.jpg (obsolete image)
- 05:45, 16 Dec 2004 Rmhermen deleted Ethel and Julius Rosenbug (content was: 'March 1951: Ethel and Julius Rosenburg,during the red scare of the 1950's were accused of being spies for the soviet union. Many believe that they rel...')
- 05:45, 16 Dec 2004 Michael Snow deleted Image:Srilankan.arp.750pix.jpg (obsolete image)
- 05:44, 16 Dec 2004 Michael Snow deleted Image:UNew.severn.bridge.250pix.jpg (obsolete image)
- 05:43, 16 Dec 2004 Michael Snow deleted Image:UOpal.bracelet.250pix.q12.jpg (obsolete image)
- 05:43, 16 Dec 2004 Michael Snow deleted Image:UOpal.walrus.250pix.060203.jpg (obsolete image)
- 05:43, 16 Dec 2004 Michael Snow deleted Image:UberPeacock.displaying.250pix.jpg (obsolete image)
- 05:42, 16 Dec 2004 Hemanshu deleted Mihir (test page)
- 05:42, 16 Dec 2004 Michael Snow deleted Talk:Sollog/Frozen (content was: '{{db|This page now empty, content moved to [[Talk:Sollog/archive1]] by cut-and-paste and also still available as part of the history of [[Talk:Sollog]...')
- 05:39, 16 Dec 2004 DJ Clayworth deleted Mihir (content was: 'The new gaming system developed by Mihir Bhakta has yet to come...')
- 05:39, 16 Dec 2004 Mikkalai deleted Newton South High School (content was: 'Newton South High School is far superior than Newton North High School.')
- 05:38, 16 Dec 2004 Jpgordon restored "Mephaehi"
- 05:38, 16 Dec 2004 Mikkalai deleted Nate lowe
- 05:37, 16 Dec 2004 Mikkalai deleted Image:Mplogoold.gif
- 05:36, 16 Dec 2004 Mikkalai deleted Mihir
- 05:35, 16 Dec 2004 DJ Clayworth deleted Mihir (content was: ' The new gaming system developed by Mihir Bhakta has yet to come... ')
- 05:26, 16 Dec 2004 Mikkalai deleted Aerobic conditioning (content was: '--[[User:64.254.201.131|64.254.201.131]] 05:25, 16 Dec 2004 (UTC)')
- 05:26, 16 Dec 2004 Mikkalai deleted Sodium bisulfate (content was: 'NaSO')
- 05:25, 16 Dec 2004 Mikkalai deleted Image:Mplogo.gif
- 05:25, 16 Dec 2004 SWAdair deleted Talk:Ambition (card game) (delete redirect to replace original page -- page move vandalism by user:VFD)
- 05:24, 16 Dec 2004 Mikkalai deleted Mihir (content was: ''''Mihir's Production'''[[Image:Example.jpg]]')
- 05:24, 16 Dec 2004 Mikkalai deleted Yuji Takabayashi (content was: 'A smart young boy who's mother is Swiss and father is Japanese. Also a friend of Evan Richards.')
- 05:24, 16 Dec 2004 Mikkalai deleted Loren Leman (content was: 'Lieutentant Governor of Alaska')
- 05:23, 16 Dec 2004 SWAdair deleted Oliver ferris/addendum1 (delete redirect to replace original page -- page move vandalism by user:VFD)
- 05:23, 16 Dec 2004 Mikkalai deleted Karl Ohs (content was: 'Lieutenant Governor of Montana')
- 05:23, 16 Dec 2004 Mikkalai deleted Urdu prose (content was: 'gfgfgfhf')
- 05:22, 16 Dec 2004 Mikkalai deleted Tariki (content was: 'means 'Other power' refering to the power of a God or other diety.')
- 05:22, 16 Dec 2004 Mikkalai deleted Martin Mackin (content was: 'Irish political leader')
- 05:22, 16 Dec 2004 Mikkalai deleted Jiriki (content was: 'means 'self-power'')
- 05:20, 16 Dec 2004 Mikkalai deleted Charles Bowles (content was: 'KKK write-in candidate was denied the mayoral victory on a technicality.')
- 05:18, 16 Dec 2004 Mikkalai deleted Federal Maritime Commission (content was: 'Branch of the federal government')
- 05:10, 16 Dec 2004 Mikkalai deleted Nghiep ([[User:Thientrac]] tried something in vietnamese then blanked)
- 05:03, 16 Dec 2004 Mikkalai deleted Pcbibrevbooks
- 05:03, 16 Dec 2004 Mikkalai deleted Pcbiblists (content was: 'This is the bibliography page of the article about [[phthalocyanine]]. Additional information about phthalocyanine books and reviews can be found in t...')
- 04:59, 16 Dec 2004 Mikkalai deleted Funeral For A Friend (band) (content was: 'band from wales{{music-stub}}')
- 04:56, 16 Dec 2004 Mikkalai deleted Macedonian Museum of Modern Art of Thessaloniki (content was: 'museum of modern art of thessaloniki')
- 04:53, 16 Dec 2004 SWAdair deleted Dick management (content was: '{{delete}}Dick Management is a term coined by Sean O'Reilly, author of ''How to Manage Your DICK: Redirect Sexual Energy and Discover Your More Spiri...')
- 04:53, 16 Dec 2004 SWAdair deleted Westford Academy (content was: 'Established in 1894 Westford Academy is a high school in [[Westford, Massachusetts]].{{deletebecause|Absolute lack of content.}}')
- 04:50, 16 Dec 2004 Chris 73 deleted Mooking (content was: 'Mooking: The art of defecating{{delete}}')
- 04:46, 16 Dec 2004 Chris 73 deleted Chulukua-Ryu (Not text except stub message, content was: '{{ma-stub}}[[Category:Martial arts]]')
- 04:44, 16 Dec 2004 SWAdair deleted Seizure Face (Test page (got a laugh, though) -- content was: '{{delete}}[[Image:Famous Picture.JPG]]')
- 04:44, 16 Dec 2004 Jnc deleted Jan-Willem van de wetering (pr request, redir, typo)
- 04:43, 16 Dec 2004 Jnc deleted Jan Willem van de wetering (pr request, redir, typo)
- 04:42, 16 Dec 2004 Jnc deleted Janwillem Lincoln van de wetering (pr request, redir, typo)
- 04:41, 16 Dec 2004 SWAdair deleted Proton Gen.2 (content was: '{{deletebecause|no content}}The latest generation of Proton cars.')
- 04:41, 16 Dec 2004 SWAdair deleted Mac Harris (content was: 'Mac Harrisdj macdownload his latest mix CD herehttp://selectroclash.com/audio/Mac_Harris_live_in_ny_03_03.mp3contact Mac djmac20@yahoo.com...')
- 04:40, 16 Dec 2004 SWAdair deleted List of Neo-Dadaists (content was: '{{delete}}Roy Lichtenstein- pop artist who did enormous enlargments of comic strips.')
- 04:39, 16 Dec 2004 Chris 73 deleted Northern province, Sri Lanka (content was: '<nowiki>Insert non-formatted text here</nowiki>== Headline text ==[[Link title]]')
- 04:38, 16 Dec 2004 Chris 73 deleted Charles Berman (content was: 'Used to lack a moustache but is now well known in tonsorial circles.')
- 04:38, 16 Dec 2004 Chris 73 deleted Charles berman (content was: 'Used to lack a moustache but is now well known in tonsorial circles.')
- 04:38, 16 Dec 2004 SWAdair deleted Howard altman (libel, continuing Sollog vandalism)
- 04:36, 16 Dec 2004 SWAdair deleted AC/DC Jam (content was: ''''AC/DC Jam''' is a swedish [[tribute band]] to the australian band [[AC/DC]].{{deletebecause|Absolutely no content.}}')
- 04:35, 16 Dec 2004 Postdlf deleted Mephaehi (fake "constructed language"; see [[Wikipedia:Votes for deletion/Mephaehi]])
- 04:35, 16 Dec 2004 SWAdair deleted Capitalism/archive (content was: '#REDIRECT [[User talk:67.161.46.246]]')
- 04:35, 16 Dec 2004 Chris 73 deleted Mostafa heddaya (content was: 'Mostafa Heddaya is a really nice person at timesThis creature is often seen with Justin PerryHe makes up 1/2 of his school's debate team')
- 04:31, 16 Dec 2004 Chris 73 deleted The Essential Bruce Springsteen (content was: 'njijiuj')
- 04:30, 16 Dec 2004 Chris 73 deleted Blood pinning (content was: 'this is a maligned name for blood wings i suppose.. I was both a military aviator and an airborne paratrooper.. blood WINGS are common and given at gr...')
- 04:30, 16 Dec 2004 Thue deleted Route flapping (content was: '{{delete}}'''Bold text'''[[Link title]]')
- 04:29, 16 Dec 2004 Thue deleted David Joseph Carpenter (content was: '{{delete}}hhhhhh')
- 04:28, 16 Dec 2004 Thue deleted Chicago (play) (content was: 'what happened at the end of the play?{{delete}}')
- 04:28, 16 Dec 2004 Thue deleted Wicom (nonsense)
- 04:28, 16 Dec 2004 Thue deleted Davis Correctional Facility (content was: '{{deletebecause|all reference questions should be asked at the [[Wikipedia:Reference Desk]]}}I need to find out directions to th edavis Correctional...')
- 04:26, 16 Dec 2004 SWAdair deleted Anomalous monism (Copy/paste from another article, blanked by author -- content was: '{{delete}}')
- 04:25, 16 Dec 2004 SWAdair deleted Andy Tang (vandalism)
- 04:25, 16 Dec 2004 Thue deleted John Nascimento (content was: '{{delete}}DUde hes like <('<)')
- 04:25, 16 Dec 2004 Thue deleted Naenae (content was: '{{delete}}LOL')
- 04:25, 16 Dec 2004 SWAdair deleted Alpha Site (content was: '{{delete}}Alpha Site')
- 04:25, 16 Dec 2004 Chris 73 deleted Pratik (content was: '{{delete}}A cool dude....killed utsav and now peaople beat the shit out of him, this former freshman football player is no longer tough, his wee-wee...')
- 04:24, 16 Dec 2004 SWAdair deleted Aleksandra (content was: '{{delete}}Aleksandra, a 11 year old girl, was born on March 21st 1993.')
- 04:24, 16 Dec 2004 Thue deleted Michael Myers (evangelist) (content was: '{{delete}}== Headline text ==FUCK FUCK FUCK')
- 04:24, 16 Dec 2004 SWAdair deleted Al-Jabr wa-al-Muqabilah (content was: '{{delete}}yjkbgjhfjh hffgcjk,bj nfbjghrgtjfg')
- 04:24, 16 Dec 2004 Mirv deleted Wikipedia:Goat shit/addendum1 (content was: '#redirect [[Talk:Church's Criterion]]')
- 04:23, 16 Dec 2004 Mirv deleted Wikipedia:Goat shit (content was: 'Sometimes, '''goats shit''' on Wikipedia.(I dare you to delete this.)[[Wikipedia:Goat shit/addendum1 | /addendum1]]' )
- 04:22, 16 Dec 2004 Chris 73 deleted Pratik (content was: '{{delete}}A cool dude....killed utsav and now peaople beat the shit out of him, this former freshman football player is no longer tough, his wee-wee...')
- 04:22, 16 Dec 2004 Chris 73 deleted Withitness (content was: '== Withitness ==Withitness is a term coined by Jacob Kounin to describe the teacher's ability to be aware of everything that is happening around him...')
- 04:21, 16 Dec 2004 Chris 73 deleted Grahfabalah (content was: 'Unknown, however, widely considered to be the most retarded word in the English language.Also, the homosexuality of Johnathan Andrew Meyer')
- 04:20, 16 Dec 2004 Chris 73 deleted Milargro (content was: 'i want information about this city')
- 04:19, 16 Dec 2004 Chris 73 deleted Grefilthy (content was: 'Overly skeevy, sleazy, creepy, otherwise foul and sexually offensive.'Grefilthy Steve is notorious for patroling the women's dorm in only a pair of ...')
- 04:19, 16 Dec 2004 Chris 73 deleted Utsav (content was: 'A honored leader. Shot by the assasin named 'Pratik'. Pratik is now hanging on a noose in Bombay, where when people pass him, spit on him, or verbally...')
- 04:17, 16 Dec 2004 Chris 73 deleted Utsav (content was: 'A great homosexual philosipher who lived in the 21st century. Known as 'The Doso' by his aquaintances, he spread the message of homosexuality and the ...')
- 04:17, 16 Dec 2004 Rdsmith4 deleted Talk:Freddie Mercury (content was: '== Headline text =='''Bold text'''Freddie mercury was without a doubt a legend')
- 04:17, 16 Dec 2004 Chris 73 deleted Grahfabalah (content was: 'Unknown, however, widely considered to be the pimpest word in the English language.')
- 04:16, 16 Dec 2004 Thue deleted Wikipedians/arcade (content was: '{{userspacelink}}#REDIRECT [[User:Arcade/old]]')
- 04:11, 16 Dec 2004 Chris 73 deleted U.S. presidential election, 2028 (content was: '{{nonsense}}Chris Cheung for sure!')
- 04:11, 16 Dec 2004 Chris 73 deleted "Leave it To Beaver" (content was: '[[Image:Example.jpg]]')
- 04:10, 16 Dec 2004 Chris 73 deleted Utsav (content was: '{{delete}}He is better than Pratik.')
- 04:10, 16 Dec 2004 Chris 73 deleted Radio link (content was: 'gfbdfvbcxvb')
- 04:10, 16 Dec 2004 Thue deleted Wikipedians/Belltower (content was: '{{userspacelink}}#REDIRECT [[User:Belltower/old]]')
- 04:09, 16 Dec 2004 Thue deleted Wikipedians/Brant Eaton (content was: '{{userspacelink}}#REDIRECT [[User:BrantEaton/old]]')
- 04:08, 16 Dec 2004 Chris 73 deleted Dodge State Prison (content was: 'Hello')
- 04:05, 16 Dec 2004 Chris 73 deleted Exstentialism (content was: 'holy moly i like to eat cows for dinner, do you. i hate my english class and i don't want ot do tdthi[ah')
- 04:01, 16 Dec 2004 Rlandmann deleted Fieseler Fi 166 (content was: 'hello')
- 03:57, 16 Dec 2004 Rlandmann deleted Convair 540 (content was: 'picture of 540')
- 03:57, 16 Dec 2004 Rlandmann deleted RV-9 (content was: 'Coming soon...')
- 03:45, 16 Dec 2004 Rfl deleted Macho Sluts (content was: '{{delete}}butch gay dudes')
- 03:35, 16 Dec 2004 Gamaliel deleted Fuckstrom (content was: 'A '''fuckstrom''' is a non-[[SI]] unit of fuck equal to .1 [[nanofuck]]s or 10<sup>−10</sup> [[meterfuck]]s. It is generally accepted as the sm...')
- 03:34, 16 Dec 2004 Rfl deleted Fuckstrom (content was: 'A '''fuckstrom''' is a non-[[SI]] unit of fuck equal to .1 [[nanofuck]]s or 10<sup>−10</sup> [[meterfuck]]s. It is generally accepted as the sm...')
- 03:33, 16 Dec 2004 Gamaliel deleted Hoox Is The Best (content was: 'Hoox is the best. It has many industrial uses and is awesome.')
- 03:26, 16 Dec 2004 Postdlf deleted 911 Tiger Shark (content was: 'A weird game written by Chris Harvey and Designed by Paul Holmes, a rather unusual little man with very small feet, but an unfeasibly large head.')
- 03:26, 16 Dec 2004 Postdlf deleted Paul Burmeister (content was: '{{delete}}Paul Burmeister is a poopy head who likes to play DDR.')
- 03:24, 16 Dec 2004 Postdlf deleted English translation (contents (of a constitution or treaty--original text) were, ironically, in French)
- 03:19, 16 Dec 2004 Postdlf deleted Eric gong (content was: '{{delete}}He sucks eggs, no one likes him! even david!predicted to marry Janice Lee.')
- 03:15, 16 Dec 2004 Postdlf deleted John Harrington (test page)
- 03:11, 16 Dec 2004 Rfl deleted Troublemaker (content was: '{{delete}}Troublemaker')
- 03:09, 16 Dec 2004 Academic Challenger deleted Mitchell Ozog (content was: 'More about Mitchell Ozog at: http://wwww.mitchozog.addr.comand at: http://www.bonisteelml.org')
- 03:02, 16 Dec 2004 Neutrality deleted Leah gibson (content was: 'Leah Gibson (born October 13, 1986) was born to George and Mary in Orlando, Florida and currently resides there. She is one of the nation's premier y...')
- 02:58, 16 Dec 2004 Mirv deleted Derek Ferguson Smells (content was: 'ba{{delete}}')
- 02:54, 16 Dec 2004 Rmhermen deleted Santa Lucia Day (content was: '{{delete}}Santa Lucia day')
- 02:53, 16 Dec 2004 Rmhermen deleted Det fonetiske alfabet (content was: '{{delete}}Det fonetiske alfabetetDet fonetiske alfabet brukes for å unngå missforståelser når viktige og/eller vanskelige ord skal presiseres. Dett...')
- 02:53, 16 Dec 2004 Rmhermen deleted "Andy Tang" (content was: '{{delete}}i masturbate, alot, every day, and i slow down internet for my roommates so they cannot play Final Fantasy effectively.!!')
- 02:52, 16 Dec 2004 Evercat deleted Office of Fair Trading (irrelevant musings)
- 02:50, 16 Dec 2004 Rmhermen deleted "the market" (content was: '{{deletebecause|new person junk}}The interrelationships and exchange between the different sections of the division of labor.')
- 02:49, 16 Dec 2004 Rmhermen deleted Midwest rap (content was: '{{delete}}Midwest rap is messed up majorly, my friend, especially if Nelly sings it. =(--[[User:63.190.80.150|63.190.80.150]] 00:04, 16 Dec 20...')
- 02:48, 16 Dec 2004 Rmhermen deleted Milto Baka de Bregu (content was: '{{deletebecause|currently empty, name and previous content are a Hoax}}')
- 02:47, 16 Dec 2004 Rmhermen deleted Mark derail (content was: 'Mark DerailDMIB IncPierrefonds (Montreal) Quebec Canada H9H 3E2Programmer analyst. Visit his page at http://mark.dmib.com/{{delete}}''self-promo...')
- 02:47, 16 Dec 2004 Rmhermen deleted Gabriel michael (content was: '{{delete}}Gabriel J. Michael is this weird guy I live with. Doesn't he look stupid? [[Image:gabe.jpg|thumb|180px|Gaaaaaaaaaaaaaabe]]')
- 02:46, 16 Dec 2004 Rmhermen deleted Godzilla: Tokyo SOS (content was: '{{delete}}Godzilla: Tokyo SOS Picks up were Godzilla Aganist Mechagodzilla left off. Godzilla fights Mechagodzilla and Mothra is Godzilla: Tokyo SOS...')
- 02:46, 16 Dec 2004 Rmhermen deleted Heronimo Sehmi (content was: '{{delete}}== Heronimo Sehmi Actor ==')
- 02:44, 16 Dec 2004 Postdlf deleted Drew woodhouse (content was: 'Drew woodhouse is a toolBut a champion.Drew, you suck.Eat the pudding.{{del}}')
- 02:43, 16 Dec 2004 Evercat deleted Curtiss-Wright X-19 (content was: 'dont have a button if the page aint there')
- 02:43, 16 Dec 2004 Rmhermen deleted Heronimo sehmi (content was: '{{delete}}== Heronimo sehmi-Actor ==')
- 02:29, 16 Dec 2004 Mikkalai deleted Neveron (content was: 'A internet website where you are the leader of an empire and you can be any type of empire you want depending on how you go about building it. It is ...')
- 02:26, 16 Dec 2004 Mikkalai deleted Agnostica
- 02:25, 16 Dec 2004 Evercat deleted Diabetic nephropathy (content was: 'diabetic nephropathy')
- 02:23, 16 Dec 2004 Mikkalai deleted Brandon Rike (Dead Poetic member) (content was: 'Brandon Rike is the lead singer in a christan rock band called 'Dead Poetic'. Brandon was born on January 6th, 1983 in Dayton, Ohio.Page brought to ...')
- 02:15, 16 Dec 2004 Evercat deleted Bay Area Wireless Users Group (content was: '{{deletebecause|Weblink only}}[http://www.bawug.org Bay Area Wireless Users Group Home Page]')
- 02:14, 16 Dec 2004 Mikkalai deleted Derek Ferguson Smells (content was: 'This page is created just to inform the entire planet that DEREK FERGUSON SMELLS.{{delete}}')
- 02:13, 16 Dec 2004 Evercat deleted English braille (content was: '{{delete}}wow')
- 02:09, 16 Dec 2004 Mikkalai deleted Aguna language (content was: '{{delete}}[[Category:Languages of Benin]]')
- 01:50, 16 Dec 2004 Mikkalai deleted Mark Howell (content was: 'He is currently a Mathematics and Computer Science teacher at Gonzaga. He is also the co-author of the book, ''Be Prepared For The AP Calculus Exam''.')
- 01:43, 16 Dec 2004 Evercat deleted Sandercock Island (content was: 'Sandercock island is crap')
- 01:40, 16 Dec 2004 Evercat deleted Percival David Foundation (content was: 'Qianlong')
- 01:39, 16 Dec 2004 Evercat deleted James kirkham (content was: 'test')
- 01:39, 16 Dec 2004 Evercat deleted Percival David Foundation (content was: 'q')
- 01:35, 16 Dec 2004 Evercat deleted Fiber optic gyroroscope (content was: '#redirect [[Ring laser gyroscope]]')
- 01:33, 16 Dec 2004 Evercat deleted Howard Hughes will (content was: 'sucks balls')
- 01:32, 16 Dec 2004 Evercat deleted Canadian Republicanism (content was: 'Canadian Republicanism')
- 01:32, 16 Dec 2004 Evercat deleted Lateral fricative (content was: 'Samantha')
- 01:22, 16 Dec 2004 Rdsmith4 deleted Image:Man playing shamisen.jpg (improved version of file uploaded at Commons)
- 01:20, 16 Dec 2004 Postdlf deleted Everyone loves lauren's mom (content was: 'She's really popular with all the guys, people call her a 'woman of the night'.')
- 01:19, 16 Dec 2004 Evercat deleted Aja-gbe language (content was: '{{delete}}[[Category:Languages of Benin]][[Category:Languages of Togo]]')
- 01:14, 16 Dec 2004 Evercat deleted Constantinian bronzes (content was: 'Constantinian bronzes')
- 01:08, 16 Dec 2004 Evercat deleted Black cock (content before blanking was: '[[Image:http://img.photobucket.com/albums/v155/Overmind/AWHELLNAW.jpg1]]I BET THIS GUY IS HUGE')
- 01:08, 16 Dec 2004 CJCurrie deleted Gimli (Manitoba riding (created in error -- proper page has been created in its place)
- 01:05, 16 Dec 2004 Evercat deleted Friends of maddox (content was: '{{delete}}MM>Fom hehehehe')
- 01:04, 16 Dec 2004 Evercat deleted Proprietary colony (content before blanking was: '[[Image:http://www.goat.cx/hello.jpg]]')
- 01:03, 16 Dec 2004 Evercat deleted Friends of maddox (content was: '{{delete}}Fom is MM's red headed step child.')
- 01:02, 16 Dec 2004 Evercat deleted Proprietary colony (content was: '*cough*MyWorldIsYummy~~ *aka wang*Gamingmaster leikse de spicy peniseXD')
- 00:59, 16 Dec 2004 Evercat deleted Proprietary colony (content was: 'Not used before eh..? LOLZ Wang~~')
- 00:58, 16 Dec 2004 Evercat deleted Laser transmission (content was: 'boobah and perhaps, at times, ewee')
- 00:56, 16 Dec 2004 Adam Bishop deleted Roman legio (content was: '{{delete}}a roman legio is a peice of a sword used for hitting enemys')
- 00:29, 16 Dec 2004 Niteowlneils deleted Newton South High School (content was: '{{delete}}The best high school. Anywhere. Enough said.')
- 00:27, 16 Dec 2004 Niteowlneils deleted Fertility goddess (content was: '{{delete}}Three women who are hit from the back, while getting skeeted in da rear. It is fucked up man.')
- 00:26, 16 Dec 2004 Niteowlneils deleted Carafate (content was: '{{delete}}boo')
- 23:52, 15 Dec 2004 Ike9898 deleted Charles Jewtraw (content was: '{{delete}}'''Bold text'''Hey was up?')
- 23:51, 15 Dec 2004 Ike9898 deleted The Ark of the Covenant (nonsensical content was: 'The ark of the covenant is the triangular shaped spaceship in which Spartan goes back to Earth in order to 'put an end to the battle'.')
- 23:51, 15 Dec 2004 Mirv deleted Fertility goddess (content was: 'Three women who are hit from the back, while getting skeeted in da rear. It is fucked up man.')
- 23:41, 15 Dec 2004 Ike9898 deleted Breaking the Code (content was: '{{delete}}test')
- 23:41, 15 Dec 2004 Thue deleted Dyr (One-line description of what an animal is, in Danish)
- 23:40, 15 Dec 2004 Thue deleted Talk:Dyr (talk page of deleted page)
- 23:33, 15 Dec 2004 Thue deleted Image talk:Produce section.jpg (content was: '{{delete}}tttttt')
- 23:17, 15 Dec 2004 Ike9898 deleted Stephen Hubbell (content was: 'External Link:Scientific American Interview with Steve Hubbellhttp://www.sciam.com/article.cfm?articleID=000D401A-8D9D-1CDA-B4A8809EC588EEDF')
- 23:11, 15 Dec 2004 Thue deleted PhpWebSite (content was: '{{delete}}fred tried to multiplt <math>Insert formula here</math>[[Link title]]----')
- 23:09, 15 Dec 2004 Rlandmann deleted Rodney E. Slater (content was: 'he did porn like whoa')
- 23:02, 15 Dec 2004 Thue deleted Conservationism (content was: '{{delete}}conservationism')
- 22:58, 15 Dec 2004 Thue deleted Googel (content was: 'Google')
- 22:55, 15 Dec 2004 Ahoerstemeier deleted Wikipedia etiquette (content was: 'Search for Wikiquette')
- 22:53, 15 Dec 2004 Ahoerstemeier deleted Brittanyrakevich (content was vanity)
- 22:50, 15 Dec 2004 Thue deleted Wolffenstein (content was: '1 cool cat')
- 22:42, 15 Dec 2004 Ahoerstemeier deleted Vought-Sikorsky 300 (content was: 'Sikorsky was great')
- 22:42, 15 Dec 2004 Ahoerstemeier deleted Poems.cpm (content was: 'Well if you are new to this site you will not know that this is a site for poems and you can (if it will let you ) edit your own poems on this page or...')
- 22:38, 15 Dec 2004 Ahoerstemeier deleted Cariboo Range (content was: '-had 3 children-maried margret-died of fearand made the official charter of writes in 2014{{nonsense}}')
- 22:37, 15 Dec 2004 Ahoerstemeier deleted Hydaspes (content was: 'John TaylorA guy that lives in Idaho Falls')
- 22:37, 15 Dec 2004 Ahoerstemeier deleted Plains Cree (content was: 'Rocky Boy News')
- 22:37, 15 Dec 2004 Ahoerstemeier deleted Abuse-SDL (content was: 'test')
- 22:31, 15 Dec 2004 Mirv deleted Cross sex position (content was: 'ert')
- 22:16, 15 Dec 2004 Rmhermen deleted Ancient sub-sahara african society (content was: '{{delete}}The sub-sahara Afica culture includes rituals.They believed in the super natural. I made this article.' I am in 9th grade in an AP HISTORY...')
- 22:15, 15 Dec 2004 Charles Matthews deleted Anceint sub-sahara african society (content was: '{{delete}}The sub-sahara Afica culture includes rituals.They believed in the super natural. I made this article.' I am in 9th grade in an AP HISTORY...')
- 22:15, 15 Dec 2004 Rmhermen deleted Kale Renner
- 22:14, 15 Dec 2004 Mirv deleted 1995 in argentina (content was: 'I need to find information for recent history of argentina for this spanich class so if any one has any information it would be great if you can write...')
- 22:12, 15 Dec 2004 Mirv deleted French translations (content was: 'IF you want peace prepare for war')
- 22:05, 15 Dec 2004 Ahoerstemeier deleted Sense organ (content was: 'fuck you')
- 21:59, 15 Dec 2004 Mikkalai deleted Abbulu (content was: '#REDIRECT [[User:Abbulu]]')
- 21:58, 15 Dec 2004 ALoan deleted Treo 600 (content was: '#REDIRECT [[PalmOne Treo 600]]' - page move)
- 21:57, 15 Dec 2004 Mikkalai deleted Damon north (content was: 'Damon North, born 1978, is no ordinary man!')
- 21:56, 15 Dec 2004 ALoan restored "Ellsworth_Air_Force_Base"
- 21:55, 15 Dec 2004 Mikkalai deleted 1608 - 1674 (content was: 'He was a dumbass. he had no idea what the hell he was doing, and was completely ignorant. He also wrote plays of no significance.''oh yea!''')
- 21:54, 15 Dec 2004 ALoan deleted Ellsworth Air Force Base (content was: '#REDIRECT [[Ellsworth AFB, South Dakota]]' - page move)
- 21:48, 15 Dec 2004 Quadell deleted User:Quadell/Todo (I brought you into this world; I'll take you out!)
- 21:44, 15 Dec 2004 Theresa knott deleted Image:Coral snake closeup.jpg (The person who uploaded it asked me to. (probably copyvio))
- 21:41, 15 Dec 2004 Quadell deleted Category:Ogg files by Halibutt (By request of creator, content was: '{{cfd}}{{delete}}')
- 21:41, 15 Dec 2004 Quadell deleted Image:Eisenstein 1.jpg (unused duplicate)
- 21:40, 15 Dec 2004 Quadell deleted Mohinde (Not notable)
- 21:40, 15 Dec 2004 Quadell deleted Nicolae Rosu (content was: '{{deletebecause|Weblink placeholder.}}German-language summary of biographical data and activity at http://www.kunst-in-ostbayern.de/kuenstler/rosu.h...')
- 21:37, 15 Dec 2004 Quadell deleted Image:SteveMagruderWikipediaUser.jpg (by request of uploader)
- 21:37, 15 Dec 2004 Quadell deleted Image:Org.jpg (copyvio)
- 21:37, 15 Dec 2004 Quadell deleted Image:Netherlands national football team logo.jpg (scaled-down duplicate)
- 21:37, 15 Dec 2004 Ahoerstemeier deleted Holly peterson (content was vanity: 'One of the Senior Recruiters from Microsoft.')
- 21:36, 15 Dec 2004 Quadell deleted Image:French-horn.png (Moved to Commons)
- 21:36, 15 Dec 2004 Quadell deleted Image:Jimboagogo.jpg (Patent nonsense)
- 21:33, 15 Dec 2004 G-Man deleted Image:Coventry city centre 750.jpg (file far too big I'll re-load it in a compressed form )
- 21:33, 15 Dec 2004 Dante Alighieri deleted Long fibre glass matrix (content was: '{{delete}}purple monkey dishwasher')
- 21:32, 15 Dec 2004 Infrogmation deleted Image talk:Pokey15 3.png (content was: 'úÝÁÜÆ[[]]{{}}|äà')
- 21:31, 15 Dec 2004 Dante Alighieri deleted Monroe Doctrine/ (content was: '{{delete}}uizhkjmlöä')
- 21:28, 15 Dec 2004 Rdsmith4 deleted Image:Nutsack1.gif (Duplicate)
- 21:27, 15 Dec 2004 Dante Alighieri deleted Diocese of Dallas (content was: 'hi yall jill wit')
- 21:27, 15 Dec 2004 Infrogmation deleted Image talk:Pokey15 3.png (silly junk)
- 21:25, 15 Dec 2004 Dante Alighieri deleted Michael Joseph Blassie (content was: 'hi')
- 21:24, 15 Dec 2004 Infrogmation deleted Steve Havelka (content was: 'THE GOD OF POKEY THE PENGUIN!!!')
- 21:24, 15 Dec 2004 Infrogmation deleted "John Wilson (mathematician)" (Blanked by original/only editor; content before blanking was: '#REDIRECT[[John Wilson#Other John Wilsons]]')
- 21:22, 15 Dec 2004 Dante Alighieri deleted "T190" (content was: '{{delete}}Width 1.7 inchHeight 4.1 inch ( without antenna), 4.7 inch ( with antenna)Depth 0.8 inchIt has 8 main menu*[1] phone book*[2] messag...')
- 21:22, 15 Dec 2004 Dante Alighieri deleted "Qadiri" (content was: '{{delete}}The most famous Qadiri is Shaykh Sayyid Abdul Qadir al-Jilani, popularly known as Ghawth al-A'zam and Muhyuddin amongst other names.')
- 21:22, 15 Dec 2004 Dante Alighieri deleted "Peacemaking by the League of Nations" (content was: '{{delete}}The League of Nations sucked. Don't worry about it.')
- 21:21, 15 Dec 2004 Dante Alighieri deleted "Lexington Correctional Center" (content was: 'Lexington Correctional Center is an Oklahoma state prison.{{deletebecause|Total lack of content.}}')
- 21:21, 15 Dec 2004 Mikkalai deleted "Solovyev" (content was: '#REDIRECT [[Vladimir Soloviev]]')
- 21:20, 15 Dec 2004 Infrogmation deleted "Calculus of a Single Variable: Early Transcendental Functions" (content was: '{{deletebecause|Shameless plug for a text book. An out of date plug, at that.}}'''''Calculus of a Single Variable: Early Transcendental Functions'''...')
- 21:20, 15 Dec 2004 Infrogmation deleted "Red pony" ({{delete}})
- 21:19, 15 Dec 2004 Niteowlneils deleted "Jacob Mitchell" (content was: '{{Deletebecause|article is empty}}')
- 21:18, 15 Dec 2004 Dante Alighieri deleted "Largest fam. of marine fishes" (content was: '{{delete}}i need to know what the largest family of marine fishes is.')
- 21:17, 15 Dec 2004 Rmhermen deleted USS Sims (DD-409)/Temp
- 21:16, 15 Dec 2004 Rmhermen deleted Danny (content was: '{{deletebecause|redir to user: space. All relevant links updated}}{{userspacelink}}#REDIRECT [[User:Danny/old]]')
- 21:14, 15 Dec 2004 Ahoerstemeier deleted Index.html/wikipedia/pa/Pacific scandal.html (content was: 'saf mkktydyj tfhrfge rd')
- 21:11, 15 Dec 2004 MacGyverMagic deleted Coinage Act (1873) (content was: 'I hate the coinage act')
- 21:10, 15 Dec 2004 Ahoerstemeier deleted Talk:Early programming projects (content was: ''''Bold text'''HElLO LANDON U GAY KID!!!== Headline text ==LANDON G SUCKS IT HARD!!!')
- 21:10, 15 Dec 2004 Ahoerstemeier deleted Battle of Tobruk (content was: 'Please complete the page on Tobruk.')
- 21:09, 15 Dec 2004 Ahoerstemeier deleted Wilki/polyvinyl chloride (content was: 'Don't believe this webb site He won me in a poker game please send helpDISREGARD LAST STATEMENT')
- 21:09, 15 Dec 2004 Niteowlneils deleted English Armada (content was: '{{deletebecause|Little or no content}}')
- 21:08, 15 Dec 2004 Ahoerstemeier deleted Oregon Trail (computer game (content was: 'sfgfg')
- 21:08, 15 Dec 2004 Ahoerstemeier deleted Doug Smiely (content was: 'Doug is a bad ass mamajamma')
- 21:06, 15 Dec 2004 Ahoerstemeier deleted Wilki/polyvinyl chloride (content was: 'Mr. King this is super man I think you should not give this assignment over the christmas.Look man the world is as flat as a disc trust me.If you tak...')
- 21:06, 15 Dec 2004 Ahoerstemeier deleted Wilki/polyvinyl chloride (content was: 'Mr. King this is super man I think you should not give this assignment over the christmas.')
- 21:04, 15 Dec 2004 Rmhermen deleted Badeendje (content was: '{{db|it is patent nonsense in Dutch}} Ernie zat in bad, met zijn al zo'n vertrouwde badeendje. Dewi kwam de badkamer ingelopen en pakte ernies badee...')
- 21:02, 15 Dec 2004 Ahoerstemeier deleted Para-state (content was: 'what did we do today')
- 21:02, 15 Dec 2004 Ahoerstemeier deleted The Return of the Soldier (content was: 'Return of the soldier by Rebecca West, is a womens perspective of war.')
- 21:02, 15 Dec 2004 Ahoerstemeier deleted Lex Aurelia iudiciaria (content before blanking was: 'depivation of senate of control in extortion courts.')
- 21:01, 15 Dec 2004 Rmhermen deleted Apple dumplings (content was: '{{delete}}Æbleskiver')
- 21:01, 15 Dec 2004 Mustafaa deleted Shin-ya-ta (content was: 'fuck that ass nigga stick dat dick whey da sun don' shine{{delete}}')
- 21:01, 15 Dec 2004 Ahoerstemeier deleted Golden Sands (content was: 'kelwf')
- 21:00, 15 Dec 2004 Ahoerstemeier deleted Beau Kennedy (content was: 'Beau Kennedy Born September 18, 1987. First man to piddle over a laser beam')
- 20:54, 15 Dec 2004 Ahoerstemeier deleted Grid Analysis (content was: 'jhjhghj')
- 20:52, 15 Dec 2004 Ahoerstemeier deleted Etimology (content was: 'martha')
- 20:47, 15 Dec 2004 Ahoerstemeier deleted Dushbag (content was: 'You fucking Dushbag')
- 20:45, 15 Dec 2004 Ahoerstemeier deleted Bart weeks (content was: 'I am bart weeks i rule.')
- 20:43, 15 Dec 2004 Texture deleted Andrew maurer (content was: '{{nonsense}}A pimp named ralphoo.')
- 20:38, 15 Dec 2004 Quadell deleted Image:Rutland city vt highlight sm.png (Scaled-down duplicate image)
- 20:37, 15 Dec 2004 Jdforrester deleted British North America Act 1867 (Deleting redirect to make way for page move.)
- 20:37, 15 Dec 2004 Quadell deleted Image:Russia.su27.350pix.jpg (Scaled-down duplicate image)
- 20:36, 15 Dec 2004 Ram-Man deleted Template:Citation 4 (content was: '#REDIRECT [[Template:Book reference 4]]')
- 20:36, 15 Dec 2004 Quadell deleted Image:Rugby Town Centre 350.jpg (Scaled-down duplicate image)
- 20:35, 15 Dec 2004 Quadell deleted Image:Rugschool2 330.jpg (Scaled-down duplicate image)
- 20:33, 15 Dec 2004 Quadell deleted Image:Ruddy turnstonesmall.jpg (Scaled-down duplicate image)
- 20:33, 15 Dec 2004 Quadell deleted Image:Ruddy turnstone small.jpg (Scaled-down duplicate image)
- 20:32, 15 Dec 2004 Quadell deleted Image:Ruddy-headed.goose.arp.300pix.jpg (Scaled-down duplicate image)
- 20:32, 15 Dec 2004 Quadell deleted Image:Ruby.xtal.300pix.jpg (Scaled-down duplicate image)
- 20:31, 15 Dec 2004 Quadell deleted Image:Royaljord.a310-300.f-odvi..250pix.jpg (Scaled-down duplicate image)
- 20:30, 15 Dec 2004 Quadell deleted Image:Rounders pitch big.jpg (Duplicate image)
- 20:30, 15 Dec 2004 Ram-Man deleted Template:Citation 3 (obsolete content was: '#REDIRECT [[Template:Book reference 3]]')
- 20:29, 15 Dec 2004 Quadell deleted Image:Rounders pitch small.jpg (Scaled-down duplicate image)
- 20:29, 15 Dec 2004 Quadell deleted Image:Rounders pitch small.png (Scaled-down duplicate image)
- 20:29, 15 Dec 2004 Thue deleted Tony Vignaux (content was: '#redirect [[User:Tony Vignaux]]')
- 20:27, 15 Dec 2004 Thue deleted Talk:Tim Chambers (content was: 'moved to http://meta.wikipedia.com/wiki.phtml?title=Talk:Tbc')
- 20:27, 15 Dec 2004 Quadell deleted Image:Roman statuette of bronze from Swedssh Iron age, found at Öland medium.jpg (Scaled-down duplicate image)
- 20:26, 15 Dec 2004 Thue deleted Tim Chambers (content was: '#REDIRECT [[user:Tim Chambers]]')
- 20:25, 15 Dec 2004 Quadell deleted Image:Rockefeller Center small.jpg (Scaled-down duplicate image)
- 20:24, 15 Dec 2004 Thue deleted Tim Goodwin (content was: '#REDIRECT [[user:Tim Goodwin]]')
- 20:23, 15 Dec 2004 Ram-Man deleted Template:Book reference 2 (content was: '{{{author}}}. '[{{{URL}}} {{{title}}}].' ''{{{work}}}''.')
- 20:23, 15 Dec 2004 Infrogmation deleted Image:Choi.jpg (unused duplicated of Image:CJW.jpg; listed on WP:PUI since 4 Nov)
- 20:23, 15 Dec 2004 Quadell deleted Image:Rock Climbers on Stanage Edge.jpg (Scaled-down duplicate image)
- 20:23, 15 Dec 2004 Ram-Man deleted Template:Citation 2 (content was: '#REDIRECT [[Template:Book reference 2]]')
- 20:23, 15 Dec 2004 Thue deleted Tobias Hoevekamp (content was: '#redirect [[User:Tobias Hoevekamp]]')
- 20:22, 15 Dec 2004 Quadell deleted Image:Robarts corner 300px.jpg (Scaled-down duplicate image)
- 20:22, 15 Dec 2004 Quadell deleted Image:Robarts front 300px.jpg (Scaled-down duplicate image)
- 20:22, 15 Dec 2004 Thue deleted Tompeters (content was: '#REDIRECT [[user:Tom Peters]]')
- 20:22, 15 Dec 2004 Quadell deleted Image:Roaring Mountain in Yellowstone-300px.JPG (Duplicate image)
- 20:22, 15 Dec 2004 Thue deleted Tonda (content was: '#REDIRECT [[user:Tonda]]')
- 20:21, 15 Dec 2004 Thue deleted TwoOneTwo (content was: '#REDIRECT [[user:TwoOneTwo]]')
- 20:20, 15 Dec 2004 Thue deleted Tiskin (content was: '#REDIRECT [[User:Alexandre Tiskin]]')
- 20:20, 15 Dec 2004 Thue deleted Tiptyper (content was: '#REDIRECT [[user:Tiptyper]]')
- 20:20, 15 Dec 2004 Thue deleted Toby and Bella (content was: '#REDIRECT [[user:Toby and Bella]]')
- 20:20, 15 Dec 2004 Thue deleted Tuomas Toivonen (content was: '#REDIRECT [[user:Tuomas Toivonen]]')
- 20:20, 15 Dec 2004 Thue deleted Turboalberta (content was: '#redirect [[user:Turboalberta]] ')
- 20:20, 15 Dec 2004 Thue deleted Tze Weng Foong (content was: '#REDIRECT [[User:Tze_Weng_Foong]]')
- 20:20, 15 Dec 2004 Thue deleted Txino (content was: '#REDIRECT [[user:Txino]]')
- 20:19, 15 Dec 2004 Thue deleted Trixium (content was: '#REDIRECT [[user:Trixium]]')
- 20:19, 15 Dec 2004 Thue deleted Trelvis (content was: '#REDIRECT [[user:Trelvis]]')
- 20:19, 15 Dec 2004 Thue deleted Tooch (content was: '#REDIRECT [[user:Tooch]]')
- 20:19, 15 Dec 2004 Quadell deleted Image:Rigging1.tif (Image does not display)
- 20:18, 15 Dec 2004 Infrogmation deleted Image:HJW.JPG (WP:PUI listed and tagged for deletion since 4 Nov)
- 20:17, 15 Dec 2004 Thue deleted TaranRampersad (content was: '#REDIRECT [[User:TaranRampersad]]')
- 20:15, 15 Dec 2004 Thue deleted TheCunctator (content was: '#REDIRECT [[User:The Cunctator]]')
- 20:15, 15 Dec 2004 Thue deleted THERESA KNOTT (content was: '#REDIRECT [[user:Theresa knott]]')
- 20:13, 15 Dec 2004 Thue deleted Taral (content was: '#REDIRECT [[User:Taral]]')
- 20:13, 15 Dec 2004 Thue deleted TedDunning (content was: '#REDIRECT [[user:Ted Dunning]]')
- 20:13, 15 Dec 2004 Thue deleted Tedunning (content was: '#REDIRECT [[user:Ted Dunning]]')
- 20:13, 15 Dec 2004 Quadell deleted Image:Reynolds.clive.350pix.jpg (Duplicate image)
- 20:13, 15 Dec 2004 Jfdwolff deleted Category:Transplant medicine (improperly named)
- 20:13, 15 Dec 2004 Quadell deleted Image:Reynolds.clive.250pix.jpg (Duplicate image)
- 20:12, 15 Dec 2004 Thue deleted Thadeu Lima de Souza Cascardo (content was: '#REDIRECT [[user:Tcascardo]]')
- 20:12, 15 Dec 2004 Thue deleted Ted Dunning (content was: '#REDIRECT [[User:Ted Dunning]]')
- 20:12, 15 Dec 2004 Thue deleted TEmbrey (content was: '#REDIRECT [[user:TEmbrey]]')
- 20:11, 15 Dec 2004 Quadell deleted Image:Reticulated moray eel small.jpg (Image is missing)
- 20:09, 15 Dec 2004 Thue deleted StefanRybo (content was: '#redirect [[user:StefanRybo]] ')
- 20:09, 15 Dec 2004 Thue deleted SoniC (content was: '#REDIRECT [[user:SoniC]]')
- 20:09, 15 Dec 2004 Thue deleted StasK (content was: '#REDIRECT [[User:StasK]]')
- 20:09, 15 Dec 2004 Thue deleted Stefano KALB (content was: '#REDIRECT [[user:Stefano KALB]]')
- 20:09, 15 Dec 2004 Thue deleted Stephen Fuqua (content was: '#REDIRECT [[User:Stephen Fuqua]]')
- 20:09, 15 Dec 2004 Theresa knott deleted Wikepedia.com (content was: '#REDIRECT [[Www.getlost.com]]')
- 20:09, 15 Dec 2004 Thue deleted Stephen Rapley (content was: '#REDIRECT [[User:Stephen Rapley]]')
- 20:08, 15 Dec 2004 Theresa knott deleted Www.getlost.com (content was: '#REDIRECT [[Oil spill]]')
- 20:08, 15 Dec 2004 Quadell deleted Image:Republika Srpska coat medium.png (Duplicate image)
- 20:08, 15 Dec 2004 Quadell deleted Image:Renoir.watercan.250pix.jpg (duplicate image)
- 20:07, 15 Dec 2004 Theresa knott deleted Oil spill (content was: '#REDIRECT [[Wikepedia.com]]')
- 20:07, 15 Dec 2004 Ahoerstemeier deleted Brian Sackett (content was nonsense: 'Brian Sackett is the awesomest most talented actor slash singer slash all around person ever. He is especially better than his little brother Matthew...')
- 20:07, 15 Dec 2004 Ahoerstemeier deleted Alyssa Damiani (content was: 'Alyssa Damiani is currenty located in a unidentiful location, the only available information is that she has no comments about the trail...')
- 20:07, 15 Dec 2004 Thue deleted Stephan Bourgeois (content was: '#REDIRECT [[User:Stephan Bourgeois]]')
- 20:07, 15 Dec 2004 Thue deleted StephenFuqua (content was: '#REDIRECT [[User:Stephen Fuqua]]')
- 20:06, 15 Dec 2004 Ahoerstemeier deleted Matt Sackett (content was: ''''Bold text'''see Brian SackettWE LOVE YOU BRIAN... I MEAN MATT')
- 20:06, 15 Dec 2004 Thue deleted Stevebrowne (content was: '#REDIRECT [[user:Stevebrowne]]')
- 20:06, 15 Dec 2004 Quadell deleted Image:Rembrandt van rijn-self portrait.jpeg (Duplicate image)
- 20:05, 15 Dec 2004 Infrogmation deleted Image:Stitas.jpg (listed on WP:PUI and tagged for deletion since 3 Nov)
- 20:05, 15 Dec 2004 Ahoerstemeier deleted Dark Sage Of Spirit (content was: 'Dark Sage Of Spirit----The spirits have called fourth thee...')
- 20:05, 15 Dec 2004 Ahoerstemeier deleted California Rehabilitation Center (content was: 'California rehabilitation Center')
- 20:04, 15 Dec 2004 Ahoerstemeier deleted Valerio da Pos (content was: 'email me @ usmell@supersmell.com')
- 20:03, 15 Dec 2004 Thue deleted Sultaniyya (content was: '#REDIRECT [[User:Sultaniyya]]')
- 20:03, 15 Dec 2004 Quadell deleted Image:Reliant.scimitar.bristol.750pix.jpg (Duplicate image)
- 20:03, 15 Dec 2004 Quadell deleted Image:Reliant.scimitar.bristol.300pix.jpg (Duplicate image)
- 20:03, 15 Dec 2004 Thue deleted Talk:SunirShah (content was: '#REDIRECT [[user talk:SunirShah]]')
- 20:03, 15 Dec 2004 Thue deleted SunirShah (content was: '#REDIRECT [[user:SunirShah]]')
- 20:02, 15 Dec 2004 Thue deleted Suzanne Elsasser (content was: '#REDIRECT [[user:Suzanne Elsasser]]')
- 20:02, 15 Dec 2004 Thue deleted Surly Bob (content was: '#REDIRECT [[user:Surly Bob]]')
- 20:02, 15 Dec 2004 Thue deleted SuperAnt (content was: '#REDIRECT [[User:SuperAnt]]')
- 20:02, 15 Dec 2004 Ahoerstemeier deleted Robyn Lee Parks (content was: 'hjalkalala;a;;;;')
- 20:01, 15 Dec 2004 Ahoerstemeier deleted Usmell@supersmelly.co.uk (content was: 'yo yo smelly')
- 20:01, 15 Dec 2004 Ahoerstemeier deleted Western Boundary Current (content was: 'ghjfhf')
- 20:01, 15 Dec 2004 Ahoerstemeier deleted Parson Brown (content was: 'And Pretend that he is Parson Brown')
- 20:01, 15 Dec 2004 Ahoerstemeier deleted Foxy Lady (content was: '''Itali[[Image:Examp[[Image:Example.jpg]]le.jpg]]c text''')
- 19:59, 15 Dec 2004 Thue deleted Seattlewind (content was: '#REDIRECT [[User:Seattlewind]]')
- 19:58, 15 Dec 2004 Infrogmation deleted Image talk:Jeriryan3.jpg (Talk of deleted image page; content was: 'Hi Andy, please mention source and permission details of the image. [[User:Jay|Jay]] 08:52, 26 Jun 2004 (UTC): I just asked for clarification on [[U...')
- 19:58, 15 Dec 2004 Thue deleted SGL (content was: '#REDIRECT [[User:SGL]]')
- 19:58, 15 Dec 2004 Infrogmation deleted Image:Jeriryan3.jpg (WP:PUI listed and tagged for deletion since October; incorrectly claimed as "PD", but is copyrighted)
- 19:57, 15 Dec 2004 Thue deleted Sjn28 (content was: '#REDIRECT [[user:Sjn28]]')
- 19:56, 15 Dec 2004 Thue deleted Soam Vasani (content was: '#REDIRECT [[user:Soam Vasani]]')
- 19:54, 15 Dec 2004 Thue deleted Shamenize (content was: '#REDIRECT [[user:Shamenize]]')
- 19:54, 15 Dec 2004 Infrogmation deleted Image:RSAF-F16CD.jpg (WP:PUI listed and tagged for deletion since October)
- 19:53, 15 Dec 2004 Thue deleted Slick514 (content was: '#REDIRECT [[User:Slick514]]')
- 19:53, 15 Dec 2004 Woggly deleted Foxy Lady (content was: '''Itali[[Image:Examp[[Image:Example.jpg]]le.jpg]]c text''')
- 19:53, 15 Dec 2004 Thue deleted Socksdelux (content was: '#REDIRECT [[User:Socksdelux]]')
- 19:52, 15 Dec 2004 Thue deleted Shaun (content was: '#redirect [[user:McGonigal]]')
- 19:52, 15 Dec 2004 Thue deleted Sepp rothwangl (content was: '#REDIRECT [[user:Sepp Rothwangl]]')
- 19:51, 15 Dec 2004 Thue deleted Scott neil (content was: '#REDIRECT [[user:Scott neil]]')
- 19:51, 15 Dec 2004 Thue deleted Sachachua (content was: '#REDIRECT [[user:Sachachua]]')
- 19:51, 15 Dec 2004 Thue deleted Saghmos (content was: '#REDIRECT [[user:Saghmos]]')
- 19:50, 15 Dec 2004 Thue deleted Sammy snake (content was: '#REDIRECT [[user:Sammy snake]]')
- 19:50, 15 Dec 2004 Thue deleted ScottMoonen (content was: '#REDIRECT [[user:ScottMoonen]]')
- 19:49, 15 Dec 2004 Thue deleted SamWilson (content was: '#REDIRECT [[user:SamWilson]]')
- 19:49, 15 Dec 2004 Woggly deleted Jeffrey Fordyce (content was: '{{nonsense}}Jeff is propbably the coolest kid ever. He is quite hot too. All the ladies want him. YEAH!')
- 19:49, 15 Dec 2004 Thue deleted Sannse (content was: '#redirect [[User:Sannse]]')
- 19:49, 15 Dec 2004 Thue deleted Sarah Waggoner (content was: '#REDIRECT [[user:Sarah Waggoner]]')
- 19:49, 15 Dec 2004 Thue deleted Savana-ona-rolla (content was: '#REDIRECT [[user:Savana-ona-rolla]]')
- 19:48, 15 Dec 2004 Thue deleted Scoobcraazey (content was: '#REDIRECT [[User:Scoobcraazey]]')
- 19:45, 15 Dec 2004 Infrogmation deleted Australian Girls Choir (WP:CP listed since November; content was: '{{copyvio|url=http://www.ausgirlschoir.com.au/history.htm}}')
- 19:45, 15 Dec 2004 Infrogmation deleted National Boys Choir, Australia (WP:CP listed since November; content was: '{{copyvio|url=http://www.nationalboyschoir.com.au/}}')
- 19:42, 15 Dec 2004 Thue deleted Talk:Uriyan (content was: '#REDIRECT [[User talk:Uriyan]]')
- 19:37, 15 Dec 2004 Woggly deleted Ahuizotl (content was: '{{nonsense}}gfg')
- 19:31, 15 Dec 2004 Quadell deleted Image:UAmber.insect.250pix.050203.jpg (Scaled-down duplicate of existing image)
- 19:31, 15 Dec 2004 Quadell deleted Image:UBa.b737-436.g-docp.250pix.jpg (Scaled-down duplicate of existing image)
- 19:31, 15 Dec 2004 Quadell deleted Image:UBa.b767-300.g-bzhb.250pix.jpg (Scaled-down duplicate of existing image)
- 19:30, 15 Dec 2004 Quadell deleted Image:UAmber.pendants.250pix.050203.jpg (Scaled-down duplicate of existing image)
- 19:30, 15 Dec 2004 Quadell deleted Image:UBmi.a320-200.g-midt.250pix.jpg (Scaled-down duplicate of existing image)
- 19:27, 15 Dec 2004 Thue deleted RobertBrook (content was: '#REDIRECT [[User:Robert Brook]]')
- 19:27, 15 Dec 2004 Topbanana deleted Category:Mozilla developer (Dead category)
- 19:26, 15 Dec 2004 Thue deleted Rodrigob (content was: '#REDIRECT [[user:Rodrigob]]')
- 19:26, 15 Dec 2004 Infrogmation deleted Discovery Coast Atlantic Forest Reserves (Listed on WP:CP since 3 December;content was: '{{copyvio|url=http://whc.unesco.org/sites/892.htm}} - [[User:Evil saltine|Evil saltine]] 13:37, 3 Dec 2004 (UTC)')
- 19:26, 15 Dec 2004 Infrogmation deleted Atlantic Forest Southeast Reserves (Listed on WP:CP since 3 December;content was: '{{copyvio|url=http://whc.unesco.org/sites/893.htm}} - [[User:Evil saltine|Evil saltine]] 13:39, 3 Dec 2004 (UTC)')
- 19:26, 15 Dec 2004 Infrogmation deleted Boundary scan (Listed on WP:CP since 3 December;content was: '{{copyvio|url=http://standards.ieee.org/reading/ieee/std_public/description/testtech/1149.1-1990_desc.html}}')
- 19:26, 15 Dec 2004 Topbanana deleted Usama murtaza (content was: ' i ll have to say is awoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo')
- 19:25, 15 Dec 2004 Infrogmation deleted Fightin' Texas Aggie Band/Temp (Temp redirect no longer needed; content was: '#REDIRECT [[Fightin' Texas Aggie Band]]')
- 19:25, 15 Dec 2004 Infrogmation deleted Takedown (movie) (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://www.imdb.com/title/tt0159784/}}')
- 19:24, 15 Dec 2004 Infrogmation deleted .example (Listed on WP:CP since 3 December;content was: ''''Please remove the following'''{{copyvio|url=http://www.support.microsoft.com/default.aspx?scid=kb;en-us;197063}}From http://support.microsoft.com/?...')
- 19:23, 15 Dec 2004 Infrogmation deleted Discourse markers (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://www.developingteachers.com/articles_tchtraining/dis2_ceri.htm}}')
- 19:23, 15 Dec 2004 Infrogmation deleted Texas Children's Hospital (cListed on WP:CP since 3 December; ontent was: '{{copyvio|url=http://www.texaschildrenshospital.org/allabout/default.aspx}}')
- 19:23, 15 Dec 2004 Topbanana deleted Bourse (content was: 'what does Bourse mean?{{db|no meaningful content}}')
- 19:23, 15 Dec 2004 Infrogmation deleted Ipecac Records (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://www.ipecac.com/about.php}}[[User:David Johnson|David Johnson]] 19:47, 3 Dec 2004 (UTC)')
- 19:22, 15 Dec 2004 Infrogmation deleted Discourse markers/Temp (redump of copyright text)
- 19:22, 15 Dec 2004 Topbanana deleted Abed rawas (content was: 'A Tuff guy that represents ARABS.Favorite quote 'You Hit Me! We Hit You! A word to the not so wise, from the lips of the Arabian'')
- 19:22, 15 Dec 2004 Topbanana deleted Yasar barin (content before blanking was: ''''Yasar Barin'''Yasar Barin is a Kentucky Fried flaming homosexual who prefers little boys ages 7-12. In his spare time, Yasar likes to give himsel...')
- 19:22, 15 Dec 2004 Topbanana deleted Hosay (content was: 'very smelly who has long under arm hairs')
- 19:22, 15 Dec 2004 Bkonrad deleted DAN LAMEE (content was: 'Dan 'Danyell' Lamee was born with both mail and female organs. At 12 it decided to become totally female but kept its male 'appearences'. Andrew met i...')
- 19:21, 15 Dec 2004 Topbanana deleted Usama Murtaza (content before blanking was: '{{nonsense}}www.boneprone.com')
- 19:21, 15 Dec 2004 Topbanana deleted Manal Rostom (content was: 'Pronounced 'MAN-ANAL', she is a particular species of gorilla that has long inhabited this Earth. She attempts to act smart, but in reality her, and m...')
- 19:21, 15 Dec 2004 Topbanana deleted Zakaria (content was: 'Zak (for short) likes to think 'Hes cool!', and likes to play with himself all the time, he has the feeling of heaven 24/7 as he states, and he has be...')
- 19:21, 15 Dec 2004 Infrogmation deleted Fightin' Texas Aggie Band (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://www.aggieband.org/outfits.php and http://www.aggieband.org/about.php}}')
- 19:21, 15 Dec 2004 Topbanana deleted Usman Murtaza (content was: '{{db|Empty article of nonsense word}}')
- 19:20, 15 Dec 2004 Infrogmation deleted Murray Burnett (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://www.infoplease.com/ipea/A0761428.html}}')
- 19:20, 15 Dec 2004 Topbanana deleted Oriflamme (content was: 'so I was like WHOA then I was like whoa.oriflamme.the guy is jesus i don't care what you say Mr. Conn.{{delete}}')
- 19:20, 15 Dec 2004 Topbanana deleted Koray Aksel (content was: '{{delete}}] Some one who is sick and tired of this kid yasar who keeps bugging him to play with his own balls')
- 19:20, 15 Dec 2004 Infrogmation deleted The Wabash Case (Listed on WP:CP since 3 December; content was: '{{copyvio1}}http://www.bartleby.com/65/wa/WabashCa.html{{copyvio2}}')
- 19:19, 15 Dec 2004 Topbanana deleted Template:HPQ full (Unused template, deletion requested by creator)
- 19:19, 15 Dec 2004 Topbanana deleted Template:HPF full (Unused template, deletion requested by creator)
- 19:19, 15 Dec 2004 Topbanana deleted Template:HP7 full (Unused template, deletion requested by creator)
- 19:19, 15 Dec 2004 Topbanana deleted Template:HP6 full (Unused template, deletion requested by creator)
- 19:19, 15 Dec 2004 Topbanana deleted Template:HP5 full (Unused template, deletion requested by creator)
- 19:19, 15 Dec 2004 Topbanana deleted Template:HP4 full (Unused template, deletion requested by creator)
- 19:19, 15 Dec 2004 Topbanana deleted Template:HP3 full (Unused template, deletion requested by creator)
- 19:19, 15 Dec 2004 Infrogmation deleted Interscan (Listed on WP:CP since 3 December; content was: '{{copyvio}}')
- 19:18, 15 Dec 2004 Topbanana deleted Template:HP2 full (Unused template, deletion requested by creator)
- 19:18, 15 Dec 2004 Infrogmation deleted Masahiro Sakurai (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://www.classicgaming.com/kirby/info/kirby101/kirbycreator.html}}')
- 19:18, 15 Dec 2004 Topbanana deleted Template:HP1 full (Unused template, deletion requested by creator)
- 19:18, 15 Dec 2004 Infrogmation deleted Maulana Sadr-ud-Din (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://aaiil.org/text/biog/biog/sadr.shtml}}[[User:Zaphod Beeblebrox|Zaphod Beeblebrox]] 12:49, 1 Dec 2004 (UTC)')
- 19:18, 15 Dec 2004 Thue deleted Rsutc (content was: '#REDIRECT [[user:Rsutc]]')
- 19:18, 15 Dec 2004 Infrogmation deleted Maulana Sadr-ud-Din/Temp (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://aaiil.org/text/biog/biog/sadr.shtml}}Still a copyvio...')
- 19:18, 15 Dec 2004 Infrogmation deleted Maulana Sadr-ud-Din/Temp/Temp (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://aaiil.org/text/biog/biog/sadr.shtml}}')
- 19:18, 15 Dec 2004 Infrogmation deleted Melphalan (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://health.yahoo.com/health/drugs/202345/overview}}')
- 19:18, 15 Dec 2004 Infrogmation deleted Michael C. Coup (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://www.vornado.com/manuals/pr/Work%20in%20Comfort%20on%20any%20Project%20with%20the%20Vornado%20Heavy%20Duty%20Shop%20Fan%20on%20the...')
- 19:17, 15 Dec 2004 Infrogmation deleted NY Ontario @ Western Railway (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://www.nyow.org/}}')
- 19:17, 15 Dec 2004 Infrogmation deleted P.N. Oak (Listed on WP:CP since 3 December; content was: '{{copyvio|url=http://home.freeuk.com/tajmahal/19Author.htm}}')
- 19:17, 15 Dec 2004 Topbanana deleted The Red Pony (Copland) (content was: '{{delete}}i'm so fat and my name is Kasey')
- 19:17, 15 Dec 2004 Thue deleted Ron Parker (content was: '#REDIRECT [[user:Ron Parker]]')
- 19:17, 15 Dec 2004 TUF-KAT deleted The spank (content was: ''''The Spank''' is a band from small town Port Hope ON. Theywill soon become the most successful band in the history of music.')
- 19:17, 15 Dec 2004 Thue deleted RobertL30 (content was: '#REDIRECT [[user:RobertL30]]')
- 19:16, 15 Dec 2004 Topbanana deleted Testpage:Central (content was: '{{delete}}* {{PAGENAME}}* {{NAMESPACE}}* [[{{NAMESPACE}}:{{PAGENAME}}]]')
- 19:16, 15 Dec 2004 Topbanana deleted The frist charters (content was: '{{nonsense}}wergsjdlfhlzrerhbyusgchyidfyuaerdbsbhdsgdhsghagdghagrlkgiyhadsafhdfhhfhhfhfhfhfhfhfhfhfhfjasdljkawglefc njhkzxjs xgfgkgfsdrt')
- 19:16, 15 Dec 2004 Topbanana deleted Talip Tastemel (content was: '{{delete}}(Born 1984, istanbul).Turkish university student. He studies business administration at Bilgi University.')
- 19:15, 15 Dec 2004 Infrogmation deleted Shirley Barg/Temp (Temp redirect no longer needed; content was: '#REDIRECT [[Shirley Barg]]')
- 19:15, 15 Dec 2004 Topbanana deleted Self Addressed Stamped Envelope (content was: 'http://www.bbrmotorsports.com/Info/SASE.htm http://www.mymommybiz.com/canada/allaboutsases.htmlSee also: [[International reply coupon]]{{delete}}')
- 19:15, 15 Dec 2004 Topbanana deleted Mustafa Altay Sönmez (Vanity page)
- 19:14, 15 Dec 2004 Topbanana deleted Louis Conway (content was: '{{delete}}Louis Conway, Mathetmatician was killed by falling cats on the 12th September 2004, he was an inspirational figure in his homeland Russia,...')
- 19:14, 15 Dec 2004 Thue deleted Ramon Casha (content was: '#REDIRECT [[user:Ramon Casha]]')
- 19:13, 15 Dec 2004 Topbanana deleted Jack Harris (content was: '{{delete}}Jack Harris is a 61 year old white male and employee of White Star Steel, located in Houston, Texas. He has worked with White Star for th...')
- 19:12, 15 Dec 2004 Topbanana deleted Ethan Quigley (content was: '{{delete}}Ethan Quigley is the coolest, funnist, smartest and coolest (again) person in the world.')
- 19:12, 15 Dec 2004 Infrogmation deleted Robert Rimmer (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.harrad2000.com/eulogy.html}}')
- 19:11, 15 Dec 2004 Topbanana deleted Chrismahanukwanzaka (content was: '{{nonsense}}-It's okay if you're a Muslim, a Christian or a Jew.-It's okay if you're agnostic and you don't know what to do.-An all-inclusive cel...')
- 19:11, 15 Dec 2004 Topbanana deleted Chrismahanukwanzaaka (content was: '{{nonsense}}-It's okay if you're a Muslim, a Christian or a Jew.-It's okay if you're agnostic and you don't know what to do.-An all-inclusive ce...')
- 19:10, 15 Dec 2004 Topbanana deleted Chitrapandian (Nonsense page/advert)
- 19:10, 15 Dec 2004 Infrogmation deleted Shirley Barg (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.albertandp.ca/ShirleyBarg/Biography.cfm}}')
- 19:10, 15 Dec 2004 Topbanana deleted Borden Family (content was: '{{delete}} shawna is the stuff! '08'Communcations Hughes Shout outs!!!!!!!! BrittanyMouniqeDenishaKE-KE Jazmyne and Mr.banks')
- 19:10, 15 Dec 2004 Infrogmation deleted Don Estridge (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.thocp.net/biographies/estridge_don.html}}')
- 19:10, 15 Dec 2004 Topbanana deleted A series of unfortunate events-book the twelth (content was: '{{delete}}It is rumored to be called either 'The Dreadful Denouement, 'The Perilous Plane, or 'The Intolerable Inn.'')
- 19:09, 15 Dec 2004 Topbanana deleted Kitap-lık (content was: '{{delete}}Turkish Literrary magazine. Publisher: YKY. Editor in chief: Murat Yalçın')
- 19:09, 15 Dec 2004 Infrogmation deleted Don Estridge/Temp (unhelpful substub; content was: 'Person who helped create the IBM PC.')
- 19:09, 15 Dec 2004 Infrogmation deleted Sandy Allen (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.education-world.com/a_curr/curr004.shtml}}--[[User:Rbrwr|rbrwr]][[User talk:Rbrwr|<sup>±</sup>]] 21:32, 4 Dec 2004 (...')
- 19:09, 15 Dec 2004 Thue deleted Rkinder (content was: '#REDIRECT [[user:Rkinder]]')
- 19:08, 15 Dec 2004 Topbanana deleted Usman Murtaza (content was: 'cool guy......')
- 19:08, 15 Dec 2004 Topbanana deleted Perry Macarthy (content was: 'See 'The Stig'.')
- 19:08, 15 Dec 2004 Infrogmation deleted Image:Ibrahim ismail chundrigar.jpg (Listed on WP:CP since 4 December; )
- 19:07, 15 Dec 2004 Ahoerstemeier deleted Height of the innuitian (content were editing experiments)
- 19:07, 15 Dec 2004 Infrogmation deleted Keith Johnstone (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.keithjohnstone.com/bio.htm}}')
- 19:07, 15 Dec 2004 Infrogmation deleted Selkirk high school (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.selkirk.k12.wa.us/Page%20Templates/home/welcometoselkirk.htm}}')
- 19:07, 15 Dec 2004 Infrogmation deleted Small world network (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.ams.org/new-in-math/small-world.html}}')
- 19:07, 15 Dec 2004 Infrogmation deleted Tactical Directives for Metropolitan Population and Built-up Areas (Listed on WP:CP since 4 December; )
- 19:07, 15 Dec 2004 Infrogmation deleted Unsanctum (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.hordesofdarkness.net/bio.html}}')
- 19:07, 15 Dec 2004 Infrogmation deleted Velingrad (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.travel-bulgaria.com/content/velingrad_spa_resort.shtml}}')
- 19:06, 15 Dec 2004 Infrogmation deleted Villa Incognito (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.amazon.com/exec/obidos/tg/detail/-/0553803328?v=glance&vi=reviews}}')
- 19:06, 15 Dec 2004 Infrogmation deleted Torecan (Listed on WP:CP since 4 December; content was: '{{copyvio|url=http://www.rxlist.com/cgi/generic2/thiethyl.htm}}')
- 19:05, 15 Dec 2004 Thue deleted RaviDesai (content was: '#REDIRECT [[user:RaviDesai]]')
- 19:05, 15 Dec 2004 Thue deleted ReiniUrban (content was: '#REDIRECT [[User:ReiniUrban]]')
- 19:05, 15 Dec 2004 Thue deleted Red Bowen (content was: '#REDIRECT [[user:Red Bowen]]')
- 19:05, 15 Dec 2004 Thue deleted Redmist (content was: '#REDIRECT [[user:redmist]]')
- 19:05, 15 Dec 2004 Thue deleted Talk:Ray Van De Walker (content was: '#redirect [[User talk:Ray Van De Walker]]')
- 19:04, 15 Dec 2004 Thue deleted Ray G. Van De Walker (content was: '#REDIRECT [[User:Ray Van De Walker]]')
- 19:00, 15 Dec 2004 Ahoerstemeier deleted Martin Edward Mortensen (content was: 'Martin Edward Mortensen')
- 19:00, 15 Dec 2004 Ahoerstemeier deleted George winston (content was: 'gfdfg')
- 18:58, 15 Dec 2004 Ahoerstemeier deleted Gustav Fröhlich (content was: 'OOH I LOVE THIS GUY!')
- 18:58, 15 Dec 2004 Ahoerstemeier deleted Civil rights songs (content was: 'what the fuck')
- 18:52, 15 Dec 2004 Jimfbleak deleted Old Norwegian (content was: 'My name is Kyle')
- 18:49, 15 Dec 2004 Thue deleted Vit-b (content was: '#REDIRECT [[user:Vit-b]]')
- 18:48, 15 Dec 2004 Thue deleted Valerio Saggini (content was: '#REDIRECT [[user:Valerio Saggini]]')
- 18:47, 15 Dec 2004 Thue deleted Vassili Nikolaev (content was: '#REDIRECT [[User:Vassili Nikolaev]]')
- 18:46, 15 Dec 2004 Thue deleted Ulf Hermjakob (content was: '#REDIRECT [[user:Ulf Hermjakob]]')
- 18:46, 15 Dec 2004 Thue deleted Pemerson (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Pemerson]]')
- 18:45, 15 Dec 2004 Thue deleted Unukorno (content was: '#REDIRECT [[User:Unukorno]]')
- 18:43, 15 Dec 2004 Thue deleted Qaz (content was: '#redirect [[User:Qaz]]')
- 18:39, 15 Dec 2004 Thue deleted Grunt Rebellion (content was: '{{db|The wikipedians are sick of 198.236.63.13 always recreating [[Grunt Rebellion]]}}The Grunts are sick of the Covenat allways send them frist in b...')
- 18:39, 15 Dec 2004 Ahoerstemeier deleted American Empire Project (content was: 'http://www.americanempireproject.com/')
- 18:33, 15 Dec 2004 Ahoerstemeier deleted Culture of Yemen (content was: '<insirt nothing here>')
- 18:33, 15 Dec 2004 Thue deleted Strikebreaker (content was: '{{delete}}a strike braker is someone that breaks a strike.')
- 18:32, 15 Dec 2004 Thue deleted Gender (sociology) (content was: '{{delete}}YEAH!')
- 18:31, 15 Dec 2004 Thue deleted Great Rail Strike of 1877 (content was: '{{nonsense}}what the fuck is this another half ass blank entry? what would McKinley think? I'll tell you, he'd be spinning in his grave, with a bo...')
- 18:31, 15 Dec 2004 Thue deleted Grube (personal attack)
- 18:30, 15 Dec 2004 Thue deleted Commmander okami (content was: '{{delete}}Commander Mako 'Okami' Bandana is currently a ruthless canditate for world domination. Or so his web site says. Anyhow, he is a web icon kno...')
- 18:29, 15 Dec 2004 Thue deleted Breath of Fire IV (content was: '{{db|there's just a festive message here}}TIS THE SEASON TO BE JOLLY!!')
- 18:29, 15 Dec 2004 Neutrality deleted Talk:The Oregon Trail (computer game) (content was: 'tyhis is the most dumbest game in the history of all games and no one shold ever play it again becasue it is stupid and i dont like it i hate school a...')
- 18:28, 15 Dec 2004 Thue deleted Ashwin (content was: '{{delete}}Ashwin Nathan is a kid who lives in East Bumblefunk. He is very awesome. In fact, he is totally tubular. Gnarly dude. He enjoys long walks...')
- 18:28, 15 Dec 2004 Thue deleted Appalachian Spring (content was: '{{delete}}i think thisv is so stupi9d u guys suck big ones')
- 18:27, 15 Dec 2004 Thue deleted Red pony (content was: '{{delete}}jordan mead is a gay fag that humps ethan and his pill\ w\=-o)\\'[]')
- 18:26, 15 Dec 2004 Thue deleted Rubik's Clock (content was: '{{delete}}[[Media:Example.ogg]]--[[User:62.253.64.13|62.253.64.13]] 18:10, 15 Dec 2004 (UTC)<nowiki>Insert non-formatted text here</nowiki><math>Inse...')
- 18:26, 15 Dec 2004 Thue deleted Pikku G (content was: '{{nonsense}}Pikku G is gay. He likes to touch on young boy's bottoms. He fingers his dad's rear-end. This wanna be gangsta is a wanksta, who loves b...')
- 18:26, 15 Dec 2004 Thue deleted OPCO (content was: '{{delete}}OP co.'s first strike!MWA HA HA HA HA HA!And remember.Op co. where you give us money, for nothing!')
- 18:26, 15 Dec 2004 Mackensen deleted Lord Granville Somerset (content was: '#REDIRECT [[Granville Charles Henry Somerset]]' preparing for move)
- 18:26, 15 Dec 2004 Mustafaa deleted Talip TaÅŸtemel (content was: '{{delete}}Turkish university student. (Born 1984, İstanbul). He studies Business Administration at Bilgi University.')
- 18:24, 15 Dec 2004 Thue deleted L33t programming language/Temp (content was: '{{db|That's not really helpful}}8y J05#u^P3c#73r 0n +h3 7w3|f7h d@y 0f ¢#ri57m@5, my h4x0r sent tome, 12 g4m3rz pwn3!ng 11 w@r3z 1n57411!ng...')
- 18:22, 15 Dec 2004 Thue deleted Coagulative necrosis (content was: '{{delete}}[[Image:Example.jpg]]')
- 18:22, 15 Dec 2004 Thue deleted Murdocc (content was: '{{nonsense}}Nathine sucks!')
- 18:22, 15 Dec 2004 Thue deleted Abu Lahab (content was: '{{delete}}Abu Lahan')
- 18:20, 15 Dec 2004 Thue deleted Bretto (content was: '{{delete}}ALEX ANDERSON IS A FAT MONSTERSHE IS LAME TIMES TWELVESHE GONNA DIE OF HEART ATTACK IF SHE DONT GET OFF HER LAZY ASS')
- 18:18, 15 Dec 2004 Thue deleted Alex anderson (content was: '{{nonsense}}ALEX ANDERSON IS A FAT WHORE! OMG! WHAT A COW!')
- 18:18, 15 Dec 2004 Thue deleted Jake Hickey (content was: '{{delete}}Well... he is crazy... and freeeeeekkkkky but... ooo f*** it, he sucks!')
- 18:18, 15 Dec 2004 Thue deleted Batur (content was: '{{nonsense}}my unemployed roommate.')
- 18:16, 15 Dec 2004 Infrogmation deleted Image talk:China 11a.jpg (content was: 'hi china is cool')
- 18:04, 15 Dec 2004 Quadell deleted Image:Color temp.jpg (Listed on IfD since December 7)
- 18:04, 15 Dec 2004 Quadell deleted Image:Gallienus lead seal lg.jpg (Listed on IfD since December 7)
- 18:02, 15 Dec 2004 Quadell deleted Image:Casa Milia roof.jpg (Duplicate image)
- 18:02, 15 Dec 2004 Quadell deleted Image:Faroe islands coa.png (Image has errors and does not display)
- 18:01, 15 Dec 2004 Bkonrad deleted Hoboshow (content was: '{{delete}}== Headline text ==A hoboshow is a gaggle of hobos dancing around in the street for money, only petty change though cause no one would re...')
- 17:59, 15 Dec 2004 Quadell deleted Image:The Evil Monkey.JPG (Moved to Commons)
- 17:59, 15 Dec 2004 Quadell deleted Image:JABox.jpg (Duplicate image)
- 17:53, 15 Dec 2004 Quadell deleted Image:Painter jay defeo,1960.jpg (image has errors and will not display)
- 17:53, 15 Dec 2004 Quadell deleted Image:MIKASA&TOGO.JPG (Moved to Commons)
- 17:52, 15 Dec 2004 Quadell deleted Image:MIKASAGUNS.JPG (moved to Commons)
- 17:51, 15 Dec 2004 Quadell deleted Image:Pan Am 747 - LAX.jpg (Image has errors and will not display)
- 17:42, 15 Dec 2004 Deb deleted "tim andrews" (duplicate article)
- 17:36, 15 Dec 2004 Jpgordon deleted Wikipedia:Requests for penectomy (Vandalism + nonsense)
- 17:30, 15 Dec 2004 Ahoerstemeier deleted McKinley Tariff of 1890 (content was: 'this is fucking pathetic you guys need to get your shit together that's what McKinley would want')
- 17:30, 15 Dec 2004 Deb deleted James G. Roche (content was: 'vbnvbn')
- 17:27, 15 Dec 2004 Thue deleted Image:KU Mathematical institute.jpg (I uploaded this, but do not have permission to use it. Deleted.)
- 17:26, 15 Dec 2004 Kosebamse deleted Meaning Of Names (content was: 'Gustavo')
- 17:18, 15 Dec 2004 Thue deleted Poslfit (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Poslfit]]')
- 17:17, 15 Dec 2004 Ahoerstemeier deleted In the Ghetto (content was: 'EWRTETWETEWT')
- 17:17, 15 Dec 2004 Ahoerstemeier deleted Predynastic Period of Egypt (content was: 'ruled by a cool cat for 500 years who made a pyramid. egypt rulz')
- 17:17, 15 Dec 2004 Ahoerstemeier deleted National Hobo Convention (content was: 'for hobosyay!')
- 17:16, 15 Dec 2004 Ahoerstemeier deleted Contract Research Organization (content was: 'cro')
- 17:16, 15 Dec 2004 Thue deleted Pingos (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[user:Goran]]')
- 17:15, 15 Dec 2004 Thue deleted Plemeljr (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Plemeljr]]')
- 17:14, 15 Dec 2004 Charles Matthews deleted Robin haigh (content was: 'Heck, you wana know about robin haigh? I'll tell ya, but you'd better be ready for awesomnes!Firstly, he has a crummy sis called grubalo7.Also, he...')
- 17:13, 15 Dec 2004 Thue deleted Phil Bordelon (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Phil Bordelon]]')
- 17:13, 15 Dec 2004 Thue deleted Pspinler (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Pspinler]]')
- 17:13, 15 Dec 2004 Thue deleted PierreAbbat (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:PierreAbbat]]')
- 17:12, 15 Dec 2004 Thue deleted Pneff (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Pneff]]')
- 17:12, 15 Dec 2004 Thue deleted PittiPan (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[user:PittiPan]]')
- 17:12, 15 Dec 2004 Thue deleted Pirilon (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[user:Pirilon]]')
- 17:11, 15 Dec 2004 Thue deleted Philhunt (content was: '#redirect [[User:Philhunt]]')
- 17:11, 15 Dec 2004 Thue deleted Philo Vivero (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Philo_Vivero]]')
- 17:11, 15 Dec 2004 Thue deleted PhillipHankins (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:PhillipHankins]]')
- 17:11, 15 Dec 2004 Thue deleted Phillip2 (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Phil Lord]]')
- 17:07, 15 Dec 2004 Jpgordon deleted CHH (User test)
- 16:58, 15 Dec 2004 Ahoerstemeier deleted Slip-N-Slide Records (content was: 'wass up trickdaddy halla at your number 1 fan!!!!!!!!!!!!!!11')
- 16:58, 15 Dec 2004 Thue deleted OprgaG (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:OprgaG]]')
- 16:58, 15 Dec 2004 Niteowlneils deleted Talk:Islam in Bolivia (content was: '{{del}}islamin bolivia')
- 16:56, 15 Dec 2004 Thue deleted Orcalover (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Orcalover]]')
- 16:56, 15 Dec 2004 Thue deleted Pawel Jochym (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Pawel Jochym]]')
- 16:56, 15 Dec 2004 Thue deleted Patrick Michaud (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Patrick Michaud]]')
- 16:55, 15 Dec 2004 Thue deleted P0ppe (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:P0ppe]]')
- 16:55, 15 Dec 2004 Thue deleted Pgdudda (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:pgdudda]]')
- 16:53, 15 Dec 2004 Thue deleted PatrickSalsbury (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:PatrickSalsbury]]')
- 16:53, 15 Dec 2004 Neutrality deleted "Category:Houston, TX" (Obseleted by [[:Category:Houston, Texas]].')
- 16:52, 15 Dec 2004 Niteowlneils deleted Control theory (sociology) (content was: '{{delete}}Control Theory')
- 16:52, 15 Dec 2004 Thue deleted Paolo Bernardelli (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Paolo Bernardelli]]')
- 16:51, 15 Dec 2004 Thue deleted "Pguiral" (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Pguiral]]')
- 16:50, 15 Dec 2004 Thue deleted PeterKur (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:PeterKur]]')
- 16:50, 15 Dec 2004 Jfdwolff deleted Lekguan (content was: '== lekguan ==Error: 404 Page not found.Wikipedia has encountered an error. The entry 'lekguan' has not been found in the database. If you would lik...')
- 16:50, 15 Dec 2004 Ahoerstemeier deleted Balance sheet analysis (content was: 'dsagfhjjd')
- 16:50, 15 Dec 2004 Ahoerstemeier deleted Mariya (content was: 'One word: child delinquent.....sorry two words')
- 16:49, 15 Dec 2004 Thue deleted ODiV (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:ODiV]]')
- 16:49, 15 Dec 2004 Thue deleted Ole Aamot (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Ole_Aamot]]')
- 16:48, 15 Dec 2004 Thue deleted Oliver Menge (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Oliver_Menge]]')
- 16:47, 15 Dec 2004 Ahoerstemeier deleted Austempered ductile iron (content was: 'austempered ductile iron')
- 16:47, 15 Dec 2004 Thue deleted Paul Hsieh (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:Paul Hsieh]]')
- 16:45, 15 Dec 2004 Thue deleted Paralogical (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Paralogical]]')
- 16:45, 15 Dec 2004 Thue deleted Oskar Flordal (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Oskar Flordal]]')
- 16:45, 15 Dec 2004 Thue deleted PaddedCell (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:PaddedCell]]')
- 16:44, 15 Dec 2004 Thue deleted OpenSourced (content was: '''This page should be deleted once all links to it have been fixed up.''#redirect [[User:OpenSourced]]')
- 16:42, 15 Dec 2004 Ahoerstemeier deleted Kirk's dik-dik (content was: 'hellishly skinny')
- 16:42, 15 Dec 2004 Ahoerstemeier deleted Jeffrey Fordyce (content before blanking was: 'Jeffrey Fordyce is a cool kid! He is tall and is a computer whiz. Yay for Jeffrey - also known as 'Jeff'.')
- 16:42, 15 Dec 2004 Bkonrad deleted Image talk:Ferdinand Magellan.jpg (gibberish)
- 16:41, 15 Dec 2004 Ahoerstemeier deleted Count olaf (content was: 'count olaf is an evil person in 'a series of unfortunate events' who is boyfriend to esme sqalor.')
- 16:40, 15 Dec 2004 Ahoerstemeier deleted Lekguan (content before blanking was: '== lekguan ==Lekguan is an audiophile/videophile kidd. He hates tubes for audio but adores it for his visual needs...')
- 16:40, 15 Dec 2004 Ahoerstemeier deleted Japanese Elm (content was: 'Japanese elms')
- 16:40, 15 Dec 2004 Ahoerstemeier deleted Lester liao (content was: 'PLEASE SEND ME THE CHEMISTRY DATA MR. LIAO.')
- 16:40, 15 Dec 2004 Niteowlneils deleted Absolut Engine (content was: '{{db|Hello sailor}}hello')
- 16:40, 15 Dec 2004 Niteowlneils deleted Meaning Of Names (content was: '{{delete}}== Headline text ==amir')
- 16:39, 15 Dec 2004 Niteowlneils deleted Evoleto (content was: '{{deleteagain}}[[Image:evoleto-logo.gif]]'''Evoleto, LLC'''''Your Web Solution Provider.''Evoleto, LLC is a company founded in Aug, 2004 in the ...')
- 16:37, 15 Dec 2004 Niteowlneils deleted Free book of c language (content was: '{{del}}'''Bold text'''how to get the free download of the c language book''Italic text''and to maitain')
- 16:36, 15 Dec 2004 Niteowlneils deleted What are J.R.R Tolkiens Kids Name (content was: '{{deletebecause|Irrelevant, poorly titled, nonencyclopedic, possibly considered vandalism.}}Jake is so gay and so is Mc')
- 16:36, 15 Dec 2004 Niteowlneils deleted World Youth Alliance (content was: '{{delete}}elena')
- 16:36, 15 Dec 2004 Postdlf deleted Pyelonephritis (content was: 'start')
- 16:33, 15 Dec 2004 Thue deleted Wikipedians/The Cunctator (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:The Cunctator]]')
- 16:30, 15 Dec 2004 Jpgordon deleted 3fox (User test)
- 16:26, 15 Dec 2004 Thue deleted Talk:Zundark (content was: '#REDIRECT [[User_talk:Zundark]]')
- 16:26, 15 Dec 2004 Thue deleted The Cunctator/Anarchists for a Better Past, Present, and Future (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:The Cunctator/old-Anarchists for a Better Past, Present, and...')
- 16:24, 15 Dec 2004 Thue deleted Culture of Madagascar (content was: '{{db|I'm no expert, but I suspect the culture is of a slightly broader spectrum than just that}}Penis?')
- 16:24, 15 Dec 2004 Thue deleted Ryguasu/basic processes (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Ryguasu/basic_processes]]')
- 16:24, 15 Dec 2004 Thue deleted Lir/Chess(1) (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Lir/Chess(1)]]')
- 16:20, 15 Dec 2004 Thue deleted DMworkArea (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:David_Martland/DMworkArea]]')
- 16:20, 15 Dec 2004 Thue deleted Claudine/Demo (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Claudine/old-demo]]')
- 16:19, 15 Dec 2004 Thue deleted Ddroar/articles (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Ddroar/articles]]')
- 16:19, 15 Dec 2004 Thue deleted Dr. Tarek Yehia KAPIEL/HomePage Text (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Dr._Tarek_Yehia_KAPIEL/HomePage_Text]]')
- 16:18, 15 Dec 2004 Thue deleted Damian Yerrick/Contributions (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Damian Yerrick/old-Contributions]]')
- 16:17, 15 Dec 2004 Thue deleted Erdem Tüzün/Contributions (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Erdem_Tüzün/Contributions]]')
- 16:17, 15 Dec 2004 Thue deleted Kragen/Edited pages (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Kragen/Edited_pages]]')
- 16:15, 15 Dec 2004 Thue deleted Koyaanis/flowers for spirit (content was: '''This page should be deleted once all links to it have been fixed up.''#REDIRECT [[User:Koyaanis_Qatsi/flowers_for_spirit]]')
- 16:04, 15 Dec 2004 Chris 73 deleted William shakespears burrial
- 16:04, 15 Dec 2004 Chris 73 deleted Lil' Keke (content was: 'hey bitch')
- 15:59, 15 Dec 2004 Thue deleted Xiemaisi (content was: '#REDIRECT [[user:Xiemaisi]]')
- 15:58, 15 Dec 2004 Chris 73 deleted Schwuchteln (content was: '{{delete}}Schwuchteln')
- 15:58, 15 Dec 2004 Chris 73 deleted Mick Box
- 15:57, 15 Dec 2004 Thue deleted NickelKnowledge (content was: '''this page should be deleted once the links to it are fixed up''#REDIRECT [[User:NickelKnowledge/old]]')
- 15:53, 15 Dec 2004 Thue deleted Xaonon (content was: '#REDIRECT [[user:Xaonon]]')
- 15:47, 15 Dec 2004 Thue deleted Warnermendenhall (content was: '#REDIRECT [[User:Warnermendenhall]]')
- 15:46, 15 Dec 2004 Thue deleted Wmorgan (content was: '#REDIRECT [[user:Wmorgan]]')
- 15:44, 15 Dec 2004 Chris 73 deleted List of cities in the Cayman Islandss (Typo, redundant with [[List of cities in the Cayman Islands]])
- 15:42, 15 Dec 2004 Chris 73 deleted Talk:Boners dias (content was: '{{del}}There is nothing wrong with the boners dias unless you are a bad man good sir! I trust you are not bad man!')
- 15:40, 15 Dec 2004 Ferkelparade deleted Boners dias (content was: '{{del}}MUCHO BONERS DIAS EL GRANDO TACO BELL HEEEEEYAHHHH SPOKKER YOU FIGHT DIRTY MEXICAN KICKBOXING FOR ME IN THE AMERICA')
- 15:39, 15 Dec 2004 Thue deleted WillWare (content was: '#REDIRECT [[User:WillWare]]')
- 15:39, 15 Dec 2004 Ferkelparade deleted Steff Fontain (content was: '{{db|Who's alvie?}}Is this guy still alvie? CHEERS,Dave.')
- 15:38, 15 Dec 2004 Thue deleted Wayne Hardman (content was: '#REDIRECT [[user:Wayne Hardman]]')
- 15:38, 15 Dec 2004 Thue deleted WhyRossum (content was: '#redirect [[user:WhyRossum]]')
- 15:38, 15 Dec 2004 Thue deleted WcGing (content was: '#REDIRECT [[User:WcGing]]')
- 15:37, 15 Dec 2004 Thue deleted WilliamWyatt (content was: '#REDIRECT [[user:WilliamWyatt]]')
- 15:37, 15 Dec 2004 Thue deleted William (Andy) Smith (content was: '#REDIRECT [[user:William_(Andy)_Smith]]')
- 15:36, 15 Dec 2004 Thue deleted WillWilkinson (content was: '#REDIRECT [[user:WillWilkinson]]')
- 15:34, 15 Dec 2004 Thue deleted N8chz (content was: '''This page should be deleted once all pages linking to it have been fixed up''#REDIRECT [[User:N8chz/old]]')
- 15:24, 15 Dec 2004 Thue deleted David Butler article In the Image of Man (content was: '{{del}}IMAGE OF MAN by David Butler')
- 15:13, 15 Dec 2004 Thue deleted English Armada (content was: '{{del}}you')
- 15:11, 15 Dec 2004 Thue deleted Jonynas (nonsense: 'The wild Jonyas (jon-ee-ess) Very rare only spotted so far in northern Vermont, by incredibly stupid and/or illiterate fools')
- 15:09, 15 Dec 2004 Thue deleted Ugh. (content was: 'Shoes and shoes and bacon adn shoes.')
- 14:58, 15 Dec 2004 Ahoerstemeier deleted Mercantalism (content was: 'Hello!')
- 14:58, 15 Dec 2004 Ahoerstemeier deleted Foggy (program) (content was: 'hey')
- 14:48, 15 Dec 2004 Oberiko deleted User:Oberiko/Egypt-Libya Campaign (content was: '*[http://www.army.mil/cmh-pg/brochures/egypt/egypt.htm]')
- 14:44, 15 Dec 2004 Quadell deleted Image:Cometes trajectoires 5.png (Listed on IfD for a long time)
- 14:40, 15 Dec 2004 Ahoerstemeier deleted "Kike Morandé" (content was: 'lol')
- 14:40, 15 Dec 2004 Ahoerstemeier deleted "Chinese hip hop" (content was: 'hgvgyvtgbuhvttcghnyvtttbytyvthbybytvtybyvt5ftygggggggggggggggggtvttcrv')
- 14:37, 15 Dec 2004 Thue deleted "Hugh Selwyn Mauberley" (content was: '{{db|Good luck!}}Hugh Selwyn Mauberley, Pounds 1921 poem that I have a test on at four o' the clock today.I hope i do ok.')
- 14:37, 15 Dec 2004 Quadell deleted "Image:Cometes trajectoires 8.png" (Listed on IfD for a long time)
- 14:37, 15 Dec 2004 Quadell deleted "Image:Cometes trajectoires 7.png" (Listed on IfD for a long time)
- 14:36, 15 Dec 2004 Quadell deleted Image:Cometes trajectoires 6.png (Listed on IfD for a long time)
- 14:34, 15 Dec 2004 Quadell deleted Image:Colman Terence-250px.jpg (Scaled-down duplicate of existing image)
- 14:31, 15 Dec 2004 Quadell deleted Image:Cocoon 3 300px.jpg (Scaled-down duplicate of existing image)
- 14:30, 15 Dec 2004 Quadell deleted Image:Cocoon 2 300px.jpg (Scaled-down duplicate of existing image)
- 14:25, 15 Dec 2004 Quadell deleted Image:Coin roman licinius close-up.jpg (Image contains errors and will not display)
- 14:25, 15 Dec 2004 Quadell deleted Image:Coin roman licinius.png (Image contains errors and will not display)
- 14:25, 15 Dec 2004 Quadell deleted Image:Coin roman licinius.jpg (Image contains errors and will not display)
- 14:21, 15 Dec 2004 Ahoerstemeier deleted Die Schule (content was substub spam contents at wrong title: '== Madunda Secondary School ==im Ludewa District, Iringa Region, Tanzania[[http://people.freenet.de/mgumtau/]]')
- 14:19, 15 Dec 2004 Quadell deleted Image:Coaguinea-bissausmall.jpg (Scaled-down duplicate of existing image)
- 14:19, 15 Dec 2004 Ahoerstemeier deleted Prophecies of Sollog (content was spam: 'Prophecies of SollogA collection of the occult writings of the infamous seer Solloghttp://www.propheciesofsollog.com')
- 14:18, 15 Dec 2004 Ahoerstemeier deleted A view from the bridge (content was: '[http://www.eriding.net/amoore/gcse/viewfromthebridge.htm Useful link]')
- 14:14, 15 Dec 2004 Ahoerstemeier deleted Nokia WAP Microbrowser (content was: 'ok now it is there')
- 14:14, 15 Dec 2004 Ahoerstemeier deleted Norman rogers (content was: 'norman rogers is a 102 year old linux lover who recently rejected sex for a tux sex toy')
- 14:14, 15 Dec 2004 Ahoerstemeier deleted List of Picasso artworks 1951-1960 (content was: 'Picasso 1951-1960')
- 14:13, 15 Dec 2004 Ahoerstemeier deleted Amos Badertscher (content was: 'word to ur east side mother')
- 14:12, 15 Dec 2004 Ahoerstemeier deleted Islam in Peru (content was: 'islam in peru')
- 14:12, 15 Dec 2004 Ahoerstemeier deleted Islam in Bolivia (content was: 'bolivia')
- 14:12, 15 Dec 2004 Ahoerstemeier deleted Nitin kochhar (content was: 'He is from IIFT{{delete}}')
- 14:12, 15 Dec 2004 Quadell deleted Image:Coa of jordan small.jpg (Image has errors and will not display)
- 14:07, 15 Dec 2004 Quadell deleted Image:Cnv29.jpg (Duplicate image)
- 13:54, 15 Dec 2004 Fredrik deleted TOH (linkspam)
- 13:35, 15 Dec 2004 DavidWBrooks deleted Doller (content was: '{{delete}}the term for an amateur kigurumi player.')
- 13:34, 15 Dec 2004 DavidWBrooks deleted Gods Bible Code (content was: '{{db|Spam. }} - nonsense/link spam Gods Bible CodeA key book in the belief system of TOH. Written by SollogBook puts forth many ...')
- 13:33, 15 Dec 2004 DavidWBrooks deleted Chitrapandian (content was: '{{delete}} nonsense/link spam - 'The most wasted day of all is that on which we have not laughed'.Coming soon .. stay tuned !!== eXternal Links : ==[http://chitrap...')
- 13:33, 15 Dec 2004 DavidWBrooks deleted The Creator Formula (content was: '{{db|Spam}}The Creator FormulaA key book in the belief of TOH written by Sollog.This book explains how the Solar System was Intelligently Designe...')
- 13:32, 15 Dec 2004 DavidWBrooks deleted Evoleto (content was: Advertising - '''Evoleto, LLC'''''Your Web Solution Provider.''Evoleto, LLC is a company founded in Aug, 2004 in the State of Delawar...')
- 13:28, 15 Dec 2004 Rlandmann deleted Wikipediasucks.com (content was: 'WikipediaSucks.comA fan site of Sollog and TOH that has become quite popular.http://www.wikipediasucks.com')
- 13:27, 15 Dec 2004 Woggly deleted Levitan, Sharon and Co. (recreated after deletion following VfD vote. content was: '{{deleteagain}}A leading law firm in Israel specializes in insurance, reinsurance and commercial law. [http://www.israelinsurancelaw.com the firm's...')
- 13:26, 15 Dec 2004 Ahoerstemeier deleted Imdg code (content was: 'HELLO CAN YOU GİVE ME INFORMATION ABOUT IMDG CODE?')
- 13:25, 15 Dec 2004 Jnc deleted Solari sandbox (redir, new user mistake)
- 13:24, 15 Dec 2004 Jnc deleted Talk:Solari sandbox (redir, new user mistake)
- 13:22, 15 Dec 2004 Evil saltine deleted Bowsprit Tortoise (content was: '{{del}}== External links ==* [http://www.isv.cc Internationale Schildkröten Vereinigung]')
- 13:14, 15 Dec 2004 Ahoerstemeier deleted Shut up (content was: 'no really. i mean it')
- 13:14, 15 Dec 2004 UtherSRG restored "Walt_Disney_Imagineering"
- 13:14, 15 Dec 2004 UtherSRG restored "Talk:Walt_Disney_Imagineering"
- 13:14, 15 Dec 2004 Ahoerstemeier deleted Nitin kochhar (content was: 'He is a student of IIFT')
- 13:14, 15 Dec 2004 Ahoerstemeier deleted Meaning Of Names (content was: 'austin')
- 13:13, 15 Dec 2004 UtherSRG deleted Walt Disney Imagineering (prep for move. content was: '#REDIRECT [[WED Enterprises]]')
- 13:13, 15 Dec 2004 UtherSRG deleted Talk:Walt Disney Imagineering (prep for move. content was: 'LittleDan, I agree that the Imagineers are engineers, but I removed the edit b/c it didn't flow or add much where you put it (and 'basically' was miss...')
- 13:10, 15 Dec 2004 UtherSRG deleted November 2004 in sports/mistake (content was: '#REDIRECT [[November 2004 in sports]]')
- 13:07, 15 Dec 2004 Rfl deleted Talk:Jagiellonian University (content was: '#REDIRECT [[Talk:Jagiellonian University (old redirect)]]')
- 13:07, 15 Dec 2004 UtherSRG restored "Current_sports_events"
- 13:06, 15 Dec 2004 UtherSRG deleted Current sports events (prep for move/history restore)
- 13:01, 15 Dec 2004 Ahoerstemeier deleted Vomit-in (content was: 'vomit-in')
- 13:00, 15 Dec 2004 Thue deleted Kapang Syndrome (content was: '{{deletebecause|it's a redirect to a deleted article}}#REDIRECT [[Kapang syndrome]]')
- 12:58, 15 Dec 2004 Thue deleted Shandy Gaff (content was: '{{delete}}#REDIRECT [[Shandy_gaff]]' (blind redirect))
- 12:57, 15 Dec 2004 Rfl deleted User talk:Rfl/move test 1 (content was: 'move test 1 talk')
- 12:57, 15 Dec 2004 UtherSRG deleted Jacob Steinhardt/Temp (content was: '#REDIRECT [[Jacob Steinhardt]]')
- 12:56, 15 Dec 2004 Thue deleted Image:Netscape Navigator 4 small.png (Thumb of [[:Image:Netscape Navigator 4.png]])
- 12:56, 15 Dec 2004 UtherSRG deleted Jacob steinhardt/Temp (content was: '#REDIRECT [[Jacob Steinhardt/Temp]]')
- 12:55, 15 Dec 2004 Thue deleted Image:Netscape-small.png (Thumb of [[:Image:Netscape-large.png]])
- 12:55, 15 Dec 2004 Thue deleted Image:Pullmanstrikesmall.jpg (thumb of [[:Image:Pullmanstrikelarge.jpg]])
- 12:54, 15 Dec 2004 Thue deleted Image:Kan.jpg (corrupt image)
- 12:53, 15 Dec 2004 Deb deleted Mrs Johnstone (patent nonsense)
- 12:53, 15 Dec 2004 Deb deleted Jonathan Urm (content was: '{{nonsense}}According to some, he be teh [[leetsauce]]. <3 Jasmine')
- 12:52, 15 Dec 2004 UtherSRG deleted Halifax river (dead redirect link. content was: '#REDIRECT [[Halifax River]]')
- 12:49, 15 Dec 2004 Deb deleted Chitrapandian (content was: 'Coming soon .. stay tuned !!== eXternal Links : ==[http://chitrapandian.blogspot.com/ : Dreamz Unlimited Zone :][http://www.flickr.com/photos/dre...')
- 12:46, 15 Dec 2004 Thue deleted Kyla Cole (content was: '{{delete}}bnv')
- 12:46, 15 Dec 2004 Ahoerstemeier deleted Well Done (content was nonsense: 'The one and only phrase ever spoken by thr Well Done lady. Originally appearing on a rat extermination game, 'Well Done' has become a frequent part of...')
- 12:46, 15 Dec 2004 Quadell deleted Image:Bewicks.swan.arp.750pix.jpg (Duplicate of existing image)
- 12:46, 15 Dec 2004 Quadell deleted Image:Bewicks.swan.arp.250pix.jpg (Duplicate of existing image)
- 12:45, 15 Dec 2004 Quadell deleted Image:Bewicks.swan.2.arp.250pix.jpg (Duplicate of existing image)
- 12:43, 15 Dec 2004 Deb deleted Freewill defence (content was: '{{delete}}free-will defence')
- 12:43, 15 Dec 2004 Deb deleted Love Buzz/Big Cheese (content was: 'lllllllllllllllkkkkkkkkkkkkkkkkkkggggggggggggggggkkkkkkkkkkkkkkkkrrrrrrrrrrrrrrrrrpppppppppppppppppeeeeeeeeeeeeee vvvvvvvvvvvvlllllllllllllllleiiiiii')
- 12:42, 15 Dec 2004 Deb deleted Parkerwock (content was: '[http://tinypic.com/wr51f The Elusive Parkerwock]')
- 12:40, 15 Dec 2004 UtherSRG deleted Ocklawaha river (dead redirect link. content was: '#REDIRECT [[Ocklawaha River]]')
- 12:33, 15 Dec 2004 Thue deleted Cheesecat (content was: 'The Cheesecat lives in the deepest rain forest. It hast 7 legs and 3 arms. 98.4 % of the Cheesecats body consists of cheese. A Cheesecat normally eats...')
- 12:33, 15 Dec 2004 Thue deleted Lieh Tzu (content was: 'he was a man')
- 12:29, 15 Dec 2004 Thue deleted Robin Haigh (user test)
- 12:29, 15 Dec 2004 ALoan restored "Millau_viaduct"
- 12:29, 15 Dec 2004 Thue deleted Nitin kochhar (content was: 'He is a student of IIFT - MBA IB - 2004-06.')
- 12:25, 15 Dec 2004 Thue deleted EBRAHIM bamgii (content was: 'A smeely guy')
- 12:23, 15 Dec 2004 Thue deleted Ajay jassal (content was: ' AJAY IZ DI BEST HE IZ DI MASTER SO WOT DO U HAV 2 SAY')
- 12:22, 15 Dec 2004 ALoan deleted Talk:Millau Viaduct/duplicate (content was: '#REDIRECT [[Millau viaduct]]' - not needed post page move)
- 12:21, 15 Dec 2004 ALoan deleted Millau viaduct (content was: '#REDIRECT [[Millau Viaduct]]' - moving old history here)
- 12:17, 15 Dec 2004 Thue deleted Johnsn (content was: 'Johnsn is a very interesting creature of our today's world. It behaves like a human, and also recreates itself.')
- 12:09, 15 Dec 2004 Thue deleted Keedie Edge (prank)
- 12:04, 15 Dec 2004 Rfl deleted Jagiellonian University (old redirect) (content was: '#REDIRECT [[Jagiellonian University in Kraków]]')
- 12:02, 15 Dec 2004 TPK deleted Noskar (content was: 'noskar (pronounce noshkar) - is nick in Slovakia for person wearing expensive sporting trousers with cheapest second-hand leather jacket and false jew...')
- 12:02, 15 Dec 2004 Rfl restored "Jagiellonian_University_in_Kraków"
- 11:57, 15 Dec 2004 Mustafaa deleted Abouk (content was: '{{delete}}Lebanese slang word that means 'your Daddy'. Usually used with: Ayri, Louteh and Ommak. A word usually said to Hisham Kreitem.')
- 11:56, 15 Dec 2004 Ahoerstemeier deleted Fred and Ginger (content was: 'hljh;lkh')
- 11:56, 15 Dec 2004 Rfl deleted Jagiellonian University in Kraków (fixing the manual moving of [[Jagiellonian University]])
- 11:55, 15 Dec 2004 Ahoerstemeier deleted Centralised Processing System (content was: 'isa the study of ur ma')
- 11:54, 15 Dec 2004 Rfl deleted Jagiellonian University (fixing the manual moving of [[Jagiellonian University]])
- 11:48, 15 Dec 2004 Tarquin deleted Busted logic (content was: 'I hate wikipedia. I wanty wikipedia to DIE!!!!')
- 11:41, 15 Dec 2004 TPK deleted La llamada de Lauren (content was: 'a')
- 11:40, 15 Dec 2004 TPK deleted Devotionalism (content was: 'devotionalism was a merry jape')
- 11:39, 15 Dec 2004 TPK deleted Image talk:José Manuel Durão Barroso.jpg (content was: 'mncvy,mvn,mcvnyxv,myxvnyx,vmxvnhdhasdfjztasdfgkawm.ymvb mn df+ b.ekfhj')
- 11:24, 15 Dec 2004 Thue deleted Kleftiko (content was: '<math>Insert formula here</math><nowiki>Insert non-formatted text here</nowiki>----ggd--[[User:81.182.217.202|81.182.217.202]] 10:49, 15 Dec 2004 (U...')
- 11:22, 15 Dec 2004 Johnleemk deleted Kjetil Andre Aamodt (content was: 'KJETIL ANDRE AADOMT')
- 11:10, 15 Dec 2004 Dysprosia deleted The boner essay (speedy delete)
- 11:04, 15 Dec 2004 Ahoerstemeier deleted Food irradiation (content was: 'Hey dude, this page is cool!')
- 11:03, 15 Dec 2004 Thue deleted McCaig's Tower (Nonsense: "Originally used by cave men for bizarre mating rituals species of evolves mutant fish")
- 11:00, 15 Dec 2004 Thue deleted Analytical Theory of Probabilities (content was: 'Theory of Probabilities')
- 10:59, 15 Dec 2004 Thue deleted Benderloch (content was: '[[Benderloch is a mystical lake where gay people swim. It is the most wonderful homosexual resort in the world.]]')
- 10:55, 15 Dec 2004 Thue deleted List of mausoleums (random characters)
- 10:48, 15 Dec 2004 MacGyverMagic deleted Agilolfing (unwikified text dump of Agilolfing "genealogy". WP is not a genealogy site.)
- 10:47, 15 Dec 2004 Thue deleted USS Harry Truman (content was: 'Hello asshole,You are a son of a bitch')
- 10:45, 15 Dec 2004 Thue deleted Calpurnius (content was: 'uuu')
- 10:45, 15 Dec 2004 Hemanshu deleted List of football clubs in Andorra (content was: ' i will like to know more about andorra soccer teams in andorra')
- 10:21, 15 Dec 2004 MacGyverMagic restored "Thaloc"
- 10:21, 15 Dec 2004 MacGyverMagic deleted Thaloc (lost info in merge, see if longer history is available)
- 10:12, 15 Dec 2004 MacGyverMagic deleted Thalocian (content was: '#REDIRECT [[Thaloc]]')
- 10:09, 15 Dec 2004 Ahoerstemeier deleted Sant'Ivo alla Sapienza (content was: '{{}}~|Þ[[]]ŒÆœ—ÚÈÊäÜÇñßplease')
- 10:07, 15 Dec 2004 MacGyverMagic deleted Thaloc (prepare for incoming merge)
- 09:58, 15 Dec 2004 Ahoerstemeier deleted Strode's College (content was: 'College in Egham.')
- 09:42, 15 Dec 2004 MacGyverMagic deleted James Bates (content was: 'James goes to [[Strode's College]].{{delete}}')
- 09:42, 15 Dec 2004 MacGyverMagic deleted Nick baines (content was: 'nick wrote an article on me and now every weirdo nows where to find me.ha vengence is mine! die swine!{{delete}}')
- 09:40, 15 Dec 2004 MacGyverMagic deleted Azrael lv5 (bio of a forum admin)
- 09:26, 15 Dec 2004 Ahoerstemeier deleted Tanguturi Prakasam Pantulu (content was: 'as')
- 09:20, 15 Dec 2004 Gamaliel deleted Crc16 (content was: '{{del}}dfgfdgfdgdfg')
- 09:11, 15 Dec 2004 SWAdair deleted Jantje liep op straat (non-English text that is apparent nonsense even when translated)
- 09:10, 15 Dec 2004 Ahoerstemeier deleted Emily Howard (content was: 'emily howard is a lady!no shes not, shes a bloke!!!!')
- 09:10, 15 Dec 2004 SWAdair deleted Deep freeze (content was: 'mr freeze created the deep freezing process{{delete}}')
- 09:10, 15 Dec 2004 SWAdair deleted Constitution of Poland (content was: '== Headline text ==ol--[[User:134.83.1.225|134.83.1.225]] 08:47, 15 Dec 2004 (UTC)<nowiki>Insert non-formatted text here</nowiki><math>Insert formula...')
- 09:09, 15 Dec 2004 SWAdair deleted 26th Century (content was: '{{db|no useful content}}Between the years 2500-2599 in Standard Earth Time.')
- 08:47, 15 Dec 2004 SWAdair deleted Mendo mate (content was: '{{db||Advertising}}Mendo Mate is a delicious health drink (supposedly, I've never had the pleasure of tasting it).http://www.mendomate.com/')
- 08:47, 15 Dec 2004 SWAdair deleted Lübeck law (content was: '{{delete}}no smoking<nowiki>Insert non-formatted text here</nowiki>')
- 08:41, 15 Dec 2004 Ahoerstemeier deleted Image talk:Supply-demand-P.png (content was: 'hi<math>Insert formula here</math>D02=Cao2xGC[http://www.example.com link title][[Media:Example.ogg]]--[[User:200.52.136.3|200.52.136.3]] 00:06, 15 ...')
- 08:40, 15 Dec 2004 SWAdair deleted Cockblock (identical duplicate of [[Cock block]])
- 08:35, 15 Dec 2004 SWAdair deleted POT (Pirates of the Theatre) (recreation of already-deleted article)
- 08:34, 15 Dec 2004 SWAdair deleted Mark Howell (recreation of already-deleted (test) page)
- 08:27, 15 Dec 2004 SWAdair deleted Hanusa (content was: '{{delete}}As you can see the combination of vowells and consonants in this name is impecable.1. any last name that ends in a vowell not a 'silent e...')
- 08:26, 15 Dec 2004 Ahoerstemeier deleted IEEE Microwave Theory and Techniques Society (content was: '== External Links ==* http://www.mtt.org/ IEEE MTT-S Official Web Site')
- 08:22, 15 Dec 2004 SWAdair deleted Traian Basescu/Temp (Unused old temp page, never used as basis for article, no need to keep for attribution)
- 08:18, 15 Dec 2004 SWAdair deleted Talk:Lasesr tag (talk page of an already-deleted article)
- 08:17, 15 Dec 2004 SWAdair deleted TEOTWAWKI (content was: '{{delete}}The End Of The World As We Know It')
- 08:17, 15 Dec 2004 SWAdair deleted SHTF (content was: '{{delete}}as in when the 'Shit Hits The Fan.'')
- 08:16, 15 Dec 2004 SWAdair deleted Leif (content was: '{{delete}}Leif has way too much free time on his hands, so he sits around and edits the Wikipedia all day long, never once contacting his friends an...')
- 08:16, 15 Dec 2004 SWAdair deleted Kiryat Belz (content was: 'kiryat belz{{delete}}')
- 08:13, 15 Dec 2004 Ferkelparade deleted Proton Aeroback (content was: '{{delete}}we want proton nasional car evolution')
- 08:11, 15 Dec 2004 Bryan Derksen deleted About:blank (This is already covered in [[About:]], there's no way this is going to become a significant stand-alone article. Not linked to from anywhere else, either, so no need for redirecting.)
- 08:03, 15 Dec 2004 RedWordSmith deleted Kiryat Belz (content was: 'kiryat belz')
- 07:31, 15 Dec 2004 Adam Bishop deleted Chris Renner (content was: '{{db|Not encyclopedia matter}}== Headline text ==Chris RennerThe head basketball coach at [[Ballard High School]] in Louisville, Kentucky. Has...')
- 07:30, 15 Dec 2004 Adam Bishop deleted Turkish wrestlers (need more content than a category)
- 07:26, 15 Dec 2004 Adam Bishop deleted Voiced communication system (content was: '{{delete}}huhuhdhdhdh')
- 07:25, 15 Dec 2004 Adam Bishop deleted Montesquieu, Lot-et-Garonne (this should not be about Montesquieu the person)
- 07:25, 15 Dec 2004 Adam Bishop deleted Fan-in (content was: 'Fan-in{{delete}}')
- 07:24, 15 Dec 2004 Adam Bishop deleted Basketball at the 1964 Summer Olympics (content was: '{{delete}}kj')
- 07:23, 15 Dec 2004 Adam Bishop deleted E-Server (content was: '{{delete}}eServer--[[User:203.115.1.81|203.115.1.81]] 06:40, 15 Dec 2004 (UTC)[[Image:Example.jpg]]')
- 07:19, 15 Dec 2004 Charles Matthews deleted The Everlasting Hatred: The Roots of Jihad (content was: '{{delete}}')
- 07:17, 15 Dec 2004 Charles Matthews deleted Euler force (content was: 'what is the physical significance of euler force?')
- 07:15, 15 Dec 2004 Jimfbleak deleted The Erudin People (content was: '==Erudin People==')
- 07:15, 15 Dec 2004 Jimfbleak deleted Will MA (content was: 'delete}}If you cannot find me in [[User:Willma]]. You may come here to check my details.')
- 07:03, 15 Dec 2004 Adam Bishop deleted Gritts (content was: '{{delete}}')
- 06:48, 15 Dec 2004 Mirv deleted Demultiplexing (content was: '{{delete}}abc')
- 06:48, 15 Dec 2004 Hadal deleted Bishop kelley high school (content was: '{{delete}}MUFFALETTAAA!!!!!')
- 06:40, 15 Dec 2004 DJ Clayworth deleted Swiss banks (content was: 'Safe havens for stolen funds.')
- 06:39, 15 Dec 2004 DJ Clayworth deleted Nicholas Corozzo (content was: 'you fuckin idiots think my uncle is the boss of some organization such as this? you're out of your god damn minds')
- 06:38, 15 Dec 2004 Postdlf deleted NeoPlanet (spam; content was: 'NeoPlanet is a free, customizable internet browser.The browser can be downloaded from http://www.neoplanet.com/')
- 06:34, 15 Dec 2004 Jimfbleak deleted Gritts (content was: 'delete}}GrittsMy girlfriend')
- 06:34, 15 Dec 2004 Jimfbleak deleted Wikiwoe (content was: '{delete}}there's some bad writing on justinian's campaign against the ostrogoths...')
- 06:34, 15 Dec 2004 Jimfbleak deleted Chuck Taylor (content was: 'Chuck Taylor was the inventor of converse shoes. Chucky as he was sometimes called is a total badass and practically a god.-nick snyder')
- 06:33, 15 Dec 2004 Jimfbleak deleted NeoPlanet (content was: 'Neo Planet is a free, customizable internet browser.')
- 06:32, 15 Dec 2004 Adam Bishop deleted Ferdinand Eisenstein (content was: 'E=MC2')
- 06:23, 15 Dec 2004 Hadal deleted Matthew O' Brien (content was: '{{delete}}MATT- I SEE YOU')
- 06:23, 15 Dec 2004 Hadal deleted Hanusa (content was: '{{delete}}HANUSA=COOLEST LAST NAME EVER')
- 06:15, 15 Dec 2004 Hadal deleted C99 Parser (content was: '{{db|No text}}')
- 06:13, 15 Dec 2004 Postdlf deleted Gooky Chink Ass Slanteye (content was: 'Racist Slang that is highly innappropriate.')
- 06:13, 15 Dec 2004 DJ Clayworth deleted Ben Nourse (content was: 'Test')
- 06:13, 15 Dec 2004 DJ Clayworth deleted Mike Edrington (content was: '{{delete}}Hey')
- 06:13, 15 Dec 2004 Postdlf deleted AmphetaDesk (content was: '{{delete}}1' (nope. 0.))
- 06:12, 15 Dec 2004 Hadal deleted M0rb (content was: '{{delete}}Short with fuzzy head.')
- 06:11, 15 Dec 2004 Hadal deleted Sheister (content was: 'The IRC handle of a very intelligent yet obnoxious individual between 1999 and 2003.<br>Last seen on #hooked, EFnet. <br>AKA ''meatman'' (see: http:...')
- 06:11, 15 Dec 2004 DJ Clayworth deleted Matt Yohe (content was: 'Ghay!')
- 06:10, 15 Dec 2004 DJ Clayworth deleted Mike edrington (content was: 'Mike Edrington is sweet and awesome.He is single.He blogs. www.keef.net/mike')
- 06:10, 15 Dec 2004 Hadal deleted Matt yohe (content was: 'Matt Yohe died Dec. 15, 2004 of Liver Failure.His aunt puts out records. She is anointed.')
- 06:08, 15 Dec 2004 Hadal deleted Appie (content was: '{{delete}}best buddy of [[eggie]]')
- 06:08, 15 Dec 2004 Hadal deleted Eggie (content was: '{{delete}}The most awesome person ever lived.the soul mate of [[Darren]]')
- 06:07, 15 Dec 2004 Hadal deleted Darren (content was: '{{delete}}most understanding person ever, soul mate of [[eggie]]')
- 06:03, 15 Dec 2004 DJ Clayworth deleted User:!!!!!!WIKIPEDIA SUCKS!!!!!! (content was: 'troll'. Deleted because patent nonsense and not created by the user.)
- 05:59, 15 Dec 2004 DJ Clayworth deleted Hanusa (content was: 'HANUSA=THE BEST LAST NAME EVER!')
- 05:56, 15 Dec 2004 Gadfium deleted Robert Pickle (content was: '''''Saint' Robert 'Moishe' Pickle''' (born? hatched?) (died?) is one of the few people in the world who have been found to be in breach of all 7 of th...')
- 05:55, 15 Dec 2004 DJ Clayworth deleted Army of Virginia (content was: 'l')
- 05:53, 15 Dec 2004 DJ Clayworth deleted Wikipedia:Votes for deletion/Purplefeltangel (subpage for a VFD that was nominated in violation of policy - no need to keep)
- 05:52, 15 Dec 2004 Gadfium deleted Advanced black bee position (content was: '{{del}}iiiii')
- 05:49, 15 Dec 2004 Hadal deleted Low power radio (content was: 'asdsd{{delete}}')
- 05:48, 15 Dec 2004 Hadal deleted Cross sex position (content was: 'iiiiii{{delete}}')
- 05:40, 15 Dec 2004 Gadfium deleted First kushite king (Obvious test page)
- 05:32, 15 Dec 2004 SWAdair deleted Wikipedians/Andrea Parri (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Andrea Parri/old]]')
- 05:32, 15 Dec 2004 SWAdair deleted Why do my balls itch (content was: '{{delete}}Because of Itchy Gnomes. And perhaps VD's!They also may itch so bad.')
- 05:31, 15 Dec 2004 SWAdair deleted Weenis (content was: '{{nonsense}}Slang - The weenis, is the skin on the elbow of any living creature (with elbows of course). Created as a joke in San Diego or Oregon (...')
- 05:31, 15 Dec 2004 SWAdair deleted Tremorton (content was: '{{delete}}Town that is now called Trillville')
- 05:30, 15 Dec 2004 SWAdair deleted Tony Garland (nonsense libel)
- 05:30, 15 Dec 2004 SWAdair deleted The music of florence (content was: '{{delete}}The music of Florencethe music of florence can only be explained in one word SEXUAL')
- 05:30, 15 Dec 2004 SWAdair deleted The Cunctator/Edited pages (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:The Cunctator/old-Edited pages]]')
- 05:29, 15 Dec 2004 SWAdair deleted Talk:Moonsorrow (content was: '{{del}}Moonsorrow == roxor.')
- 05:27, 15 Dec 2004 DJ Clayworth deleted Joey jorsidon (content was: 'joey jordison is a fucking music legend. he started playing guitar when he was 5 and drums when he was 7.')
- 05:27, 15 Dec 2004 Aranel deleted Category:Vaudeville performer (content was: '{{cfd}}This category has been moved to [[:Category:Vaudeville performers]]. It may be deleted at any time by a administrator.')
- 05:24, 15 Dec 2004 SWAdair deleted Talk:Flag of Belgium (content was: '{{del}}'''Bold text'''It likes to poop on your head')
- 05:24, 15 Dec 2004 SWAdair deleted Szopen/About (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Szopen/old-About]]')
- 05:24, 15 Dec 2004 SWAdair deleted Stephen Gilbert/ToDo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Stephen Gilbert/old-ToDo]]')
- 05:23, 15 Dec 2004 SWAdair deleted Neosonix (content was: '{{nonsense}}Neosonix was the main creator of the web page [[sonicultra]]. He looked over the message board and kept things in order. The web page wa...')
- 05:23, 15 Dec 2004 SWAdair deleted Someone/wikipidians friends (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Someone/old-wikipidians friends]]')
- 05:21, 15 Dec 2004 SWAdair deleted Sice (content was: '{{delete}}he's the man for you duhn da dahhhhhhhhhhhhhhhhhhh')
- 05:21, 15 Dec 2004 SWAdair deleted Ryguasu/conversion script AI (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Ryguasu/conversion_script_AI]]')
- 05:21, 15 Dec 2004 SWAdair deleted Prudent (content was: '{{delete}}prudent')
- 05:21, 15 Dec 2004 SWAdair deleted Mumiy Troll (content was: ''''Mumiy Troll''' is a [[pop]]-[[music|rock]] musical band from Russia.{{deletebecause|Totally lacking content.}}')
- 05:20, 15 Dec 2004 SWAdair deleted Moderate/radical Republican (content was: '{{delete}}== Headline text ==<nowiki>Insert non-formatted text here</nowiki>----javascript:insertTags('\'\'\'','\'\'\'','Bold text');Bold textei...')
- 05:20, 15 Dec 2004 SWAdair deleted Kế toán (content was: '{{delete}}Là hệ thống ghi chép sổ sách tài chính của doanh nghiệp')
- 05:18, 15 Dec 2004 SWAdair deleted Krzysztof P. Jasiutowicz/Metadata pattern talk (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Kpjas/old-Metadata pattern talk]]')
- 05:17, 15 Dec 2004 SWAdair deleted John Lucas Cranach (content was: 'penis{{delete}}')
- 05:17, 15 Dec 2004 SWAdair deleted Gareth Owen/todo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Gareth_Owen/todo]]')
- 05:16, 15 Dec 2004 Neutrality deleted Zach (content was: '{{delete}}The ruler of Iceland in the year 1859. Zach, or Himbrand Ironfinger, was known most notably for his ''Poor Zach's Alamanac'' in which he de...')
- 05:15, 15 Dec 2004 SWAdair deleted Gareth Owen/inprogress (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Gareth_Owen/inprogress]]')
- 05:14, 15 Dec 2004 Hadal deleted Kkiopp (content was: 'KKiopp{{delete}}')
- 05:14, 15 Dec 2004 SWAdair deleted FRATERNITY vACATION (content was: '{{delete}}'''Bold text'''Fraternity Vacation')
- 05:14, 15 Dec 2004 SWAdair deleted Crooms Academy of Information Technology (content was: '{{delete}}Information Technology magnet school in Seminole County, Florida. Students who attend are given a laptop to do their work on.Home page: ...')
- 05:13, 15 Dec 2004 SWAdair deleted Charles Sheeler (content was: '{{delete}}go to hell')
- 05:13, 15 Dec 2004 SWAdair deleted Bifkin (content was: '{{del}}The area of skin between the testis and anus in a man or the vagina and anus of a woman, anatomically termed the 'perineam' but more commonly ...')
- 05:13, 15 Dec 2004 SWAdair deleted Bayin (content was: 'Áá{{delete}}')
- 05:12, 15 Dec 2004 SWAdair deleted Ballë për Ballë (content was: '{{delete}}balle per balle')
- 05:12, 15 Dec 2004 SWAdair deleted Allison edwards (content was: '{{delete}}Born 1984 in Lincoln County Kentucky. Allison is currently dating Josh Barnett. She also owns six cats and a hamster named Napoleon. She ...')
- 04:54, 15 Dec 2004 SimonP deleted Michael Porter Goldsmith (listed on VfD, no objections to deletion)
- 04:53, 15 Dec 2004 SimonP deleted Levitan, Sharon and Co. (listed on VfD, votes 8-1 in favour of deletion)
- 04:52, 15 Dec 2004 SimonP deleted David S. Walton (listed on VfD, votes 5-1 in favour of deletion)
- 04:51, 15 Dec 2004 SimonP deleted Booboo (listed on VfD, votes 11-1 in favour of deletion)
- 04:48, 15 Dec 2004 SimonP deleted Peter Welleman (listed on VfD, votes 7-1 in favour of deletion)
- 04:45, 15 Dec 2004 SimonP deleted Down In The Alley (listed on VfD, no objections to deletion)
- 04:40, 15 Dec 2004 Johnleemk deleted Chairman of constitution convention (content before blanking was: 'weeeee')
- 04:36, 15 Dec 2004 Johnleemk deleted Matthew haughton (content was: '== Headline text ==Matthew Haughton. Student. Sav.----Matthew Haughton was born on March 19th, 1987. The same date that some other people were ...')
- 04:32, 15 Dec 2004 Rdsmith4 restored "User:Rdsmith4"
- 04:30, 15 Dec 2004 Rdsmith4 deleted User:Rdsmith4 (starting over)
- 04:30, 15 Dec 2004 Gadfium deleted Mevermind the Bollocks (Misspelling of [[Nevermind the Bollocks]], no real content.)
- 04:27, 15 Dec 2004 Hadal deleted Jeff udovic (content was: '{{delete}}== Mi Mi Mi Mi! ==Jeff Udovic is a useless polish biker with a rebel good-for-nothing attitude thats going to get him absolutely nowhere...')
- 04:25, 15 Dec 2004 DJ Clayworth deleted Davoi (content was: 'The Davoi are a powerful clan of Orcs, and are found in force throughout this fortress. It is located in the south of Jugner Forest. It is built upon ...')
- 04:12, 15 Dec 2004 DJ Clayworth deleted Dan steven smith (content was:He is a fucking ninja. He is such a sweet ninja, that he can out ninja any oth...')
- 04:10, 15 Dec 2004 PMelvilleAustin deleted Image:Palpy.jpg (orphan)
- 04:07, 15 Dec 2004 SimonP deleted Johannes Haut (content was: 'My name is Karen Haught Fritz and live in Pennsylvania, USA. Am doing geneaology workup on the Haut family who we believe came from the area around S...')
- 04:01, 15 Dec 2004 Hadal deleted Eric Bowers (content was: 'Date of birth: June 23, 1986.College student at SUNY Plattsburgh.')
- 03:51, 15 Dec 2004 Morven deleted Image:PRR B29 8550.jpg (Deleting; uploaded wrong version by mistake.)
- 03:49, 15 Dec 2004 Gamaliel deleted Alethea Meigs (Walton) McCormick (redirect to deleted article)
- 03:49, 15 Dec 2004 Gamaliel deleted Nathaniel Young Walton (redirect to deleted article)
- 03:37, 15 Dec 2004 Francs2000 deleted Computing Verification Systematics (content was: 'heyehyeyhe')
- 03:32, 15 Dec 2004 UtherSRG deleted Category:Spoiler warning (content was: 'This category includes articles that include spoiler warnings.==See Also==[[Wikipedia:Spoiler warning]][[Category:Wikipedia style and how-to]]')
- 03:32, 15 Dec 2004 Francs2000 deleted Military history of australia (content before blanking was: '== External links ==[http://www.defence.gov.au/index.cfm Australian Government, Department of Defence][http://www.awm.gov.au/atwar/conflict.htm Au...')
- 03:31, 15 Dec 2004 Niteowlneils deleted Nicole Lenz (content was: '{{delete}}Well Paris is a great person and she has lots of good friends such as Rick Solomon who is really hot>>>')
- 03:31, 15 Dec 2004 Niteowlneils deleted Eritrean Liberation Front (content was: '{{delete}}see isiais afwerki')
- 03:30, 15 Dec 2004 Francs2000 deleted Military history of Australia (content was: '== External links ==[http://www.defence.gov.au/index.cfm Australian Government, Department of Defence][http://www.awm.gov.au/atwar/conflict.htm Aus...')
- 03:29, 15 Dec 2004 Academic Challenger deleted Tony Garland
- 03:27, 15 Dec 2004 Academic Challenger deleted Machecoul (content was: 'A lot of muthafuckas died here, yo. Check it.')
- 03:25, 15 Dec 2004 Jnc deleted Mincus (xspace redir to User:)
- 03:22, 15 Dec 2004 SimonP deleted Gogo (Final Fantasy VI) (listed on VfD, votes 9-2 in favour of deletion)
- 03:20, 15 Dec 2004 Francs2000 deleted Tendokan Aikido (content was: 'http://www004.upp.so-net.ne.jp/tendokan/index.htm')
- 03:20, 15 Dec 2004 Jrdioko deleted Tan Sri Syed Mokhtar Al-Bukhary (content was: 'hai')
- 03:19, 15 Dec 2004 RadicalBender deleted Talk:Plano, Texas (content was: 'I live here. [[User:24.1.184.153|24.1.184.153]] 23:37, 14 Dec 2004 (UTC)')
- 03:18, 15 Dec 2004 Francs2000 deleted Amygdaloidal (content was: '{{delete}}== Headline text ==your web page is stupid very dumb dumb dumb dumb')
- 03:18, 15 Dec 2004 Francs2000 deleted Talk:Military history of Australia (content was: 'the state of this page is quite depressing. The significant number of troops australia has sent overseas for World War One/Two have yet to be acknowle...')
- 03:17, 15 Dec 2004 Francs2000 deleted Military history of Australia (content was: '== External links ==[http://www.awm.gov.au/atwar/conflict.htm Australian Military History: An overview (Australian War Memorial Website]')
- 03:17, 15 Dec 2004 Jrdioko deleted Agrarian revolt (content before blanking was: 'hi')
- 03:15, 15 Dec 2004 Francs2000 deleted Doogin O'Doyle (chess player) (nonsense from a repeat vandal)
- 03:14, 15 Dec 2004 SimonP deleted The Detholz! (listed on VfD, votes 5-1 in favour of deletion)
- 03:13, 15 Dec 2004 Francs2000 deleted Benitoz (nonsense)
- 03:13, 15 Dec 2004 SimonP deleted Eamonn Reading (listed on VfD, no objections to deletion)
- 03:13, 15 Dec 2004 Joy Stovall deleted Nathaniel Y. Walton (VFD consensus. 1 vote to keep, 20 to delete)
- 03:12, 15 Dec 2004 SimonP deleted Baron pluroon (listed on VfD, no objections to deletion)
- 03:11, 15 Dec 2004 SimonP deleted Ripodb.tk (listed on VfD, votes 6-1 in favour of deletion)
- 03:08, 15 Dec 2004 Francs2000 deleted The Electrifying Mojo (content was: 'I remember mojo as being one of the best dj's in detroit. he would spin a very eclectic mix of music consisting of anything from prince to the b-52's.')
- 03:08, 15 Dec 2004 Francs2000 deleted Sensor resolution (content was: '{{delete}}')
- 03:08, 15 Dec 2004 Francs2000 deleted Chopin competition (content was: 'Chopin')
- 03:07, 15 Dec 2004 Joy Stovall deleted The shocker (VFD consensus to delete: unanimous vote )
- 03:02, 15 Dec 2004 Francs2000 deleted Nerdshoe (content was: 'A very nerdy person who watches discovery channel and sci-fi channel quite a bit.')
- 03:00, 15 Dec 2004 Dante Alighieri deleted Tony garland (content was: 'Tony Garland is a homosexual that currently lives in Adelaide, South Australia.His interests include buying kiteboards but never using them and farti...')
- 02:59, 15 Dec 2004 Dante Alighieri deleted Charlie maguire (content was: '==Patch==Patch died about 1.5 years ago.==Mary Ann==His beloved mother.')
- 02:58, 15 Dec 2004 Dante Alighieri deleted Mark Howell (content was: 'Mathematics teacher notable for such phrases as 'I'm Smart as Shit,' 'If that doesn't get your math juices flowing you had better check your pulse,' a...')
- 02:57, 15 Dec 2004 Dante Alighieri restored "Shadowmech"
- 02:57, 15 Dec 2004 Dante Alighieri restored "Neosonix"
- 02:56, 15 Dec 2004 Joy Stovall deleted Alethea W. McCormick (VFD unanimous consensus to delete)
- 02:54, 15 Dec 2004 Francs2000 deleted Kateryna Yushchenko-Chumachenko (content was: '{{delete}}I am trying to see a picture')
- 02:53, 15 Dec 2004 Francs2000 deleted Smart/browse/Christian Falangist Party of America (content was: '{{deletebecause|nonsense}}christian falangist party of america')
- 02:53, 15 Dec 2004 Joy Stovall deleted Xampp (VFD consensus to delete. 7 votes delete, 1 anonymous vote to keep)
- 02:51, 15 Dec 2004 Francs2000 deleted Shin Meikai Kokugo Jiten (content was: 'やわらかい')
- 02:49, 15 Dec 2004 Academic Challenger deleted Gobble (content was: '{{delete}}The gobble, is the skin under the chin')
- 02:48, 15 Dec 2004 Francs2000 deleted Belt buckle (content was: '{{delete}}hi belt pls')
- 02:47, 15 Dec 2004 Francs2000 deleted QIK2JDG (content was: '{{del}}'''Bold text'''''Italic text''== Headline text ==[[Image:Example.jpg]]')
- 02:46, 15 Dec 2004 Francs2000 deleted Index.html/wikipedia/de/Dermaptera.html (content was: '{{delete}}hi im morgan...im stupid...duhhhhhhhhhhhhhhhhh duhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhduhhhhhhhhhhhhhhhhhhhhhhhhhh')
- 02:46, 15 Dec 2004 Neutrality deleted Belt buckle (content was: 'hi belt pls')
- 02:44, 15 Dec 2004 Francs2000 deleted Korea univ (incorrect name, copyvio)
- 02:44, 15 Dec 2004 Mirv deleted Weenis (content was: '{{del}}The weenis, is the skin on the elbow')
- 02:43, 15 Dec 2004 Francs2000 deleted Adult / Sex magazine (content was: '{{delete}}Yo yo yo I want to see som X-rated material!!!!!!!!!!!!!')
- 02:43, 15 Dec 2004 Francs2000 deleted Florencia 13 (content was: '{{delete}}florence gangs worst enemy is not 18street at the time its east coast crips')
- 02:43, 15 Dec 2004 Francs2000 deleted Communist Revolution (content was: '{{delete}}ALOHA ALOHA SUKA')
- 02:43, 15 Dec 2004 Francs2000 deleted Collage artist (content was: '{{delete}}richard hamilton')
- 02:43, 15 Dec 2004 Neutrality deleted Grunt Rebellion (content was: 'Rumored to be a time when a Arbiter was required for the Covenant. This was probably before the grunts were forced to become part of the Covenant Armada and Rebelled.' (funny))
- 02:42, 15 Dec 2004 Francs2000 deleted Kiara (content was: '{{delete}}hahah NO'''Bold text'''')
- 02:42, 15 Dec 2004 Francs2000 deleted Jack McDonald (content was: '{{del}}1919 - was part of the reason that the Stanley Cup was cancelled.See Spanish Flu')
- 02:42, 15 Dec 2004 Francs2000 deleted Aight (content was: '{{del}}Aight, which is a slang interpretation of the word alright.')
- 02:39, 15 Dec 2004 Danny deleted Aight (content was: 'Aight, which is a slang interpretation of the word alright.')
- 02:38, 15 Dec 2004 Joy Stovall deleted Speedwood (Unanimous consensus to delete)
- 02:35, 15 Dec 2004 Joy Stovall deleted Acoustic thrash (VFD unanimous consensus to delete)
- 02:33, 15 Dec 2004 Mirv deleted Robot Patent (content was: '{{delete}}SOMEONE FIGURE SOMTHING OUT!')
- 02:31, 15 Dec 2004 Joy Stovall deleted Shmuck (Unanimous VFD consensus to delete )
- 02:30, 15 Dec 2004 Mirv deleted Evan gewirtz (content was: 'is a flagellum')
- 02:19, 15 Dec 2004 Neutrality deleted Image:Bull Bison in Mud Volcano Area-300px.JPG (Unneeded thumbnail.)
- 02:17, 15 Dec 2004 Dante Alighieri restored "Thaddeus_J._Hogan"
- 02:15, 15 Dec 2004 Dante Alighieri restored "Sonicultra"
- 02:14, 15 Dec 2004 Dante Alighieri restored "Zancho-San"
- 02:13, 15 Dec 2004 Dante Alighieri restored "Nuts2U"
- 02:12, 15 Dec 2004 Dale Arnett deleted West Virgina Media Holdings (Moved to correctly spelled version (West Virginia Media Holdings). Have taken care of the only currently linked page.)
- 02:10, 15 Dec 2004 Joy Stovall deleted Elizabeth Karp (content was: '{{delete}}speaking of huge nerds'smoke weed everyday' - snoop')
- 02:10, 15 Dec 2004 Joy Stovall deleted Elizabeth Karp (content was: 'speaking of huge nerds'smoke weed everyday' - snoop')
- 02:10, 15 Dec 2004 Ta bu shi da yu deleted Wikipedia:Requests for comment/Ta bu shi da yu (Done. )
- 02:08, 15 Dec 2004 Mackensen deleted User:Mackensen/Arbitration election endorsements (content was: '===[[User:Jdforrester|James F.]]===*[[User:Mackensen|Mackensen]] [[User_talk:Mackensen|(talk)]] 17:41, 18 Nov 2004 (UTC)===[[User:Neutrality|Neutra...')
- 02:07, 15 Dec 2004 Neutrality deleted Talk:Urban spelunker (content was: 'BOOBIES!--[[User:68.80.187.135|68.80.187.135]] 02:06, 15 Dec 2004 (UTC)Howdy')
- 02:07, 15 Dec 2004 Francs2000 deleted Bobsacks (nonsense)
- 02:07, 15 Dec 2004 Francs2000 deleted Talk:Frought (content was: 'i totally agree')
- 02:06, 15 Dec 2004 Francs2000 deleted Frought (content was: 'smoke weed everyday')
- 02:06, 15 Dec 2004 Francs2000 deleted Open (system call) (content was: 'dave')
- 02:00, 15 Dec 2004 Neutrality deleted Talk:Enola Gay (content before blanking was: 'look at me i am jason oliver seeking a strong male reach me at 1-719-233-5433')
- 01:59, 15 Dec 2004 Niteowlneils deleted Pigmouth carp (content was: '{{db|Something appears to have violently attacked this brave anonymous editor just as he was writing the article. Oh dear.}}The asd;flkjasdf;lajfldas...')
- 01:59, 15 Dec 2004 Niteowlneils deleted Michael gagan (content was: '{{delete}}#REDIRECT [[Michael Gagan]]')
- 01:58, 15 Dec 2004 Francs2000 deleted American Savings and Loan Association (content was: 'This is not an article!{{delete}}')
- 01:58, 15 Dec 2004 Francs2000 deleted Hammamet (content was: ',mklnjkjkbkb{{nonsense}}')
- 01:55, 15 Dec 2004 Bkonrad deleted Murder-glam (content was: '{{delete}}What in the world does this mean and why was there a link to it, since there is no entry?I conclude it is a rare species of africanized ...')
- 01:53, 15 Dec 2004 Jnc deleted Mike Dill (xspace redir to User:)
- 01:52, 15 Dec 2004 Francs2000 deleted Lake Nasser-Josh l p (content was: 'lol wow... ya thats my lake. lol')
- 01:42, 15 Dec 2004 Francs2000 deleted Brad Gillis (content was: 'Guitarist for Night Ranger.')
- 01:39, 15 Dec 2004 Francs2000 deleted Solar prominence (content was: '{{delete}}These things start on fire with explosions they make lots of noise!')
- 01:38, 15 Dec 2004 Francs2000 deleted Congenital malformation (content was: '{{del}}congenital malformation')
- 01:37, 15 Dec 2004 Francs2000 deleted Momo no Ten-nen sui (content was: '{{del}}A Peach flavored soft drink now appearing as a villian in 'Devastator II'')
- 01:28, 15 Dec 2004 Flockmeal deleted Trash fish (content was: 'trash fish')
- 01:26, 15 Dec 2004 Francs2000 deleted Image (school seal or photo) (placeholder for an image content was: '[[Image:groton.png|alt text]]')
- 01:25, 15 Dec 2004 Francs2000 deleted Dan Graham (content was: '[[de: Dan Graham]]')
- 01:25, 15 Dec 2004 Francs2000 deleted OpenSourceCMS (content was: '{{del}}')
- 01:25, 15 Dec 2004 Flockmeal deleted Toefoody (content was: 'Toefoody say 'Gimme them old happy feet!' to the Shopes of Nyee. They have many ways of saying things about grunion and the Stibers.')
- 01:23, 15 Dec 2004 Niteowlneils deleted Blood Brothers (prep for move--content was: '#REDIRECT [[Blood Brothers (disambiguation)]]')
- 01:23, 15 Dec 2004 Flockmeal deleted Denon (content was: 'Denshi Giken IND Co,Ltd')
- 01:18, 15 Dec 2004 Neutrality deleted Adamant (chess) (content was: 'kjhlkjhlkjljkjkjlkjlkjlkjlkjlkj')
- 01:17, 15 Dec 2004 Neutrality deleted NADE (content was: 'The nat and the ade.')
- 01:16, 15 Dec 2004 Neutrality deleted US local history terms (content was: '== Headline text =='''[[Precedent]]-''' actions set aside for a later president'''[[Cabinet]]-''' group of closed advisors-head of departments''...')
- 01:16, 15 Dec 2004 Neutrality deleted Otto von Ziechtzel (Per VFD (hoax))
- 01:12, 15 Dec 2004 Dante Alighieri deleted Thaddeus J. Hogan (content was: '{{vfd}}Thaddeus J. Hogan is a computer programmer and researcher born in 1983 in Minneapolis Minnesota.')
- 01:10, 15 Dec 2004 Dante Alighieri deleted Erin Gagan (content was: '{{deletebecause|it is vindictive nonsense}}Erin Gagan is the worst person in the world, she also smells really bad. She must have recieved the sho...')
- 01:06, 15 Dec 2004 Geogre deleted Creesoft (Spam: one incomprehensible line and then a link to their site. )
- 01:04, 15 Dec 2004 Dante Alighieri deleted Phoenix Evans (speedy (unverifiable vanity page))
- 01:03, 15 Dec 2004 Meelar deleted St. Mihiel offensive (content was: 'huh')
- 01:02, 15 Dec 2004 Francs2000 deleted HP2ref (content was: '{{del}}#REDIRECT [[Template:HP2ref]]')
- 01:00, 15 Dec 2004 Meelar deleted Evan smith (personal attack)
- 01:00, 15 Dec 2004 Flockmeal deleted Il Gesù (content was: '[[Image:Example.jpg]]')
- 00:59, 15 Dec 2004 DropDeadGorgias deleted The Gilded Age: A Tale of Today (content was: '{{db|No meaningful history}}''The Gilded Age: A Tale of Today'' was a book about the United States in the late nineteenth century written by Mark Twa...')
- 00:59, 15 Dec 2004 Meelar deleted The Curse of the Jade Scorpion (content was: '{{delete}}Are there music credits for the movie,'Curse of The Jade Scorpion'? If so where can i find them? Magikun6@netscape.net')
- 00:58, 15 Dec 2004 Francs2000 deleted Thomas Bond (content was: 'uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuhhhhhhhhhhhhhhhhhhhh')
- 00:58, 15 Dec 2004 Dante Alighieri deleted User:The Recycling Troll (content moved to talk page)
- 00:57, 15 Dec 2004 Francs2000 deleted MediaWiki User's Guide: Starting a new page (test)
- 00:56, 15 Dec 2004 Francs2000 deleted Toyota Aristo (content was: 'Lexus GS Series in North America')
- 00:55, 15 Dec 2004 Francs2000 deleted Loren carley (content was: 'Is a cool guy that is sitting next to Mike Johnson... the other coolest guy')
- 00:54, 15 Dec 2004 Francs2000 deleted Swampy Cree language (content was: 'Hello my name is Ivy')
- 00:53, 15 Dec 2004 Meelar deleted The DQ Crew (content was: 'We are teh leetest group of employees ever, unbeatable in any sport, or competition.')
- 00:53, 15 Dec 2004 Rdsmith4 deleted What is a limerick (content was: ''''Bold text'''== Headline text ==[[Link title]][http://www.example.com link title]')
- 00:51, 15 Dec 2004 Meelar deleted Derek rabideau (content was: '{{del}}Derek Rabideau's AIM screen name is xsyn ackx, send him lots of spam via aim.His email address is Veggiepossum23 at new.rr.com and synack@new...')
- 00:47, 15 Dec 2004 Meelar deleted Dan fink (content was: 'Dan Fink is a male living in Neenah, Wisconsin. He is all like, wtf mate?')
- 00:46, 15 Dec 2004 Dante Alighieri deleted Solar prominence (content was: '{{del}}solar things are hot they explode and make noises')
- 00:45, 15 Dec 2004 Dante Alighieri deleted Saturday Suprises (content was: '{{db|It's wednesday}}this is a Saturday Suprise!!!!')
- 00:45, 15 Dec 2004 Dante Alighieri deleted Nazi tales (content was: 'You smell.{{delete}}')
- 00:44, 15 Dec 2004 Dante Alighieri deleted List of words censored at the Sports Interactive Messageboards (patent nonsense)
- 00:44, 15 Dec 2004 Dante Alighieri deleted Talk:List of words censored at the Sports Interactive Messageboards (patent nonsense)
- 00:43, 15 Dec 2004 Dante Alighieri deleted Do egyptians live in large thickly populated settlements? (content was: '{{del}}I don't know you tell me. All smart people who Know the answer make a page and tell the answer. Please! Show off your smart, It's cool!doh')
- 00:39, 15 Dec 2004 Dante Alighieri deleted Michael Timothy Johnson (content was: '{{del}}Is a man who loves his oatmeal')
- 00:33, 15 Dec 2004 Dante Alighieri deleted Zancho-San (content was: '{{nonsense}}Zancho-San is one of the creators of [[sonicultra]]. He worked on the movie and comic parts of the site. His avitar was a blue knuckels ...')
- 00:33, 15 Dec 2004 Dante Alighieri deleted Tore Christian Solheim (patent nonsense)
- 00:32, 15 Dec 2004 Dante Alighieri deleted Talk:Patrick Doherty (content was: '{{del}}THE PATRICK PAGE SHOULD NOT BE DELETED! It is totally, although somewhat bizzare, completely true. He rules all with a giant fist, and requi...')
- 00:31, 15 Dec 2004 Dante Alighieri deleted Talk:Lewis Hallam (content was: '{{del}}Hi I'm Austin Beals and I found this link. My middle name is Lawrence and I sleep with my teddy bear his name is joe boxer (the underware kin...')
- 00:31, 15 Dec 2004 Dante Alighieri deleted Sonicultra
- 00:30, 15 Dec 2004 Dante Alighieri deleted Nuts2U (content was: '{{vfd}}Nuts2U was a hacker who hacked into the web site [[sonicultra]] once inside he caused havok and was one of the reasons that it had to shut dow...')
- 00:30, 15 Dec 2004 Dante Alighieri deleted Shadowmech (content was: 'Shadowmech was a co-creator of the web-site [[sonicultra]]. He had a short lived comic series, named 'Kill Amy: The Series', which was only up for one...')
- 00:30, 15 Dec 2004 Dante Alighieri deleted POT (Pirates of the Theatre) (content was: '{{del}}A group that releases illegally taped movies onto the internet.')
- 00:29, 15 Dec 2004 Dante Alighieri deleted Ngentot (wikipedia is not a dictionary, especially not of foreign words)
- 00:28, 15 Dec 2004 Dante Alighieri deleted Neosonix (content was: '{{nonsense}}Neosonix was the main creator of the web page [[sonicultra]]. He looked over the message board and kept things in order. The web page wa...')
- 00:28, 15 Dec 2004 Dante Alighieri deleted Moon ducks (patent nonsense)
- 00:28, 15 Dec 2004 Dante Alighieri deleted Modern Catholic philosophy (content was: '{{delete}}Catholic philosophy is gay.')
- 00:28, 15 Dec 2004 Dante Alighieri deleted Min heap order (content was: '{{delete}}asdf')
- 00:27, 15 Dec 2004 Dante Alighieri deleted MYRAGE (content was: '{{del}}A musical project masterminded by the incredibly talented musician named Josh Driscoll. Currently in experimental phases.')
- 00:27, 15 Dec 2004 Dante Alighieri deleted Lakhnavi (content was: '{{del}}'''Lakhnavi''' - surname used by someone who is from Lucknow, Uttar Pradesh, India.')
- 00:26, 15 Dec 2004 Dante Alighieri deleted Image:BCPcycle.gif (image poster requested deletion, resizing in progress)
- 00:26, 15 Dec 2004 Dante Alighieri deleted Ida Beate Areklett (patent nonsense)
- 00:25, 15 Dec 2004 Dante Alighieri deleted Geography of Asia (content was: '{{del}}<math>[[Media:[[Image:[[Media:--Kbdank71 20:53, 29 September 2005 (UTC)<nowiki>----[[== == == Headline text ==the geogrphy of asia is bumpy? == ==]]</nowiki>]]]]]]</math>')
- 00:24, 15 Dec 2004 Dante Alighieri deleted Elysium City (content was: '{{delete}}The birthplace of John-117, The Master Chief')
- 00:23, 15 Dec 2004 Dante Alighieri deleted Despot (hip hop) (self promo)
- 00:23, 15 Dec 2004 Dante Alighieri deleted Crunchy Black (content was: '{{delete}}Crunchy blac dont mess around.look for his new album feb 2005.')
- 00:22, 15 Dec 2004 Dante Alighieri deleted Chris Ansette (content was: '{{del}}Born in Ashford, Kent (England) on July 12 1986')
- 00:22, 15 Dec 2004 Dante Alighieri deleted Cassidy Cornell (content was: '{{delete}}LOTHOR ES DESOBEDIENTE Y EVIL CON LOS RANGERS SUS IDENTIDADES AMARILLO .. DUSTIN BROOKS ROJO .. SHANE CLARKAZUL .. TORI HANZONROJO CA...')
- 00:21, 15 Dec 2004 Dante Alighieri deleted Bloo Bio (content was: '{{nonsense}}Image coming soon...*Name: Bloo'*Species of imaginary friend: Paintblob*Creator: Mac*Color(s): *Azure*Cerulean*Indigo*Light Blu...')
- 00:21, 15 Dec 2004 Dante Alighieri deleted Arun m (content was: '{{delete}}Ha! This is Foster saying it works!')
- 00:21, 15 Dec 2004 Dante Alighieri deleted Lewis Hallam (newbie test)
- 00:20, 15 Dec 2004 Dante Alighieri deleted Luke marston (patent nonsense)
- 00:18, 15 Dec 2004 Dante Alighieri deleted Do egyptians live in large thickly populated settlements? (content was: 'I don't know you tell me.')
- 00:17, 15 Dec 2004 Tkinias deleted Neon tetra (redirect with no nontrivial history)
- 00:17, 15 Dec 2004 Cyrius deleted Talk:List of words censored at the Sports Interactive Messageboards (content was: 'ehit does exactly what it says on the tin tbhtbh this is a very important pagethis is an important resource for thousands of users at the Sports...')
- 23:52, 14 Dec 2004 Duncharris restored "Steve_Davis_(Comedian)"
- 23:51, 14 Dec 2004 Taxman deleted Wikipedia:Peer review - Archive 1 (no longer needed. content was: '#REDIRECT [[Wikipedia:Peer review/Archive 1]]')
- 23:50, 14 Dec 2004 Taxman deleted Wikipedia:Peer review/Archive 1 (delete for page move. content was: '#REDIRECT [[Wikipedia:Peer review - Archive 1]]')
- 23:48, 14 Dec 2004 Duncharris deleted Steve Davis (Comedian) (content before blanking was: '{{vfd}}Steve Davis is an [[Australia]]n comedian who began his career in 1979.He started as as street performer in [[Melbourne]] and worked his way...')
- 23:44, 14 Dec 2004 Adam Bishop deleted Japanese encephalitis (content was: '[[Image:Example.jpg]]')
- 23:42, 14 Dec 2004 Duncharris deleted Charlie Groth (content was: '#REDIRECT [[User:Csublime]]')
- 23:41, 14 Dec 2004 Adam Bishop deleted Japanese encephalitis (junk)
- 23:40, 14 Dec 2004 Niteowlneils deleted Nashua (horse) (content was: '{{del}}history and photos of Nashua the race horse')
- 23:40, 14 Dec 2004 Niteowlneils deleted Talk:Tarun Chitra (content was: '{{del}}As you can tell, the people at Wikipedia have no sense of humor to make me delete this awesome page...')
- 23:40, 14 Dec 2004 Niteowlneils deleted Tarun Chitra (content was: '{{del}}')
- 23:39, 14 Dec 2004 Ahoerstemeier deleted Jacques Plante Trophy (content was: 'Lick my balls my Gassen.')
- 23:38, 14 Dec 2004 Niteowlneils deleted Egyptian iconography (content was: 'keirstin{{delete}}')
- 23:36, 14 Dec 2004 Niteowlneils deleted Alan V. Oppenheim (content was: '== Alan V. Oppenheim =={{delete}}')
- 23:36, 14 Dec 2004 Niteowlneils deleted Benefit (content was: '{{delete}}hi')
- 23:36, 14 Dec 2004 Niteowlneils deleted Ashley Bucknam (content was: 'Ashley Bucknam is amazing. She goes to school and will be doing theater the rest of her life!! WOW!{{delete}}')
- 23:36, 14 Dec 2004 Infrogmation deleted Image:Sean.jpg (no actual image, presumed old upload glitch)
- 23:32, 14 Dec 2004 Ahoerstemeier deleted Travis Kilgore (content was: 'Travis Kilgore is the coolest guy in the universe!')
- 23:31, 14 Dec 2004 Infrogmation deleted Image:Carly-patterson.jpg (WP:PUI listed and tagged for deletion for over a month +; commented out of article 15 days + )
- 23:28, 14 Dec 2004 Adam Bishop deleted Christopher Palmer (content was: '{{del}} Christopher PAlmer was born January 6, 1994 in El Paso, Texas. He is very smart. He likes ''Italic text''''Italic text''nald's A LO...')
- 23:27, 14 Dec 2004 Infrogmation deleted Image:Reflectingstream.jpg (WP:PUI listed and tagged for deletion for over a month + )
- 23:27, 14 Dec 2004 Ahoerstemeier deleted Pen15 (content was: 'penis')
- 23:27, 14 Dec 2004 Infrogmation deleted Image:Running White Deer.jpg (WP:PUI listed and tagged for deletion for over a month +)
- 23:27, 14 Dec 2004 Ahoerstemeier deleted Totalitarian Language: Orwell's Newspeak and Its Nazi and Communist Antecedents (content was: 'shadows')
- 23:26, 14 Dec 2004 Ahoerstemeier deleted Talk:Tang Dynasty art (content was: 'albert was here--[[User:207.62.88.10|207.62.88.10]] 21:59, 14 Dec 2004 (UTC)[[Media:Example.ogg]][http://www.example.com link title]== Headline text ...')
- 23:24, 14 Dec 2004 Infrogmation deleted Image:Dan and Frank Carney.jpg (delte test)
- 23:22, 14 Dec 2004 Duncharris deleted Millau Viaduct (getting ready for move; content was: '#REDIRECT [[Talk:Millau Viaduct/duplicate]]')
- 23:03, 14 Dec 2004 Ahoerstemeier deleted Logan Black (content was: 'A homosexual with no taste in music. Born in Pittsville, Wisconsin. Loves the cock.')
- 22:58, 14 Dec 2004 Rdsmith4 deleted Christopher Palmer (content was: ' Christoipher Palmer(born January 6, 1994) is the smartest child in Burnet Elementary School. (Located in El Paso Texas) His friend Jeanette So...')
- 22:57, 14 Dec 2004 Rdsmith4 deleted Cal keegan (nonsense)
- 22:55, 14 Dec 2004 Rdsmith4 deleted Semmelweis University of Medical Sciences (content was: '[http://www.sote.hu Semmelweis University]')
- 22:53, 14 Dec 2004 Rdsmith4 deleted Cal keegan (nonsense)
- 22:47, 14 Dec 2004 Adam Bishop deleted Luke Ruchti (content was: 'A senior at Pittsville High School in Pittsville, Wisconsin. He doesn't have a driver's license, and he smells bad because he never showers. His hair ...')
- 22:37, 14 Dec 2004 Taxman deleted Soft updates (was a redirect. Delete to prepare for a page move)
- 22:36, 14 Dec 2004 Jayjg deleted Hirst (content was: '{{nonsense}}'''Adam Hirst is a'''very lame man to be very wary of. He is thirty two years old, and a paedophile. He regularly parades around his ho...')
- 22:35, 14 Dec 2004 Jayjg deleted Sinister seven (content was: 'His name is Dan Schonfeld. Study, Dan, study. Make sure your dad doesn't get you!{{delete}}')
- 22:34, 14 Dec 2004 Jayjg deleted Patrick Doherty (content was: '{{del}}Patrick Doherty is the almighty deity of the proud peoples of Spotswood High School. He requires daily virgin sacrifices, and deserves the all...')
- 22:33, 14 Dec 2004 Adam Bishop deleted James bentley (content was: 'James Bentley is a cult legend based in Long Eaton, Nottingham. He has many exploits all of which cause mayhem. He also made history for being the ver...')
- 22:32, 14 Dec 2004 Adam Bishop deleted Ida Beate Areklett (junk)
- 22:32, 14 Dec 2004 Adam Bishop deleted Endre Sundal Grøneng (content was: '{{del}}Endre Sundal Grøneng (1980-) is known to be the person that has had anal sex with most people with the same sex. He has allready had all the m...')
- 22:22, 14 Dec 2004 SimonP deleted Chicksaw (listed on VfD, votes 6-2 in favour of deletion)
- 22:22, 14 Dec 2004 Niteowlneils deleted Sean is not cool (content was: '{{del}}Sean is definately not cool. Sean is a loser. Even Dan and Evan are gods of super awesome coolness compared to Sean. Sean is the biggest loser...')
- 22:22, 14 Dec 2004 Niteowlneils deleted User:82.92.184.196 (content was: '{{deletebecause|This IP is no longer mine/prevent confusion for possible new anon}}This IP is [[User:JRM|mine]]. It may appear when I'm not logged i...')
- 22:19, 14 Dec 2004 Adam Bishop deleted Talk:Wake up Susan (content was: 'Is good')
- 22:19, 14 Dec 2004 Adam Bishop deleted Wake up Susan (content was: 'Goat Sex{{delete}}')
- 22:19, 14 Dec 2004 Niteowlneils deleted Design and Architecture Senior High School (content was: '{{del}}DASH SUCKS')
- 22:18, 14 Dec 2004 DropDeadGorgias deleted Wikipedia:Requests for comment/jguk (delete according to policy on request of user)
- 22:16, 14 Dec 2004 Zanimum deleted Image:Chalcopyrite.owl.arp.750pix.jpg (Mislabeled exact dupe of Image:Chalcopyrite.owl.arp.600pix.jpg)
- 22:16, 14 Dec 2004 Quadell deleted Quadell/Request for assistance (created in error)
- 22:13, 14 Dec 2004 Zanimum deleted Image:Horsehairflyswatter-s.jpg (thumb. obselete.)
- 22:12, 14 Dec 2004 Zanimum deleted Image:Federação de Futebol da Guiné-Bissau logo.gif (cleaner version of image was uploaded)
- 22:12, 14 Dec 2004 Zanimum deleted Image:TheBestOfEmersonLakeAndPalmer small.jpg (thumb of Image:TheBestOfEmersonLakeAndPalmer.jpg)
- 22:11, 14 Dec 2004 Zanimum deleted Image:Sucha Beskidzka CoA.png (Moved to commons as Image:Sucha Beskidzka herb.png)
- 22:11, 14 Dec 2004 Zanimum deleted Image:Th-C80-29R.jpg ("nothing here to see")
- 22:10, 14 Dec 2004 Zanimum deleted Image:Thanasimus formicarius thumbnail.jpg (thumb of Image:Thanasimus formicarius.jpg)
- 22:10, 14 Dec 2004 ClockworkSoul deleted Tejal Naik
- 22:09, 14 Dec 2004 Jayjg deleted Choke Kelly (content was: 'Kelly would wish Joon did that. Kelly hates Joon and she wishes he was gay. Also look at Wishful-Homosexuality.')
- 22:06, 14 Dec 2004 Niteowlneils deleted Category:Wars of Russia (content was: '{{CFD}}{{delete}}{{merge}} [[:Category:Russian wars]]')
- 22:06, 14 Dec 2004 Zanimum deleted Image:Thastevens (exactly the same file as the image in use, down to the last byte of size.)
- 22:04, 14 Dec 2004 Ahoerstemeier deleted AIS (operating system) (content was: 'kjlhkjhlkjhlkjhk')
- 22:04, 14 Dec 2004 Ahoerstemeier deleted Tion Medon (content was: 'jkjkjkjkjkjkj')
- 22:04, 14 Dec 2004 Niteowlneils deleted LarrysText (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Larry Sanger/old-LarrysText]]')
- 22:04, 14 Dec 2004 Zanimum deleted Ishtar the Country ("This country was made by two high school sophomores of east mecklenburg high school and was started in their freshman year. one of those is the author of this article.")
- 22:03, 14 Dec 2004 Davidcannon restored "Ernest_Manning"
- 22:02, 14 Dec 2004 Infrogmation deleted Whoreson: The Story of a Ghetto Pimp (WP:CP listed since 4 Dec; content was: '{{copyvio|url=http://www.amazon.com/exec/obidos/ASIN/0870679945}}')
- 22:02, 14 Dec 2004 Niteowlneils deleted Steffen Sunde (content was: '{{del}}Famous Gay, Nuff said.')
- 22:01, 14 Dec 2004 Zanimum deleted Image talk:African trade language.png (content was: '{{deletebecause|It is the result of a typo, and should not be here. I moved the page to its correct name.}}')
- 22:01, 14 Dec 2004 Niteowlneils deleted RjLesch/ToDo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:RjLesch/old-ToDo]]')
- 22:00, 14 Dec 2004 Niteowlneils deleted Pirates With Attitude (content was: '{{delete}}hjhhjhjhh')
- 22:00, 14 Dec 2004 Davidcannon deleted Ernest Manning (I need to merge the edit histories of this and a redirect page, to repair a botched cut-and-paste job.)
- 22:00, 14 Dec 2004 Zanimum deleted Image:Cz1000b.jpg ("This is just a copy of CZ-1000 jpg which I uploaded when the image server was wonkey")
- 22:00, 14 Dec 2004 Zanimum deleted Image:Coxs bazar small.jpg (this is a thumb of Image:Coxs bazar.jpg)
- 22:00, 14 Dec 2004 Niteowlneils deleted Grimm Ripper/catch22 (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Grimm_Ripper/catch22]]')
- 22:00, 14 Dec 2004 Niteowlneils deleted F. Lee Horn/Resume (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:F. Lee Horn/old-Resume]]')
- 21:59, 14 Dec 2004 Niteowlneils deleted F. Lee Horn/Mail (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:F. Lee Horn/old-Mail]]')
- 21:59, 14 Dec 2004 Infrogmation deleted Tarbela (WP:CP listed since 4 Dec; content was: '{{copyvio|url=http://www.paknet.com.pk/tourism/lakes.php}}[[User:Stellertony|Stellertony]] 09:35, Nov 25, 2004 (UTC)')
- 21:58, 14 Dec 2004 Infrogmation deleted Jack Vaughn (WP:CP listed since 4 Dec; content was: '{{copyvio|url=http://peacecorpsonline.org/messages/messages/2629/4200.html}}')
- 21:58, 14 Dec 2004 Niteowlneils deleted Anatoly Vorobey/Worked on (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Anatoly Vorobey/old-Worked on]]')
- 21:58, 14 Dec 2004 Niteowlneils deleted Anders Torlind/Articles (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Anders Torlind/old-Articles]]')
- 21:58, 14 Dec 2004 Niteowlneils deleted Andre Engels/Pages (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Andre Engels/old-Pages]]')
- 21:58, 14 Dec 2004 Niteowlneils deleted Asa Winstanley/Todo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Asa Winstanley/old-Todo]]')
- 21:57, 14 Dec 2004 Zanimum deleted Image:ThaliaSiamesecatWalkingSM.jpg (thumb of Image:Thalia Kaji 4 ammend compressed.jpgthumb of Image:Thalia Kaji 4 ammend compressed.jpg)
- 21:57, 14 Dec 2004 Niteowlneils deleted Alan Millar/Test (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Alan Millar/old-Test]]')
- 21:57, 14 Dec 2004 Niteowlneils deleted Alan Millar/Picture contributions (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Alan Millar/old-Picture contributions]]')
- 21:57, 14 Dec 2004 Niteowlneils deleted Alan Millar/Contributions (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Alan Millar/oldpage-Contributions]]')
- 21:56, 14 Dec 2004 Infrogmation deleted Parameswara (WP:CP since 4 Dec; content was: '{{copyvio|url=http://www.virtualmalaysia.com/Malaysia/States/index.cfm?state=Melaka}} - [[User:Evil saltine|Evil saltine]] 01:38, 4 Dec 2004 (UTC)')
- 21:55, 14 Dec 2004 DavidWBrooks deleted Armaic alphabet
- 21:55, 14 Dec 2004 Zanimum deleted Image:The11Kingdoms.bmp (better version at Image:The11Kingdoms.gif)
- 21:54, 14 Dec 2004 Zanimum deleted Image:Test Card J 0001
- 21:53, 14 Dec 2004 Zanimum deleted Image:Image:Male and female pheasant.jpg (dead image)
- 21:53, 14 Dec 2004 Zanimum deleted Image:Image:Male and female pheasant.jpg (dead image)
- 21:53, 14 Dec 2004 Infrogmation deleted Evangelical Lutheran Free Church of Norway (WPCP since 4 Dec; content was: '{{copyvio|url=http://frikirken.no/Frikirken/English.php}}[[User:Knowledge Seeker|[[User:Knowledge Seeker|Knowledge Seeker দ]] ([[User talk:Know...')
- 21:53, 14 Dec 2004 Zanimum deleted Image:Metcard-handyhints.png (nothing links here, bad image, csd)
- 21:52, 14 Dec 2004 Zanimum deleted Image:Texasstateseal.jpg (crappy version of Image:Texasstateseal.png)
- 21:51, 14 Dec 2004 Infrogmation deleted Sinornithosaurus (WP:CP listed since 4 Deccontent was: '{{copyvio|url=http://dinosauricon.com/genera/sinornithosaurus.html}}')
- 21:51, 14 Dec 2004 DavidWBrooks deleted Ahmad chehab (content was: 'a faget')
- 21:51, 14 Dec 2004 DavidWBrooks deleted Pirate's Lodge
- 21:51, 14 Dec 2004 Zanimum deleted Image:Test.php.gif (unlinked, badly made image)
- 21:51, 14 Dec 2004 Infrogmation deleted The Palace (WP:CP listed since 4 Deccontent was: '{{copyvio|url=http://www.palacechat.us/history.php}}')
- 21:51, 14 Dec 2004 Infrogmation deleted Wagner James Au (WP:CP listed since 4 Dec)
- 21:50, 14 Dec 2004 Zanimum deleted Image:LocationMorocco.png (Moved to commons: under same name. According to Vardion it is public domain image)
- 21:49, 14 Dec 2004 Ahoerstemeier deleted Microsoft WebDev (content was: 'hi')
- 21:48, 14 Dec 2004 Davidcannon deleted Dory Chamoun (This is not even a sub-stub. It has absolutely no text at all.)
- 21:48, 14 Dec 2004 Infrogmation deleted Lady Francis Brookes (WP:CP liisted since 4 Dec content was: '{{copyvio|url=http://www.sxolsout.org.uk/}}[[User:Estel|Estel]] 12:09, Dec 4, 2004 (UTC)')
- 21:48, 14 Dec 2004 Zanimum deleted Image:LocationSyria.png (Moved to commons: under same name. According to Vardion it is public domain image)
- 21:47, 14 Dec 2004 Zanimum deleted Image:Sine waves.jpg (This image is now obsoleted by three others)
- 21:46, 14 Dec 2004 Infrogmation deleted Image:Karunanidhi.jpg (Listed on WP:CP since 4 Dec;)
- 21:46, 14 Dec 2004 DavidWBrooks deleted Messier, Aubrey
- 21:46, 14 Dec 2004 DavidWBrooks deleted Ruby Laffoon (content was: 'He was a Democrat, who had suffered an accident as a child that left him handicapped. His administration saw passage of a sales tax in the state of Ke...')
- 21:45, 14 Dec 2004 Infrogmation deleted Image:Jaya.jpg (Listed on WP:CP since 4 Dec;)
- 21:45, 14 Dec 2004 DavidWBrooks deleted Pirate's Lodge (tedious attempt at a joke ... )
- 21:43, 14 Dec 2004 Infrogmation deleted Image:MG-Ramachandran.jpg (Listed on WP:CP since 4 Dec;)
- 21:42, 14 Dec 2004 Infrogmation deleted Image:Meenakshi tample.jpg (Listed on WP:CP since 4 Dec;)
- 21:41, 14 Dec 2004 Infrogmation deleted Image:Ashoka.jpg (Listed on WP:CP since 4 Dec;)
- 21:40, 14 Dec 2004 Infrogmation deleted Image:Chanakya.jpg (Listed on WP:CP since 4 Dec;)
- 21:40, 14 Dec 2004 DavidWBrooks deleted Jon Lote
- 21:40, 14 Dec 2004 DavidWBrooks deleted Yo momma (content was: 'Luke's mom has the perfect sandbox to play in.')
- 21:38, 14 Dec 2004 Infrogmation deleted Toshi (Listed on WP:CP since 4 Dec;content was: '{{copyvio|url=http://www.cryinginred.com/toshi.htm}}')
- 21:38, 14 Dec 2004 Infrogmation deleted Caeté (Listed on WP:CP since 4 Dec;content was: '{{copyvio|url=http://www.desvendar.com/cidades/caete/default.asp}}')
- 21:38, 14 Dec 2004 Infrogmation deleted Veer- Zaara (Listed on WP:CP since 4 Dec;content was: '{{Copyvio|url=http://www.rediff.com/movies/2004/nov/12veer.htm}}[[User:High on a tree|High on a tree]] 10:45, 4 Dec 2004 (UTC)')
- 21:38, 14 Dec 2004 Infrogmation deleted 4 Wheel Thunder (Listed on WP:CP since 4 Dec;content was: '{{copyvio|url=http://www.planetdreamcast.com/games/reviews/4wheelthunder/}}[[User:SWAdair|SWAdair]] | [[User talk:SWAdair|Talk ]] 09:40, 4 Dec 2004 (...')
- 21:38, 14 Dec 2004 Infrogmation deleted Image:Ellen Terry.jpg (Listed on WP:CP since 4 Dec;)
- 21:37, 14 Dec 2004 Infrogmation deleted SS-N-18 (Listed on WP:CP since 4 Dec;content was: '{{copyvio|url=http://www.fas.org/nuke/guide/russia/icbm/r-36m.htm}}')
- 21:37, 14 Dec 2004 DavidWBrooks deleted Bribing of Belknap (content was: 'In 1876, the word got out that War Secretary W. W. Belknap had been accepting annual payoffs from traders at Indian posts and that, while at first the...')
- 21:36, 14 Dec 2004 Infrogmation deleted Asghar Ali Engineer (Listed on WP:CP since 4 Dec; content was: '{{copyvio|url='http://www.dawoodi-bohras.com/aboutus/asghar.htm'}}')
- 21:34, 14 Dec 2004 DavidWBrooks deleted Hydaspes (content was: '{{delete}}its little place where everyone is so happy if you want to go call jet blue and yu'll be in a kool place with a k')
- 21:34, 14 Dec 2004 DavidWBrooks deleted Louis Rossel (content was: 'Louis-Nathaniel Rossel:Delegate of War during the Paris Commune.')
- 21:33, 14 Dec 2004 DavidWBrooks deleted Yo momma (content was: 'Kayvan's mom and the shuttle bus to her house.')
- 21:33, 14 Dec 2004 SimonP deleted Steam power during the Industrial Revolution (content was: '[[James Watt]][[steam engine]][[Thomas Newcomen]]{{stub}}')
- 21:32, 14 Dec 2004 Ahoerstemeier deleted Karaj River (content was: 'picture')
- 21:31, 14 Dec 2004 Ahoerstemeier deleted Yo momma (content was: 'Kayvan's Mom')
- 21:31, 14 Dec 2004 Quadell deleted Image:Knot-figure8-16.png (by request of uploader)
- 21:30, 14 Dec 2004 SimonP deleted Boa Kwon (content was: 'Boa Kwon is an incredibly attractive Korean female vocalist.')
- 21:29, 14 Dec 2004 Ahoerstemeier deleted Kingdom Heart (content was: 'ssssdcd')
- 21:29, 14 Dec 2004 Zanimum deleted 1941 in art (content was: '{{delete}}........032030000...0.000.0.00.0.00.0.00.0.0.0.0')
- 21:28, 14 Dec 2004 SimonP deleted Pleistocene Horned Gopher (content was: 'Pleistocene Horned Gopher —— Go to [[Ecological selection]]')
- 21:27, 14 Dec 2004 Zanimum deleted Hornlo/Test03 (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Hornlo/old-Test03]]')
- 21:27, 14 Dec 2004 Zanimum deleted 2101 AD (content was: 'In 2101 AD, War was beginning.BOOOOOOM!!!!!Captain: What happen !? Mechanic: Somebody set us up the bomb! Mechanic: We get signal. Captain: Main s...')
- 21:27, 14 Dec 2004 Ahoerstemeier deleted Evan gewirtz (content was: 'evan gewirtz is a flaggelum')
- 21:24, 14 Dec 2004 Zanimum deleted Hornlo/Test (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Hornlo/old-Test]]')
- 21:23, 14 Dec 2004 Zanimum deleted Hornlo/CharTalk (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Hornlo/old-CharTalk]]')
- 21:23, 14 Dec 2004 Zanimum deleted Hornlo/Test02 (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Hornlo/old-Test02]]')
- 21:23, 14 Dec 2004 Zanimum deleted Hornlo/Hold (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Hornlo/old-Hold]]')
- 21:23, 14 Dec 2004 Rfl deleted Spanish Influenza (R for alternative capitalisation of alternative name with no links - content was: '#REDIRECT [[Spanish flu]]')
- 21:22, 14 Dec 2004 Zanimum deleted Ed Poor/Feminism (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Ed_Poor/Feminism]]')
- 21:21, 14 Dec 2004 Mirv deleted Yo mama (content was: 'yo mama is slang for your mother')
- 21:21, 14 Dec 2004 Zanimum deleted EvelynToseland/ToDo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:EvelynToseland/old-ToDo]]')
- 21:20, 14 Dec 2004 Zanimum deleted DrBob/Major (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:DrBob/Major]]')
- 21:20, 14 Dec 2004 Infrogmation deleted Image:Ac.barneyfrank.jpg (Listed on WP:CP since August. Not used in article since we have a PD image of him.)
- 21:20, 14 Dec 2004 Zanimum deleted DrBob/Minor (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:DrBob/Minor]]')
- 21:20, 14 Dec 2004 Infrogmation deleted Image:Jeff Buckley mirror.jpg (Listed on WP:CP since August. Not used in article)
- 21:20, 14 Dec 2004 Zanimum deleted DrBob/Todo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:DrBob/Todo]]')
- 21:20, 14 Dec 2004 Zanimum deleted DrBob/Figures (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:DrBob/Figures]]')
- 21:19, 14 Dec 2004 Zanimum deleted Janet Davis/To do (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Janet Davis/old-To do]]')
- 21:18, 14 Dec 2004 Zanimum deleted Jan Hidders/todo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Jan Hidders/old-todo]]')
- 21:18, 14 Dec 2004 Zanimum deleted Stephen Gilbert/Contributions (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Stephen Gilbert/old-Contributions]]')
- 21:18, 14 Dec 2004 Zanimum deleted RoseParks/Disability Etiquette (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:RoseParks/old-Disability Etiquette]]')
- 21:17, 14 Dec 2004 SimonP deleted Word form (content was: 'my love is waiting for me over the bridge to his heart')
- 21:16, 14 Dec 2004 Zanimum deleted Mincus/ToDo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Mincus/old-ToDo]]')
- 21:16, 14 Dec 2004 Zanimum deleted Mike Dill/My Ideas on Societal Change and Terrorism (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Mike Dill/old-My Ideas on Societal Change and Terrorism]]')
- 21:16, 14 Dec 2004 Zanimum deleted Jimbo Wales/Statement of principles (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Jimbo_Wales/Statement_of_principles]]')
- 21:15, 14 Dec 2004 Zanimum deleted Mike Dill/to do list (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Mike Dill/old-to do list]]')
- 21:14, 14 Dec 2004 Zanimum deleted Jzcool/ThingsIWant (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Jzcool/old-ThingsIWant]]')
- 21:14, 14 Dec 2004 Zanimum deleted Jmlynch/ToDo (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Jmlynch/old-ToDo]]')
- 21:14, 14 Dec 2004 SimonP deleted Blast furnace picture (content was: '[[Image:Alto_Forno.jpg|right|Wikipedia Encyclopedia]]')
- 21:13, 14 Dec 2004 Zanimum deleted Jzcool/ToDoList (content was: '{{db|Main namespace redirects to User: cleanup}}#REDIRECT [[User:Jzcool/old-ToDoList]]')
- 21:12, 14 Dec 2004 Zanimum deleted Image:Test picture 2.bmp (abstract Windows Paint pic, b&w, no links)
- 21:12, 14 Dec 2004 Zanimum deleted Image:Test picture 3.bmp (nothing showed up)
- 21:11, 14 Dec 2004 Zanimum deleted Image:LocationJordan.png (Moved to commons: under same name. According to Vardion it is public domain image)
- 21:11, 14 Dec 2004 Zanimum deleted Image:LocationMalaysia.png (Moved to commons: under same name. According to Vardion it is public domain image)
- 21:10, 14 Dec 2004 Zanimum deleted Image:LocationIran.png (Moved to commons: under same name. According to Vardion it is public domain image)
- 21:10, 14 Dec 2004 Zanimum deleted Image:Texas state capitol.jpg (thumb of Image:Texas state capitol 1.jpg)
- 21:09, 14 Dec 2004 Zanimum deleted Image:LocationEastTimor.png (oved to commons: under same name. According to Vardion it is public domain image)
- 21:09, 14 Dec 2004 Zanimum deleted Image:LocationIndonesia.png (oved to commons: under same name. According to Vardion it is public domain image)
- 21:08, 14 Dec 2004 Zanimum deleted Image:LocationVietnam.png (oved to commons: under same name. According to Vardion it is public domain image)
- 21:07, 14 Dec 2004 Zanimum deleted Image:LocationSingapore.png (oved to commons: under same name. According to Vardion it is public domain image)
- 21:07, 14 Dec 2004 Zanimum deleted Image:LocationPhilippines.png (oved to commons: under same name. According to Vardion it is public domain image)
- 21:06, 14 Dec 2004 Zanimum deleted Tejasewah Gorti (Google reveals no such person. content was: 'Tejawaseh Gorti is a professor of mathematics at the [[University of Washington]]. Born in 1965, he later moved to [[Washington]], where he received h...')
- 21:01, 14 Dec 2004 Academic Challenger deleted Alex Huff (content was: '{{delete}}Alex Huff is a computer scientist at [[Moo University]].He is GOD>')
- 20:56, 14 Dec 2004 Academic Challenger deleted Rudy Dussault (content was: 'the man.')
- 20:55, 14 Dec 2004 Ahoerstemeier deleted Que Son Valley (content was: 'que son valley')
- 20:54, 14 Dec 2004 Academic Challenger deleted Claude de Jouffroy d'Abbans (content was: 'dghfghfghn')
- 20:50, 14 Dec 2004 MacGyverMagic deleted Ascorbat (content was: '{{Delete|This redirect was created by an error by me (as 62.66.187.247) - it was meant to be placed on the Danish Wikipedia}} (This redirect was creat...')
- 20:49, 14 Dec 2004 Marshman deleted "Image:Palau pitcher plant reduced.jpg" (This reduced version is no longer needed with new image format)
- 20:46, 14 Dec 2004 DavidWBrooks deleted J. Stephen O'Laughlin
- 20:45, 14 Dec 2004 DavidWBrooks deleted Cat sun (content was: 'LIEK OmGZ LOLZ Cat iz t3h hotTtTt !!111 d00d !!!11111oneoneoneonef0sh1zzEy!11')
- 20:43, 14 Dec 2004 Quadell deleted Image:Keyboard small.jpg (Scaled-down Duplicate Image)
- 20:42, 14 Dec 2004 Infrogmation deleted Image talk:Vagina Clitoris.jpg (talk of deleted unfree image page)
- 20:42, 14 Dec 2004 Infrogmation deleted Image:Vagina Clitoris.jpg (Listed on WP:PUI and tagged for deltion since 1 October )
- 20:40, 14 Dec 2004 DavidWBrooks deleted Taryn Sobey (content was: 'Taryn is stupid! No need to talk about HER! Let's talk about Taylor! You already know I love her, and if you don't, I will tell you now. She is my gir...')
- 20:39, 14 Dec 2004 Quadell deleted Image:Keyboard.arp.300pix.jpg (scaled-down duplicate version of image)
- 20:39, 14 Dec 2004 DavidWBrooks deleted Jan-Michael Cruz (content was: 'Jan-Michael Cruz is the best looking man to ever walk the face of the earth.')
- 20:39, 14 Dec 2004 DavidWBrooks deleted Rudy Dussault (content was: 'Rudy Dussault won last year's handsomest man award.')
- 20:36, 14 Dec 2004 DavidWBrooks deleted Eighteen Visions (content was: 'rock/hardcore band from Orange county California.')
- 20:31, 14 Dec 2004 Infrogmation deleted Image:Selectric.jpg ( listed on WP:PUI and tagged for deletion since October.)
- 20:31, 14 Dec 2004 Quadell deleted Image:KXJBthumb.jpeg (Scaled-down duplicate image)
- 20:29, 14 Dec 2004 Ahoerstemeier deleted Alistair Cockburn (content was: 'liyup9yuh<math>Insert formula here</math>'''Bold text'''')
- 20:29, 14 Dec 2004 Ahoerstemeier deleted Create an Article (content was: ' Create an ArticleTo create an article, all you need to do is search for a title that you want to create an article under, and click 'Go.' Then,...')
- 20:26, 14 Dec 2004 Ahoerstemeier deleted Bile duct cancer (content was: '[[Image:Example.jpg]][http://www.example.com link title]== Headline text ==== Headline text ==[[Link title]][http://www.example.com link title]'''Bo...')
- 20:24, 14 Dec 2004 Quadell deleted Image:KVLYFromBaseSmall.jpeg (Scaled-down duplicate image)
- 20:22, 14 Dec 2004 Ahoerstemeier deleted Heinz Thorvald (content before blanking was: 'This is the most awesome dude in the planet of earth, he shot Ron Perlman in the head while he was jumping over a hole. I mean, that is the coolest cr...')
- 20:21, 14 Dec 2004 Quadell deleted Image:KVLYDistance.jpeg (duplicate image)
- 20:18, 14 Dec 2004 Oberiko deleted Becky! Internet Mail (Advertisement)
- 20:17, 14 Dec 2004 Ahoerstemeier deleted Thought Bomb (content was: 'hmmm')
- 20:16, 14 Dec 2004 Infrogmation deleted Image:Beakman.jpg ( listed on WP:PUI and tagged for deletion since October. Not used in articles; we already have good free image of him.)
- 20:16, 14 Dec 2004 Ahoerstemeier deleted Chimalpopoca (content was: 'I love geography so much, it is a wonderful class')
- 20:15, 14 Dec 2004 Ahoerstemeier deleted David Joseph Carpenter (content was: '000')
- 20:15, 14 Dec 2004 Jrdioko deleted "Vlastimir Djordjevic" (content was: '{{delete}}Bog cuva srbe,jebem vas u usta albansku,poserem vam se na grob,KOLIKO VAS VOLIM KLAO BIH VAS MRTVE ZUBIMA')
- 20:14, 14 Dec 2004 Quadell deleted Image:Kaprun.train.500pix.jpg (Scaled-down duplicate image)
- 20:14, 14 Dec 2004 Quadell deleted "Image:Knights.weta.300pix.jpg" (Scaled-down duplicate image )
- 20:14, 14 Dec 2004 Quadell deleted Image:Klm.fokker50.ph-kvb.300pix.jpg (Scaled-down duplicate image)
- 20:14, 14 Dec 2004 Quadell deleted Image:Kemmerer, Wyoming-300px.JPG (Scaled-down duplicate image)
- 20:14, 14 Dec 2004 Quadell deleted Image:Kea.bristol.250pix.jpg (Scaled-down duplicate image )
- 20:14, 14 Dec 2004 Quadell deleted Image:Kepler Cascades in Yellowstone-300px.JPG (Scaled-down duplicate image)
- 20:13, 14 Dec 2004 Quadell deleted Image:Ka50.heli.300pix.jpg (Scaled-down duplicate image)
- 20:13, 14 Dec 2004 Quadell deleted Image:Kaprun.train.250pix.jpg (Scaled-down duplicate image)
- 20:09, 14 Dec 2004 Infrogmation deleted Image:Fontevrault abbey.JPG ( listed on WP:PUI and tagged for deletion since October.)
- 20:09, 14 Dec 2004 Infrogmation deleted Image:Osborne house.JPG ( listed on WP:PUI and tagged for deletion since October.)
- 20:08, 14 Dec 2004 Malcolm Farmer deleted List of SAT Words starting with N (content was: 'words that begin with N.')
- 20:05, 14 Dec 2004 Ahoerstemeier deleted Pedra Furada (content was spanish nanostub: 'Freguesia localizada a 9 Km da sede do concelho Barcelos')
- 20:04, 14 Dec 2004 Ahoerstemeier deleted Castle wars (content was: 'Castle Wars is really gnarly and cool and surfer13 owns castle wars')
- 20:01, 14 Dec 2004 Ahoerstemeier deleted "Jh bruns" (content was: 'School for mentally handicapped in Winnipeg, Sudan. This place is lovely!')
- 19:55, 14 Dec 2004 Infrogmation deleted Image:Elnorvas.JPG ( listed on WP:PUI and tagged for deletion since October.)
- 19:53, 14 Dec 2004 Infrogmation deleted Image:Maryvase.JPG ( listed on WP:PUI and tagged for deletion since October.)
- 19:52, 14 Dec 2004 Infrogmation deleted Image:Lincath1.jpg ( listed on WP:PUI and tagged for deletion since October.)
- 19:50, 14 Dec 2004 Infrogmation deleted Image:Flemtomb.JPG ( listed on WP:PUI and tagged for deletion since October.)
- 19:49, 14 Dec 2004 DavidWBrooks deleted 2101 AD (content was: 'In 2101 AD, War was beginning.BOOOOOOM!!!!!Mechanic: Somebody set us up the bomb!Mechanic: We get signal.Captain: Main screen turn on.Captain: ...')
- 19:46, 14 Dec 2004 Deb deleted Grant Baxter (content before blanking was: 'Grant Baxter is gay. Plain and Simple. Not to mention dumb!AND UGLY AS SIN!!!!!!!!!!!! end of story')
- 19:46, 14 Dec 2004 Deb deleted "Maxwell Adam Travis Laverack" (content was: '{{delete}}'''MAX SMELLS OF DEAD THINGS!'''')
- 19:45, 14 Dec 2004 Ahoerstemeier deleted Arcadis (content was: 'arcadis used to be calles Heidemij')
- 19:44, 14 Dec 2004 Infrogmation deleted Image:Salscath.JPG (Listed on WP:PUI and tagged for deletion since October)
- 19:43, 14 Dec 2004 Deb deleted Turbelleria (content was: 'ouyghvoaufbvaeufevhqalerkvuhalerfv laefva;kfvjhsdflaf')
- 19:41, 14 Dec 2004 Ahoerstemeier deleted Boiling to death (content was: 'boiling to death')
- 19:37, 14 Dec 2004 Infrogmation deleted Image:Bathabby.JPG (Listed on WP:PUI and tagged for deletion since October)
- 19:37, 14 Dec 2004 Ahoerstemeier deleted Picture Pages (content was: 'traciescott')
- 19:36, 14 Dec 2004 Infrogmation deleted Image:Cantomb.JPG (Listed on WP:PUI and tagged for deletion since October)
- 19:34, 14 Dec 2004 Infrogmation deleted "Image:Stalbns.JPG" (Listed on WP:PUI and tagged for deletion since October)
- 19:31, 14 Dec 2004 Infrogmation deleted Image:Cantcath.JPG (Listed on WP:PUI and tagged for deletion since October)
- 19:31, 14 Dec 2004 Infrogmation deleted Image:Salsintr.JPG (Listed on WP:PUI and tagged for deletion since October)
- 19:30, 14 Dec 2004 Ahoerstemeier deleted Sinister seven (content was: 'Dan is a nice guy who everyone likes and should be president of the cool club.')
- 19:30, 14 Dec 2004 Ahoerstemeier deleted Brother Paul (content was: 'The lord of the Reading Room.')
- 19:29, 14 Dec 2004 Ahoerstemeier deleted Age of Rifles (content was: 'Blah BlahBlah')
- 19:18, 14 Dec 2004 Ahoerstemeier deleted "Dysthymia" (content was: 'only morons have this problem!!!')
- 19:18, 14 Dec 2004 Infrogmation deleted Image:Holrodab.JPG (Listed on WP:PUI and tagged for deletion since October)
- 19:18, 14 Dec 2004 Infrogmation deleted Image:Hampcort.JPG (Listed on WP:PUI and tagged for deletion since October)
- 19:17, 14 Dec 2004 Infrogmation deleted Image:Holrood.JPG (Listed on WP:PUI and tagged for deletion since October)
- 19:10, 14 Dec 2004 Infrogmation deleted Thief in Chief (content was: '{{deletebecause|Little or no content}}')
- 19:09, 14 Dec 2004 Oberiko deleted Dysthymia (content was: 'pants')
- 19:08, 14 Dec 2004 Oberiko deleted Kahle v. Ashcroft (content was: 'what is up with that?')
- 19:08, 14 Dec 2004 Oberiko deleted Ashley Heisler (content was: 'She has hairAnd EyesNickname... [[Kiki]]')
- 19:07, 14 Dec 2004 Ahoerstemeier deleted "Image:Reloader.jpg" (content were editing experiments without an associated image)
- 19:03, 14 Dec 2004 Oberiko deleted "Gordo (monster)" (content was: 'Gordos are common enemies seen in basically every Kirby game. They are spiky creatures that tend to float about in one path until they hit an obstacle...')
- 19:01, 14 Dec 2004 Oberiko deleted "Cobaltite" (content was: 'I LIKE MONKEY PENIS! HOO-HAAH!')
- 18:57, 14 Dec 2004 Oberiko deleted "Femme fatale: s story of mimricy and murder when night falls" (Rubbish page)
- 18:49, 14 Dec 2004 DropDeadGorgias deleted Talk:Global climate change/Proposal (content was: '{{deletebecause|moved to [[User:Benapgar/Proposal]]}}')
- 18:48, 14 Dec 2004 DropDeadGorgias deleted Lasesr tag (content was: '{{deleteagain}}#REDIRECT [[Lasertag]]' delete re-created misspelling redirect)
- 18:47, 14 Dec 2004 DropDeadGorgias deleted Phaestos Disk (delete nonsense)
- 18:45, 14 Dec 2004 Ahoerstemeier deleted Template:Utgrser:Paddu/chess image (content was: 'Coolness![[Media:Example.ogg]][[Media:Example.ogg]][[Media:Example.ogg]][[Media:Example.ogg]][[Media:Example.ogg]][[Media:Example.ogg]][[Media:Example...')
- 18:44, 14 Dec 2004 Ahoerstemeier deleted Image talk:Multimeter.jpg (content was: '[[Link title]]<math>Insert formula here</math>[[Media:Example.ogg]][[Image:Example.jpg]]== Headline text ==''Italic text'''''Bold text'''--------...')
- 18:37, 14 Dec 2004 Zanimum deleted Christopher Biagini (content was: 'Christopher BiaginiHe is an ass. Self admitted. Ask him. cbiagini1@binghamton.edu')
- 18:35, 14 Dec 2004 Ahoerstemeier deleted Mugglenet (content was: '{{deletebecause|advert, spam}}a fan website for Harry Potter')
- 18:34, 14 Dec 2004 Ahoerstemeier deleted Thief in Chief (content was: 'see [[George W Bush]]')
- 18:32, 14 Dec 2004 Ahoerstemeier deleted War Party (content was rant: 'The War Party is another name for neo-conservative party known as the [[U.S._Republican_Party]]. They are insane warmongers who are trying to conquer ...')
- 18:32, 14 Dec 2004 Niteowlneils deleted Image:LocationAustralia.png (moved to commons under same name)
- 18:32, 14 Dec 2004 Niteowlneils deleted Image:LocationBahrain.png (moved to commons under same name)
- 18:32, 14 Dec 2004 Niteowlneils deleted "Image:LocationBrunei.png" (moved to commons under same name)
- 18:27, 14 Dec 2004 DavidWBrooks deleted Garibaldi biscuit (content was: 'A Garibaldi biscuit is a crisp, semi-sweet rectangular biscuit, usually supplied as a bar of five joined together.Often children, when mucking about...')
- 18:27, 14 Dec 2004 DavidWBrooks deleted John Charles Walker (content was: 'John is a very unique kid. He has invented many new things. Many dont know of his amazing wealth. Which he recieved for coming up with a new cancer dr...')
- 18:27, 14 Dec 2004 DavidWBrooks deleted Ransik (content was: 'Ransik is a evil mutant from the year 3000.He escapes with his daughter Nidira to the past !the year 2001.The rangers from the year 3000 follow soon ...')
- 18:27, 14 Dec 2004 Ahoerstemeier deleted War Party (content was: 'see [[U.S._Republican_Party]]')
- 18:26, 14 Dec 2004 Ahoerstemeier deleted Civil Rights Act of 1991 (content was: 'n00b')
- 18:26, 14 Dec 2004 DavidWBrooks deleted Famous narcissists
- 18:26, 14 Dec 2004 DavidWBrooks deleted Mugglenet (content was: 'Mugglenet is one of the most popular Harry Potter fansites featuring regular updates on HP news anda large section of very competent(even if I do not ...')
- 18:26, 14 Dec 2004 DavidWBrooks deleted Imperial Klans of America (content was: '== This is tyhe page that'll kiss my ass all over the world ==![[KKK, white power!]]')
- 18:25, 14 Dec 2004 DavidWBrooks deleted Talons of chaos (long copyvio)
- 18:25, 14 Dec 2004 Ahoerstemeier deleted Florencia 13 (content was nonsense)
- 18:25, 14 Dec 2004 DavidWBrooks deleted Grant Baxter
- 18:25, 14 Dec 2004 Zanimum deleted Kurt Zogorski (content was: 'yeah, that guy, who the @#$% is he anyways?')
- 18:24, 14 Dec 2004 Ahoerstemeier deleted David Wilhelm (content was: 'asdf')
- 18:24, 14 Dec 2004 Ahoerstemeier deleted Mount Serrano (content was: 'it a ferrous one man totally u no!!!!!!')
- 18:24, 14 Dec 2004 Ahoerstemeier deleted Bushite (content was rant: 'A Bushite is an unintelligent cohort of the neo-conservative agenda to take over the world. They tend to worship Bush more than they do their own God....')
- 18:24, 14 Dec 2004 Niteowlneils deleted Template:MelbSuburbBox3 (content was: '{{delete}}{| align=center cellpadding=5 cellspacing=0 id=toc|align=center colspan=3 style=background:#efefef|[[List of Melbourne suburbs|Melbourne...')
- 18:24, 14 Dec 2004 Ahoerstemeier deleted Sprankton (content was nonsense: 'n. A disease you get from chewing too much.')
- 18:23, 14 Dec 2004 Zanimum deleted Getpung (content was: 'Swedish for the scrotum of a goat. It is a kind of bag that hangs between the legs of a male goat and contains two nuts.')
- 18:23, 14 Dec 2004 Ahoerstemeier deleted War Party (content was: 'see [[Republican Party]]')
- 18:22, 14 Dec 2004 Zanimum deleted Sean rules (content was: 'Sean rules and Jake does not. don't listen to him, jake is cool and sean is not.')
- 18:22, 14 Dec 2004 Adam Bishop deleted Eurico Jorge I (content was: (nonsense) 'Eurico Jorge I was the last of the Latin Emperors. He struggled to end the barbaric decadence of his country fellows and eventually managed to hand ov...')
- 18:22, 14 Dec 2004 Matt Crypto deleted Sinister seven (content was: 'If like to study shout, DAN!')
- 18:16, 14 Dec 2004 Ike9898 deleted Diper (content was: 'not a fucking diaper !')
- 18:15, 14 Dec 2004 Matt Crypto deleted Sean rules (content was: 'Sean rules and Jake does not.')
- 18:03, 14 Dec 2004 Kaihsu deleted History of Sugar Production (content was: '#REDIRECT [[History of sugar production]]')
- 18:02, 14 Dec 2004 SimonP deleted 2008 Democratic Presidential Nomination (copy and paste of a news story)
- 18:01, 14 Dec 2004 Andrewa deleted Talk:Central Region (Talk page moved in error)
- 17:59, 14 Dec 2004 Duncharris deleted ""Small Englander"" (content was: '{{db|should not have quotation marks}}Small Englander: someone who advocates Britain pursuing a pacific and internationalist foreign policy (in the s...')
- 17:52, 14 Dec 2004 Kosebamse deleted Wiki.martin luther king, jr. (content was: 'Martin luther king')
- 17:50, 14 Dec 2004 Kosebamse deleted Big Red (chewing gum) (content was: 'Ya Ya Ya you know it fool')
- 17:48, 14 Dec 2004 Kosebamse deleted Visual SourceSafe (content was: 'nnnnnnnnnnnn')
- 17:43, 14 Dec 2004 Deb deleted Stacy Lewis (content was: 'Stacy Lewis is one rich mother f*#^#$. He is the heir of a very big line of pretigious hotels. One of those hotels is in Honduras. He plays basketball...')
- 17:42, 14 Dec 2004 DropDeadGorgias deleted All yuor base are belong to us (content was: '{{db|Wikipedia is not a spellchecker.}}')
- 17:42, 14 Dec 2004 DropDeadGorgias deleted Bombing of Kobe in World War II
- 17:41, 14 Dec 2004 DropDeadGorgias deleted Image:Bangladesh FA.gif
- 17:40, 14 Dec 2004 DropDeadGorgias deleted Missolonghi (content was: '{{deletebecause|It is a mistyping. The article was moved to Messolonghi}}')
- 17:40, 14 Dec 2004 Deb deleted "Juan Garza" (content was: ' fdfgsdfsdf')
- 17:39, 14 Dec 2004 DropDeadGorgias deleted Twiztid (delete reposted deleted material)
- 17:38, 14 Dec 2004 Deb deleted Mary Darwin (content was: 'bitch')
- 17:31, 14 Dec 2004 DropDeadGorgias deleted Category:Busta Rhymes (deleted empty category; content was: '[[Category:United States musicians]] [[Category:Rappers]]')
- 17:30, 14 Dec 2004 Ahoerstemeier deleted Grant Baxter (content was vanity, later replaced with editing experiments)
- 17:28, 14 Dec 2004 Deb deleted Devin Del Valle (content was: 'Devon always hangs about with Cassidy.he is a bit of a reporterlike Cassidy!')
- 17:27, 14 Dec 2004 Deb deleted Paul Lobb (content was: 'Not Jennifer.')
- 17:26, 14 Dec 2004 Ahoerstemeier deleted John mcrae (content were editing experiments)
- 17:25, 14 Dec 2004 Deb deleted August Verneuil (content was: 'hi you have dialed a page that is unavalible so sorry though!')
- 17:23, 14 Dec 2004 Infrogmation deleted "Economic crisis" (sandbox test)
- 17:19, 14 Dec 2004 Ahoerstemeier deleted Thomas Nehren (content was: '{{db|vanity}}'''Thomas Nehren''' was born in Seattle, Washington July 29, 1980. He is the son of Robert and Caroline Nehren. After moving to Utah at ...')
- 17:16, 14 Dec 2004 Ahoerstemeier deleted Ashwin nathan (content was vanity: 'Ashwin NathanA very cool kid who is awesome. His 45 minute cross country times make all the girls insane. He is awesome. The girls go crazy for him....')
- 17:15, 14 Dec 2004 Ahoerstemeier deleted Fluffigon (content was nonsense: '{{delete}}Fluffigon (FLUFF I GON)A fluffigon is an extremely rare disease. It can only be gotten thu contact with the sick person's blood. If you g...')
- 17:15, 14 Dec 2004 Ahoerstemeier deleted Emitter degeneration (content was: '{{delete}}hjjhj''degenerate is right''')
- 17:12, 14 Dec 2004 Ahoerstemeier deleted Emitter degeneration (content was: 'hjjhj')
- 17:12, 14 Dec 2004 Ahoerstemeier deleted Famous narcissists (content was: '==Famous Narcissists==.')
- 17:12, 14 Dec 2004 Ahoerstemeier deleted Bader Haji (content was: 'Hii! i luv u bader alhaji!!')
- 17:02, 14 Dec 2004 Ahoerstemeier deleted A guy who sucks (content was: '[[George W. Bush]].')
- 16:55, 14 Dec 2004 Ahoerstemeier deleted Bader Haji (content was: 'Hii! i luv u bader alhaji!!')
- 16:55, 14 Dec 2004 Ahoerstemeier deleted Tom Oakley (content was: 'Tom Oakley Is THE BEST.October 27th Is '''''His''''' Day vand no one elses. Not John Cleeses Or Kelly Osbornes. ITS MINE!!!!')
- 16:49, 14 Dec 2004 Ahoerstemeier deleted "Factionalism" (content was: 'uhjygulhygulgyyugyug')
- 16:49, 14 Dec 2004 Ahoerstemeier deleted "Surrender of General Toral" (content was: 'A movie in which Joseph Wheeler was in.')
- 16:49, 14 Dec 2004 Ahoerstemeier deleted Griffles (content was: 'Ha, ha, ha!')
- 16:46, 14 Dec 2004 Ahoerstemeier deleted BERTIE (content was vanity nonsense)
- 16:38, 14 Dec 2004 Ahoerstemeier deleted "Fluffigon" (content was nonsense: 'Fluffigon (FLUFF I GON)A fluffigon is an extremely rare disease. It can only be gotten thu contact with the sick person's blood. If you ...')
- 16:35, 14 Dec 2004 Ahoerstemeier deleted Morgangoogle (content was: 'Uber geek employed by VeriSign, Inc. Mountain View, CA')
- 16:34, 14 Dec 2004 Ahoerstemeier deleted A and R (content was: 'hi')
- 16:33, 14 Dec 2004 Ahoerstemeier deleted Anti-theft system (content was: ';l')
- 16:33, 14 Dec 2004 Ahoerstemeier deleted Baldur von schirach (content was: 'What were his actions like as a person what cruel things did he do?')
- 16:33, 14 Dec 2004 Ahoerstemeier deleted Tinsel (content was: 'sdjfkjsljdkl')
- 16:20, 14 Dec 2004 Ram-Man deleted User:Rambot/Capitalistroadster (content was: '#REDIRECT [[User talk:Capitalistroadster]]From [[User talk:Capitalistroadster]]* Folks, for the record my aticles are released under the {{DualLic...')
- 15:49, 14 Dec 2004 DavidWBrooks deleted Mr Biffo (content was: 'Mr Biffo is a genius.')
- 15:47, 14 Dec 2004 DavidWBrooks deleted An sich (content was: ''In itself'. Also a philosophical concept by Hegel and Kant (''Ansichsein'').')
- 15:44, 14 Dec 2004 Francs2000 deleted Greg dunn (content was: '{{delete}}Greg Dunn is currently a resident in Kingston, Ohio.He has a fetish for chemicals and likes to rape his mom.')
- 15:44, 14 Dec 2004 Francs2000 deleted Copyright Designs and Patents 1988 (content was: 'bill2150')
- 15:42, 14 Dec 2004 DavidWBrooks deleted "Computer Studies" (content was: '{{delete}}''Italic text'''''Bold text'''i'm looking for an definition for Computer Studies')
- 15:38, 14 Dec 2004 Ahoerstemeier deleted Saddar (content was: 'Sadar, means heart.')
- 15:30, 14 Dec 2004 Ahoerstemeier deleted Ford of Jacob's Daughters (content was: 'ÍóÝýÈÁÉÖÂêsalaiden was a battle leader in palistian and was from a kardish family he stded in syria demuscuse in nur al dinó')
- 15:27, 14 Dec 2004 DavidWBrooks deleted Kaygon
- 15:26, 14 Dec 2004 DavidWBrooks deleted Wyatt Adams (content was: 'Wyatt Adams lives in Frankfort, Ohio and goes to Adena High School.He likes men, and has a particular interest in little boys.')
- 15:25, 14 Dec 2004 DavidWBrooks deleted Abide with me (complete lyrics )
- 15:25, 14 Dec 2004 Ahoerstemeier deleted American Wirehair (content was: 'hello')
- 15:25, 14 Dec 2004 Ahoerstemeier deleted Azn Chris Lee (content was: 'Don't have a tea party.')
- 15:21, 14 Dec 2004 Ahoerstemeier deleted New Super Mario Bros. (content was: 'This is a BRAND NEW Super Mario Bros. game for the DS.')
- 15:20, 14 Dec 2004 Ahoerstemeier deleted Azn Chris Lee (content was: 'Don't have a tea party.')
- 15:18, 14 Dec 2004 Rmhermen deleted James McQuaid (content was: '{{delete}}James McQuaid is a nerdy Kid at Benet Academy who likes to taunt other people because they are not as smart as him. He has yet to realize t...')
- 15:17, 14 Dec 2004 Ahoerstemeier deleted Security testing (content was: 'rytryrey')
- 15:17, 14 Dec 2004 Ahoerstemeier deleted Seka Aleksic (content was: 'Seka Alesić')
- 15:16, 14 Dec 2004 Ahoerstemeier deleted Gay Law (content was: 'law is so gay')
- 15:14, 14 Dec 2004 Rmhermen deleted Greg (content was: '{{delete}}Don't have a tea party.')
- 15:13, 14 Dec 2004 Theresa knott deleted Talk:Kings Island (content before blanking was: 'Gay')
- 15:09, 14 Dec 2004 Ahoerstemeier deleted R. Ochsenfeld (content was: 'R.Ochsenfeld')
- 15:00, 14 Dec 2004 Quadell deleted Image:Thrustssc.300pix.jpg (Scaled-down duplicate image)
- 15:00, 14 Dec 2004 Quadell deleted Image:Tillandsia.single.250pix.jpg (Scaled-down duplicate image)
- 15:00, 14 Dec 2004 Quadell deleted Image:Titian.john.300pix.jpg (Scaled-down duplicate image)
- 15:00, 14 Dec 2004 Quadell deleted "Image:Toilet seat 200x330.jpg" (Scaled-down duplicate image)
- 15:00, 14 Dec 2004 Quadell deleted Image:Torquay.devon.300pix.jpg (Scaled-down duplicate image)
- 15:00, 14 Dec 2004 Quadell deleted "Image:Tower Fall in Yellowstone-300px.JPG" (Scaled-down duplicate image)
- 15:00, 14 Dec 2004 Quadell deleted Image:Tortoise.aldabra.250pix.jpg (Scaled-down duplicate image)
- 15:00, 14 Dec 2004 Quadell deleted Image:Tour group entering North Portal of Yucca Mountain-thumb.jpg (Scaled-down duplicate image)
- 15:00, 14 Dec 2004 Quadell deleted Image:Traffic.calming.300pix.jpg (Scaled-down duplicate image)
- 14:51, 14 Dec 2004 Ahoerstemeier deleted "Critique of Finno-Ugric and Uralic language Groups&action=edit" (miscreated at wrong title)
- 14:47, 14 Dec 2004 Ahoerstemeier deleted "David Salle" (content was: '{{db|no content}}')
- 14:42, 14 Dec 2004 Ahoerstemeier deleted "David Salle" (content was nonsense: 'Successful American artist known for stealing tip money from restaurant tables.')
- 14:39, 14 Dec 2004 Quadell deleted Image:ThunderbirdsBombBurst.jpeg (Scaled down version of existing image)
- 14:39, 14 Dec 2004 Quadell deleted Image:Thomas-Wright Battlefield in Lava Beds NM-300px.JPG (Scaled down version of existing image)
- 14:38, 14 Dec 2004 Adam Bishop deleted Willy evans (content was: 'the gayest person known to man{{deletebecause|while this is quite an accomplishment, it does not make him notable}}')
- 14:37, 14 Dec 2004 Geogre deleted Jason Morgan (1. Author votes to delete. 2. Prank. 3. VfD unanimous delete votes over 48 hr.)
- 14:30, 14 Dec 2004 Ahoerstemeier deleted Master esia (content was: 'Formation bac+5 à l'école d'ingénieurs d'Annecy.')
- 14:30, 14 Dec 2004 Ahoerstemeier deleted Samoo (content was nonsense: 'Samoo is a kind of bird that feeds on doods. She likes scrunchies and is high on poo.')
- 14:30, 14 Dec 2004 DavidWBrooks deleted Wildman harrold (content was: 'Wildman, Harrold, Allen & Dixon LLP is a general practice law firm based in Chicago, Illinois. The firm has offices in Lisle, Illinois and also in Lo...')
- 14:29, 14 Dec 2004 Quadell deleted Image:New 50-dollar bill back.jpg (Image contains errors and cannot be displayed)
- 14:29, 14 Dec 2004 Quadell deleted Image:New 50-dollar bill.jpg (Image contains errors and cannot be displayed)
- 14:29, 14 Dec 2004 Ahoerstemeier deleted Koosa (content was: 'Look for samoo. =D')
- 14:29, 14 Dec 2004 DavidWBrooks deleted Small step (content was: 'A small step for a man, is for example a step where the heel of the leading foot does not pass the toe of the trailing foot. See also [[Gait_analysis...')
- 14:29, 14 Dec 2004 DavidWBrooks deleted Modo real (foreign language version of existing page "Real mode")
- 14:28, 14 Dec 2004 Rfl deleted Influenza Epidemic of 1918 (corrected capitalization, no links, content was: '#REDIRECT [[Influenza epidemic of 1918]]')
- 14:27, 14 Dec 2004 DavidWBrooks deleted Cesar Rivero
- 14:27, 14 Dec 2004 DavidWBrooks deleted Dr. Paul Manheim (content was: 'The Federations leading Scientist in the Nature of Temporal Mechanics. Devised a Method of Manipulating Time to bring multiple copies of a single pers...')
- 14:26, 14 Dec 2004 Ahoerstemeier deleted Great Trigonometric Survey (content was: 'uioyoyiouiyuioiouoioui')
- 14:25, 14 Dec 2004 Ahoerstemeier deleted Windows (film) (content was: ''''Bold text'''i want the generation of the windows')
- 14:25, 14 Dec 2004 Postdlf deleted User talk:4.26.24.81 (only content was my erroneously given "test" message)
- 14:24, 14 Dec 2004 Ahoerstemeier deleted "The Bat (1926 movie)" (content was: '== [[Media:[[This movie helped to create Batman.]]]] ==')
- 14:24, 14 Dec 2004 DavidWBrooks deleted Dota (content was: 'Dota or Defense Of The Ancients is a Warcraft III / The Frozen Throne video game modification. Dota is based on all kinds of folklore and myths, and h...')
- 14:24, 14 Dec 2004 DavidWBrooks deleted United Nations Reolutions on Kashmir
- 14:24, 14 Dec 2004 Ahoerstemeier deleted Pontiacs rebellion (content was: 'it was a rebellion in ohio')
- 14:24, 14 Dec 2004 Ahoerstemeier deleted Spread-eagle sex position (content was: 'sex is good sex is fine doggy style or 69--[[User:195.194.131.172|195.194.131.172]] 13:39, 14 Dec 2004 (UTC)')
- 14:23, 14 Dec 2004 Ahoerstemeier deleted Mount Schank (content was: 'Mount Schank is When YOU SUCK CAUSE U DONT HAVE INFO ON IT')
- 14:23, 14 Dec 2004 Ahoerstemeier deleted Management consultants (content was: 'http://www.robots.ox.ac.uk/~charles/consult.html')
- 14:23, 14 Dec 2004 Ahoerstemeier deleted Dorsalis pedis artery (content was: 'first time to be here!')
- 14:22, 14 Dec 2004 Ahoerstemeier deleted Ragheb Alama (content was: 'Ragheb Alama is a bad man, our people hat him.')
- 14:22, 14 Dec 2004 Ahoerstemeier deleted Alex Walkinshaw (content was: 'I love Alex Walkinshaw')
- 14:21, 14 Dec 2004 Stan Shebs deleted Talk:Nerva (content was: 'denis was here but now he is gone he left his name to turn u on he, thoes who knew him knew him well thoes who don can go to @^%#')
- 14:16, 14 Dec 2004 Rfl deleted 1918 Flu (moved to correct capitalization, no links - content was: '#REDIRECT [[1918 flu]]')
- 14:16, 14 Dec 2004 Rfl deleted "Spanish Flu Pandemic" (moved to correct capitalization, no links - content was: '#REDIRECT [[Spanish flu pandemic]]')
- 14:15, 14 Dec 2004 Quadell deleted "Image:Gala2001a.jpg" (Listed on IfD since Dec 6)
- 14:15, 14 Dec 2004 Quadell deleted "Image:Gabi Centenary.bmp" (Listed on IfD since Dec 6)
- 14:15, 14 Dec 2004 Quadell deleted "Image:G point.jpg" (Listed on IfD since Dec 6)
- 14:09, 14 Dec 2004 UtherSRG deleted User:UtherSRG/SoC (my own subpage. content was: '* ''Online implementations'': A few online versions have been made available, under the condition that players already own physical copies of the game...')
- 13:35, 14 Dec 2004 Ahoerstemeier deleted Jungle (music (content was: 'ftgsfvswrdfvcxvcvsdfdf')
- 13:35, 14 Dec 2004 Ahoerstemeier deleted Locally linear embeddings (content was: 'see [http://www.cs.toronto.edu/~roweis/lle/ Homepage]')
- 13:32, 14 Dec 2004 David.Monniaux deleted Pets and service animals as a food source (content was: '#REDIRECT [[Pets and work animals as a food source]]')
- 13:25, 14 Dec 2004 Joy Stovall deleted Gabriel Soto (content was: '{{delete}}[[Image:Example.jpg]]')
- 13:14, 14 Dec 2004 Ferkelparade deleted Cur Deus Homo (content was: 'Some people believe it just seemed like fun.Others think he saw a pink elephant and wanted to cuddle with it.')
- 13:12, 14 Dec 2004 Woggly deleted List of words censored at the Sports Interactive Messageboards (created for the sole purpose of being inflammatory)
- 13:07, 14 Dec 2004 Woggly deleted Joel Persson (content was: '{{notenglish}}Joel Persson är en fantastisk människa....och som dessutom vid en jämförlse får Johan Berggren att likna en komplett tönt.')
- 13:06, 14 Dec 2004 Ahoerstemeier deleted Cypress Creek High School (content was: '[http://www.cypresscreekband.org Band Website]')
- 13:06, 14 Dec 2004 Ahoerstemeier deleted Greatest Hits 1970-2002 (content was: 'gh')
- 13:05, 14 Dec 2004 Woggly deleted Pigeon painter (nonsense. contributor is on a spree today. content was: 'Pigeon painting is a noble and well-paid job. Few people paint pigeons because of the risk of being pecked on. One person in [[Holland]] is not afraid...')
- 13:04, 14 Dec 2004 Woggly deleted TeRiele (nonsense, user has been contributing nonsense and vanity articles)
- 13:03, 14 Dec 2004 Ahoerstemeier deleted Demographics of Svalbard (content was: 'the demographics of svalbard.'''Bold text'''<nowiki>Insert non-formatted text here</nowiki>--[[User:156.34.66.248|156.34.66.248]] 23:41, 20 Nov 2004 (...')
- 13:03, 14 Dec 2004 Ferkelparade deleted CRAIG HUNTER (content was: '{{delete}}Pot noodle and an iron bru')
- 13:03, 14 Dec 2004 Woggly deleted Robbert teRiele (content was: '{{delete}}[[Robbert]] [[teRiele ]] is a pretty good [[VB]] coder.Unfortunately, he sucks at everything else, including trying to tie his own [[shoe]...')
- 13:02, 14 Dec 2004 Woggly deleted Robbert TeRiele (content was: '[[Robbert]] [[teRiele ]] is a pretty good [[VB]] coder.Unfortunately, he sucks at everything else, including trying to tie his own [[shoe]] laces. Yo...')
- 13:02, 14 Dec 2004 Ahoerstemeier deleted Pepta (content was orphan nonsense: ''''Bold text'''Peptathe name of the number equivalent to 10^51')
- 13:02, 14 Dec 2004 Ahoerstemeier deleted Swedish National board of Appeal for Higher Education (content was: 'Iam outgoing student in the university demostration secondary school uniport in nigeria and i wish if you could please assist me...')
- 13:00, 14 Dec 2004 Woggly deleted Juan Manuel Marquez (content was: '{{delete}}Fuck You Juan Manuel Marquez')
- 12:59, 14 Dec 2004 Woggly deleted Adriana sage (stub not in English but clearly pornographic)
- 12:58, 14 Dec 2004 Woggly deleted Cesar Rivero (stub not in English but clearly pornographic)
- 12:50, 14 Dec 2004 Deb deleted Whistle Blower Protection Act (content was: '{{delete}}blower protection act')
- 12:50, 14 Dec 2004 Deb deleted Century Rolls (nonsense)
- 12:48, 14 Dec 2004 Ahoerstemeier deleted Cypress Creek High School (content was: '[http://www.cypresscreekmarchingband.org]')
- 12:47, 14 Dec 2004 Danny deleted Christoffer Æsøy (content was: 'Christoffer is a professional Swimmer and Warcraft III player from Norway.Facts about ChristofferSex: MaleAge: 16Lives in: Norway, FloraDOB: 88...')
- 12:46, 14 Dec 2004 Danny deleted Bolgheri (content was: 'this guy sucks at designing clothing.')
- 12:46, 14 Dec 2004 Ahoerstemeier deleted Dynamic programming/Main Page (content was: 'hello mi want to ask about Dynamic programing assignments .')
- 12:45, 14 Dec 2004 Ahoerstemeier deleted Johan Bergren (content was: 'Johan Berggren är bäst i världen och bor i Kålltorp')
- 12:45, 14 Dec 2004 Ahoerstemeier deleted Charlton, Hertfordshire (content was: 'charlton is cool')
- 12:45, 14 Dec 2004 Ahoerstemeier deleted Civil Rights Act of 1991 (content was: 'civil rights act of 1991')
- 12:37, 14 Dec 2004 Rfl restored "Image:Flag_of_Poland_with_Coat_of_Arms_640px_border1.png"
- 12:36, 14 Dec 2004 Rfl restored "Image:Flag_of_Poland_320px.png"
- 12:36, 14 Dec 2004 Danny deleted Ballekaka (content was: 'Ballekaka is an name for your dick when you have stuck it in a cake.')
- 12:36, 14 Dec 2004 Rfl restored "Image:Flag_of_Poland_640px.png"
- 12:36, 14 Dec 2004 Rfl restored "Image:Flag_of_Poland_320px_border1.png"
- 12:36, 14 Dec 2004 Rfl restored "Image:Flag_of_Poland_640px_border1.png"
- 12:35, 14 Dec 2004 Rfl restored "Image:Flag_of_Poland_with_Coat_of_Arms_320px.png"
- 12:35, 14 Dec 2004 Rfl restored "Image:Flag_of_Poland_with_Coat_of_Arms_640px.png"
- 12:35, 14 Dec 2004 Rfl restored "Image:Flag_of_Poland_with_Coat_of_Arms_320px_border1.png"
- 12:35, 14 Dec 2004 Rfl restored "Image:Flag_of_Warsaw_320px.png"
- 12:35, 14 Dec 2004 Rfl restored "Image:Flag_of_Warsaw_640px.png"
- 12:34, 14 Dec 2004 Rfl restored "Image:Flag_of_Warsaw_320px_border1.png"
- 12:34, 14 Dec 2004 Rfl restored "Image:Flag_of_Warsaw_640px_border1.png"
- 12:32, 14 Dec 2004 Rfl deleted Image:Flag of Poland with Coat of Arms 640px border1.png (it's on Commons now)
- 12:32, 14 Dec 2004 Rfl deleted Image:Flag of Poland 320px.png (it's on Commons now)
- 12:32, 14 Dec 2004 Rfl deleted Image:Flag of Poland 640px.png (it's on Commons now)
- 12:32, 14 Dec 2004 Rfl deleted Image:Flag of Poland 320px border1.png (it's on Commons now)
- 12:32, 14 Dec 2004 Rfl deleted Image:Flag of Poland 640px border1.png (it's on Commons now)
- 12:32, 14 Dec 2004 Rfl deleted Image:Flag of Poland with Coat of Arms 320px.png (it's on Commons now)
- 12:31, 14 Dec 2004 Rfl deleted Image:Flag of Warsaw 640px border1.png (it's on Commons now)
- 12:31, 14 Dec 2004 Rfl deleted Image:Flag of Poland with Coat of Arms 640px.png (it's on Commons now)
- 12:31, 14 Dec 2004 Rfl deleted Image:Flag of Poland with Coat of Arms 320px border1.png (it's on Commons now)
- 12:31, 14 Dec 2004 Rfl deleted Image:Flag of Warsaw 320px.png (it's on Commons now)
- 12:31, 14 Dec 2004 Rfl deleted Image:Flag of Warsaw 640px.png (it's on Commons now)
- 12:31, 14 Dec 2004 Rfl deleted Image:Flag of Warsaw 320px border1.png (it's on Commons now)
- 12:28, 14 Dec 2004 MacGyverMagic deleted Johan berggren (content was: '{{delete}}Johan är hahahahahahahaha... de vill ni inte veta....han bor i Kålltorp...spamma honom på johan.berggren@hotmail.com')
- 12:28, 14 Dec 2004 Rfl restored "Image:Rfl-mandel002-out-p01.ps.rgb.bmp-fv-ls.2-gq90op.jpg"
- 12:28, 14 Dec 2004 Rfl restored "Image:Rfl-mandel002-out-p02.ps.rgb.bmp-fv-ls.2-gq90op.jpg"
- 12:28, 14 Dec 2004 Rfl restored "Image:Rfl-mandel003-out-p03.ps.rgb.bmp-fv-ls.2-gq90op.jpg"
- 12:28, 14 Dec 2004 Rfl restored "Image:Rfl-mandel004-screenshot-03-ls.5.png"
- 12:26, 14 Dec 2004 Rfl deleted Image:Rfl-mandel002-out-p01.ps.rgb.bmp-fv-ls.2-gq90op.jpg (it's on Commons now)
- 12:26, 14 Dec 2004 Rfl deleted Image:Rfl-mandel004-screenshot-03-ls.5.png (it's on Commons now)
- 12:26, 14 Dec 2004 Rfl deleted Image:Rfl-mandel003-out-p03.ps.rgb.bmp-fv-ls.2-gq90op.jpg (it's on Commons now)
- 12:26, 14 Dec 2004 Rfl deleted Image:Rfl-mandel002-out-p02.ps.rgb.bmp-fv-ls.2-gq90op.jpg (it's on Commons now)
- 12:21, 14 Dec 2004 Rfl restored "Image:Pair_3_wire_2_horizontal_stripe.png"
- 12:21, 14 Dec 2004 Rlandmann deleted Martin-Marietta X-24 (Making way for page move)
- 12:20, 14 Dec 2004 Rfl restored "Image:Traffic_lights_3_states.png"
- 12:20, 14 Dec 2004 Rfl restored "Image:Traffic_lights_4_states.png"
- 12:19, 14 Dec 2004 Rfl deleted Image:Pair 3 wire 2 horizontal stripe.png (it's on Commons now)
- 12:19, 14 Dec 2004 Rfl deleted Image:Traffic lights 3 states.png (it's on Commons now)
- 12:19, 14 Dec 2004 Rfl deleted Image:Traffic lights 4 states.png (it's on Commons now)
- 12:18, 14 Dec 2004 Rfl restored "Image:Pair_4_wire_1_horizontal_stripe.png"
- 12:17, 14 Dec 2004 MacGyverMagic deleted Attila Fülöp (content was: 'Attila Fülöp:bäst, osv...')
- 12:17, 14 Dec 2004 Rfl restored "Image:Pair_2_wire_1_horizontal_old.png"
- 12:17, 14 Dec 2004 Rfl restored "Image:Pair_1_wire_2_horizontal_old.png"
- 12:17, 14 Dec 2004 Rfl restored "Image:Pair_1_wire_1_horizontal_old.png"
- 12:17, 14 Dec 2004 Rfl restored "Image:Pair_4_wire_2_horizontal_stripe.png"
- 12:16, 14 Dec 2004 MacGyverMagic deleted JIS X 6002 (content was: '{{deletebecause}}Dear sirThank you for the invitation we will be pleased to except and hope to see you at around 8 pm.')
- 12:16, 14 Dec 2004 Rfl restored "Image:Pair_2_wire_2_horizontal_old.png"
- 12:15, 14 Dec 2004 Rfl deleted Image:Pair 2 wire 2 horizontal old.png (it's on Commons now)
- 12:15, 14 Dec 2004 MacGyverMagic deleted Robbert (content was: '{{delete}}[[Robbert]] is [[strange]] name. Usually it is spelled with only one 'b'. When a person is called this way, you are allowed to [[laugh]]...')
- 12:15, 14 Dec 2004 Rfl deleted Image:Pair 2 wire 1 horizontal old.png (it's on Commons now)
- 12:15, 14 Dec 2004 Rfl deleted Image:Pair 1 wire 2 horizontal old.png (it's on Commons now)
- 12:15, 14 Dec 2004 Rfl deleted Image:Pair 1 wire 1 horizontal old.png (it's on Commons now)
- 12:15, 14 Dec 2004 Rfl deleted Image:Pair 4 wire 2 horizontal stripe.png (it's on Commons now)
- 12:15, 14 Dec 2004 Rfl deleted Image:Pair 4 wire 1 horizontal stripe.png (it's on Commons now)
- 12:14, 14 Dec 2004 Rfl deleted Image:Pair 3 wire 1 horizontal stripe.png (it's on Commons now)
- 12:13, 14 Dec 2004 Rfl restored "Image:Pair_2_wire_2_horizontal_stripe.png"
- 12:13, 14 Dec 2004 Rfl deleted Image:Pair 2 wire 2 horizontal stripe.png (it's on Commons now)
- 12:13, 14 Dec 2004 Rfl restored "Image:Pair_2_wire_1_horizontal_stripe.png"
- 12:12, 14 Dec 2004 Rfl deleted Image:Pair 2 wire 1 horizontal stripe.png (it's on Commons now)
- 12:12, 14 Dec 2004 Rfl restored "Image:Pair_1_wire_2_horizontal_stripe.png"
- 12:12, 14 Dec 2004 Rfl deleted Image:Pair 1 wire 2 horizontal stripe.png (it's on Commons now)
- 12:11, 14 Dec 2004 Rfl restored "Image:Pair_1_wire_1_horizontal_stripe.png"
- 12:11, 14 Dec 2004 Rfl deleted Image:Pair 1 wire 1 horizontal stripe.png (it's on Commons now)
- 12:03, 14 Dec 2004 Rfl restored "Image:25_pair_color_code_chart.png"
- 11:59, 14 Dec 2004 Ahoerstemeier deleted The Pennsylvania Journal (content was: 'Hej med dig :).. Jeg ÆÆÆÆÆÆÆÆÆLSKER dig ;) [[Media:Example.ogg]][[Media:Example.ogg]][[Media:Example.ogg]][[Media:Example.ogg]]== Headline text ==Ey...')
- 11:59, 14 Dec 2004 David Gerard deleted OperatingThetan (created under incorrect name without space (browser hiccup))
- 11:57, 14 Dec 2004 Ahoerstemeier deleted Category talk:Arthur C. Clarke books (content was: '<math>Insert formula here</math>'''Bold text'''''Italic text''[[Link title]][[Image:Example.jpg]]')
- 11:56, 14 Dec 2004 Ahoerstemeier deleted Amplified fragment length polymorphism (content was only interwiki: '[[nl:Amplification Fragment Length Polymorphism]]')
- 11:52, 14 Dec 2004 Rfl deleted New age dream interpretation (content was: '#REDIRECT [[User:196.8.104.27]]')
- 11:51, 14 Dec 2004 Ahoerstemeier deleted Acrylic fiber (content was: '[[Media:Example.ogg]][[Image:Example.jpg]]--[[User:62.253.219.130|62.253.219.130]] 11:50, 14 Dec 2004 (UTC)----<math>Insert formula here</math>[[Ima...')
- 11:51, 14 Dec 2004 Ahoerstemeier deleted Yasir Abdul Qadir (content was vanity: 'He is Pakistani Student doing BEng from Turku Polytechnic in Turku, Finland.')
- 11:50, 14 Dec 2004 Ahoerstemeier deleted Dhiretjh (content before blanking was: 'Dhiretjh is a mechanical engineering student from holland. Many people have asked why he is always so impatient, yet so far, no answer to that can be given.')
- 11:49, 14 Dec 2004 Ahoerstemeier deleted Formula mass (content was: '== Headline text ==dagdsagdagdsgd')
- 11:35, 14 Dec 2004 Malcolm Farmer deleted New Subject (content was: 'This is a new Subject')
- 11:30, 14 Dec 2004 Ahoerstemeier deleted NewPage (content was: 'This is a new page This NewPageSubject is something relevant')
- 11:18, 14 Dec 2004 Kosebamse deleted USGL (nonsense)
- 11:18, 14 Dec 2004 Kosebamse deleted Rafey (nonsense)
- 11:17, 14 Dec 2004 Kosebamse deleted Ballistic trajectory (content was: '{{db|nonsense}}'''Bold text'''Wooh! VIVA LA VIVI!!!')
- 11:17, 14 Dec 2004 Kosebamse deleted Parma Ham (content was: '{{db|no content}}recipe')
- 11:06, 14 Dec 2004 Brion VIBBER deleted Image:Stupid-test-image.png (yay it works)
- 11:01, 14 Dec 2004 MacGyverMagic deleted Talk:List of U.S. state minimum wages (content was: 'Fuck George Bush and his people dick sucking hoe bitch BY:THE AMERCIAN PEOPLE and OSAMA BIN WAS HERE IIN THESE BITCH AND CASTRO')
- 10:57, 14 Dec 2004 Woggly deleted Shaun Rawcliffe (content was: ''''Shaun Rawcliffe'''[http://www.wingchun.co.uk Midlands Wing Chun Kuen (UK)]')
- 10:55, 14 Dec 2004 Woggly deleted Edvin Biukovic (content was: '== Headline text =='''''<nowiki>[[Media:== sss ==]]</nowiki>'''''{{delete}}')
- 10:53, 14 Dec 2004 Woggly deleted Robert E. Horn (content was: '[Robert E. Horn [http://www.stanford.edu/~rhorn/]]')
- 10:52, 14 Dec 2004 Woggly deleted Tom gethins (content was: '{{Delete}}Tom Gethins was a sarget majior i think! i want to research his life juring the war as he dosent have much memory. thanks')
- 10:50, 14 Dec 2004 Woggly deleted Analyst (content was: ''''Bold text'''')
- 10:49, 14 Dec 2004 Woggly deleted Alyssa Alps (content was: 'MAKE ONE{{delete}}')
- 10:40, 14 Dec 2004 Woggly deleted Rough deletion consensus (content was: '{{db|not article}}What a rough deletion consensus is is not set in stone, a few do consider a 2/3 [[majority]] a 'rough consensus'.As long as 'rough...')
- 10:39, 14 Dec 2004 Woggly deleted Nick feetenby (content was: 'nick feetenby(1988- ) is possibly one of the greatest people to live in the city of york.he has given much support to york cricket club and fulford go...')
- 10:38, 14 Dec 2004 Woggly deleted Lewis clapham (content was: 'lewis clapham(1988- ) a master of the kaining scene doesnt care about much but can be found in york mainly at the park & ride kaining away with his ma...')
- 10:37, 14 Dec 2004 Woggly deleted Five days for deletion (Inappropriate article. content was: 'Five days for deletion, is also a disputed, as long as five days may be appropriate for some articles, but for some other articles more or less(speedy...')
- 10:34, 14 Dec 2004 Zoney restored "Image:Europe_colour_coded.png"
- 10:33, 14 Dec 2004 Woggly deleted Threable handshaking protocal (content was: 'wdjsdskdksd;sldsdsfsfsdfsd')
- 10:32, 14 Dec 2004 Woggly deleted Fredrik (content was: 'Äter bajs varje dag!!!!{{delete}}')
- 10:32, 14 Dec 2004 Woggly deleted Bettina (content was: 'Äter också bajs varje dag!!!{{delete}}')
- 10:08, 14 Dec 2004 Woggly deleted Schickelsheim (content was: '{{del}}Im da biggest Ganxta from North-Schickelsheim(Nos-Shakedahome! Who will be a Memba in my BIG-FAT-Underground Crew,'Aggrofive'?')
- 10:06, 14 Dec 2004 Woggly deleted Fat cock (content was: '{{delete}}Word around the office is, you've got a fat cock.<br>I've got a fat cock too.<br>Maybe we should rub our fat cocks together sometime.<br>...')
- 09:47, 14 Dec 2004 SWAdair deleted Nguyen Thu Trieu (Should be in user space -- left note on user's talk page explaining how to create subpages)
- 09:26, 14 Dec 2004 SWAdair deleted Page (computer science) (content was: 'hgjghjghjjgkjkjhkhjkhjghjghjg{{delete}}')
- 09:23, 14 Dec 2004 SWAdair deleted Transphisic (content was: 'TRANSPHISIC, is a new painting current consisting in realizing, paintically speaking, an un-informal painting with a specific characterist: it must be...')
- 09:21, 14 Dec 2004 Ahoerstemeier deleted Indonesian Post - Pos Indonesia (content was: 'http://www.posindonesia.co.id')
- 09:13, 14 Dec 2004 Ahoerstemeier deleted Modular house (content was: 'modular house in chinese ??? prefabricated house information ???')
- 09:10, 14 Dec 2004 SWAdair deleted Wax tablet (content was: '{{delete}}aymen')
- 09:09, 14 Dec 2004 SWAdair deleted Plus Supermarkt (content was: '{{delete}}jkkj')
- 09:09, 14 Dec 2004 SWAdair deleted Nguyen Thu Trieu (content was: '{{deletebecause|it is a redirect to a user page}}#redirect [[User:Trieu]]')
- 09:05, 14 Dec 2004 Jdforrester deleted Ad whore (Speedy, content was: 'an ad whore who spams numerous forums to advertise his great new site ***site removed by wikipedia.com*{{delete}}')
- 09:01, 14 Dec 2004 Jdforrester deleted Norwegian Rocket Incident (Speedy. content was: 'you`re done')
- 08:54, 14 Dec 2004 Chris 73 deleted Laguna Bridge (content was: 'œ')
- 08:35, 14 Dec 2004 Tkinias deleted Talk:Perciformes (redirect with no nontrivial history)
- 08:33, 14 Dec 2004 Tkinias deleted Perciformes (redirect with no nontrivial history)
- 08:31, 14 Dec 2004 PMelvilleAustin deleted Image:Gdmaria.jpg (orphan image)
- 08:31, 14 Dec 2004 Postdlf deleted Image:Jewbacca.jpg (joke image--no valid use)
- 08:30, 14 Dec 2004 Postdlf deleted Talk:Jewbacca (orphan talk page for deleted article)
- 08:28, 14 Dec 2004 SWAdair deleted Trinidad and Tobago Football Federation (content was: '{{deletebecause|This page gets linked to from other association pages. It should be an empty page until the article is written. DO NOT redirect this t...')
- 08:27, 14 Dec 2004 SWAdair deleted St Francis D'Assisi High school (content was: '{{delete}}This boys secondary school is managed by Franciscan Missionary Brothers -- a Catholic Religious Society founded by Paulus Moritz a German ...')
- 08:26, 14 Dec 2004 SWAdair deleted SDXF (content was: '{{delete}}See [http://www.faqs.org/rfcs/rfc3072.html SDXF RFC 3072]')
- 08:25, 14 Dec 2004 Postdlf deleted Jewbacca (content was: 'A Jewbacca is an intergalactic space bear that possess supreme knowledge of the Torah. He is known to prefer kosher food prepared by fellow Jewbaccas...')
- 08:12, 14 Dec 2004 SWAdair deleted Online questionnaires (content was: 'what is the meaning of marriage{{delete}}')
- 08:10, 14 Dec 2004 SWAdair deleted List of words censored at the Sports Interactive Messageboards (nonsense)
- 08:09, 14 Dec 2004 SWAdair deleted Eli Gill (content was: 'the ultimate constitution signer.{{nonsense}}')
- 07:45, 14 Dec 2004 SWAdair deleted Aikido Magazine (content was: 'steven seagal')
- 07:44, 14 Dec 2004 SWAdair deleted Susan Mary Pollexfen (content was: '{{delete}}Susan Mary Pollenfen was the mother of William Butler Yeats.')
- 07:44, 14 Dec 2004 SWAdair deleted List of Physicists in the Manhattan Project (Redirect obsoleted by category, no inward links)
- 07:43, 14 Dec 2004 SWAdair deleted Broadview, Saskatchewan (content was: '{{delete}}A little hick town near the Saskatchewan/manitoba border.')
- 07:29, 14 Dec 2004 Postdlf restored "Oliver_the_humanzee"
- 07:29, 14 Dec 2004 Gadfium deleted Jean-Paul Deschatelets (content was: 'Hallo wie geht es dir')
- 07:28, 14 Dec 2004 DJ Clayworth deleted Lorne lo (content was: 'Lorne is a powerful god.')
- 07:27, 14 Dec 2004 Rmhermen deleted Tarun Chitra
- 07:27, 14 Dec 2004 Rmhermen deleted Vietnam Civil Actions Medal (content was: '{{delete}}ffff')
- 07:26, 14 Dec 2004 Rmhermen deleted Maluf
- 07:26, 14 Dec 2004 Rmhermen deleted Gregory Jonathan Grappone (content was: '{{delete}}#REDIRECT [[Gregory John Grappone]]')
- 07:26, 14 Dec 2004 Rmhermen deleted Gregory John Grappone
- 07:25, 14 Dec 2004 Rmhermen deleted Hic-a-doo-la (content was: '1. It's that special feeling you get when you hold hands with your best girl.2. It's cheering real loud for the home team.3. It's catching the perfe...')
- 07:25, 14 Dec 2004 Rmhermen deleted Paw paw michigan
- 07:24, 14 Dec 2004 Rmhermen deleted Pacification of Ghent
- 07:23, 14 Dec 2004 Rmhermen deleted Jonathan Santana (content was: '{{delete}}Jonathan Santana was born on August 2nd, 1985. Born at Palisade General Hospital. His birth last-name is Moro, since his father didnt know...')
- 07:23, 14 Dec 2004 DJ Clayworth deleted Lil Flip (content was: 'lil flip was not screws protage... he just did a couple flows on a couple tapes... z-ro on the otherhand he was SUC to the fullist')
- 07:22, 14 Dec 2004 Rmhermen deleted John "Career Killer" Deadly (content was: '{{delete}}Jonathan Santana was born on August 2nd, 1985. Born at Palisade General Hospital. His birth last-name is Moro, since his father didnt know...')
- 07:21, 14 Dec 2004 Rmhermen deleted Anna's Swedish Thins (content was: '{{delete}}Anna's Swedish Thins are the best cookies ever. Warning: they are highly addictive. Buy twenty boxes when they are on sale (I got them ...')
- 06:58, 14 Dec 2004 SimonP deleted Talk:Djibouti (content was: 'hi')
- 06:57, 14 Dec 2004 Fire Star deleted Talk:Paul was not a disciple (Orphan talk page. content was: 'Jesus did not chose Paul as a disciple. This of course doesn't diminish the important work Paul did but lets not confuse matters here.')
- 06:56, 14 Dec 2004 Lowellian deleted Boston Strangler (del in prep of move; content was: '#REDIRECT [[The Boston Strangler]]')
- 06:51, 14 Dec 2004 Gadfium deleted Boozembly :D (content was: '[http://www.example.com link title]')
- 06:49, 14 Dec 2004 SWAdair deleted Alferrarede (content was: '{{delete}}Alferrarede, freguesia do concelho de Abrantes, Distrito de Santarém, situada na margem direita do rio Tejo.')
- 06:44, 14 Dec 2004 Hadal deleted Constantine II of Constantinople (content was: 'hjskj')
- 06:44, 14 Dec 2004 John Kenney deleted Ernst vom Rath (Seeing as Kristallnacht is the principal article that will mention him, there's no reason for this article to redirect there.)
- 06:40, 14 Dec 2004 Postdlf deleted Roopali (content was: ''''Roopali''' is an Indian female name which means 'Beautiful Girl'.{{delete}}')
- 06:39, 14 Dec 2004 Postdlf deleted Oliver the humanzee (content was: 'Oliver: male, 30ish, very hairy, height 1.2 meters, weight 50 kilos, erect posture, unusual ears, offensive odor. Oscar always walks on two feet, uses a human toilet (which he flushes), can mix drinks...')
- 06:32, 14 Dec 2004 Postdlf deleted Jyoti Brahmin (content was: 'she is very beautiful{{delete}}')
- 06:32, 14 Dec 2004 Postdlf deleted Yasser Arafat is Still Dead (content was: 'Take off of the [[SNL]] running gag that [[Francisco Franco]] was still dead.')
- 06:19, 14 Dec 2004 DJ Clayworth deleted X-Ecutioners (content was: 'poop')
- 05:52, 14 Dec 2004 Golbez deleted IBlog (advertisement at best)
- 05:46, 14 Dec 2004 Hadal deleted User:68.107.102.129 (content was: ''Jihadipedia' - hilarious! [http://www.google.com (google)] does not even have it')
- 05:28, 14 Dec 2004 Flockmeal deleted Aziz SORE (content was: 'Financial mathematics student.')
- 05:28, 14 Dec 2004 Jrdioko deleted Shawn Farrell (content was: '{{delete}}Shawn Farrell is a gay homosexual who enjoys such activities as chugging cock and being boofed in the ass by big burly men. Boy is he gay....')
- 05:26, 14 Dec 2004 Flockmeal deleted Hic-a-doo-la (content was: '1. It's that special feeling you get when you hold hands with your best girl.2. It's cheering real loud for the home team.3. It's catching the perfe...')
- 05:24, 14 Dec 2004 Flockmeal deleted The Overcoat (content was: 'the overcoat')
- 05:17, 14 Dec 2004 Dysprosia deleted Template:BSD/Disclaimer (jamesday sez no)
- 05:16, 14 Dec 2004 Rmhermen deleted Nguyen Thu Trieu (content was: '== Nguyen Thu Trieu's opened projects ==This page is the container of my opened projects which can be built up by everyone.'''Contents'''Sub-dis...')
- 05:13, 14 Dec 2004 Hadal deleted Dave England (content before blanking was: 'my dad')
- 05:11, 14 Dec 2004 Infrogmation deleted Image:Yorkmin1.JPG (WP:PUI listed & tagged for deletion since October)
- 05:09, 14 Dec 2004 Infrogmation deleted Image:Yorkmin2.JPG (WP:PUI listed & tagged for deletion since October)
- 05:09, 14 Dec 2004 Infrogmation deleted Image:Tewxabby.JPG (WP:PUI listed & tagged for deletion since October)
- 05:08, 14 Dec 2004 Fennec deleted Derek Jamison ({{Wikipedia:Votes for deletion/Derek Jamison}})
- 05:07, 14 Dec 2004 Infrogmation deleted Image:Wesminab.JPG (WP:PUI listed & tagged for deletion since October)
- 05:07, 14 Dec 2004 Fennec deleted Sterry ({{Wikipedia:Votes for deletion/Sterry}})
- 05:06, 14 Dec 2004 Fennec deleted Ghost Rock ({{Wikipedia:Votes for deletion/Ghost Rock}})
- 05:04, 14 Dec 2004 Fennec deleted HYP (universities) ({{Wikipedia:Votes for deletion/HYP}})
- 05:04, 14 Dec 2004 Postdlf deleted Reflections on the Revolution in France (content was: '"Well back before the Revolution in France, There were a lot of hookers. Hookers as far as the eye could see. There were so many hookers you could have stacked them up to the moon, and maybe back!...')
- 05:04, 14 Dec 2004 Fennec deleted Mixonyte ({{Wikipedia:Votes for deletion/Mixonyte}})
- 05:02, 14 Dec 2004 Fennec deleted Permanent Assurance Company ({{Wikipedia:Votes for deletion/Permanent Assurance Company}})
- 05:02, 14 Dec 2004 Postdlf deleted Westphia (content was: 'The Treaty of WestphaliaThirty years' War, Protestants and Catholics were united against the CAlvinists. Although Protestants and Catholics detest e...')
- 05:02, 14 Dec 2004 Fennec deleted Yayhooray ({{Wikipedia:Votes for deletion/Yayhooray}} and {{copyvio|url=http://www.yayhooray.com/}})
- 05:00, 14 Dec 2004 Fennec deleted 6939 ({{Wikipedia:Votes for deletion/6939}})
- 04:59, 14 Dec 2004 Francs2000 deleted Index of CommonWealth Members (content was: 'Please Create Index of CommonWealth Members Names')
- 04:55, 14 Dec 2004 Francs2000 deleted Rick Distaso (new page blanked by author content before blanking was: 'This is the prosecuter in the Lacy Peterson murder trial.')
- 04:54, 14 Dec 2004 Fennec deleted Thishdin ({{Wikipedia:Votes for deletion/Thishdin}})
- 04:53, 14 Dec 2004 Fennec deleted Grupo Probeta ( {{Wikipedia:Votes for deletion/Grupo Probeta}})
- 04:52, 14 Dec 2004 Fennec deleted Mediacrat ( {{Wikipedia:Votes for deletion/Mediacrat}})
- 04:52, 14 Dec 2004 Jnc deleted Damian Yerrick/Banners (xspace redir to User:)
- 04:51, 14 Dec 2004 Fennec deleted IeSpell ({{Wikipedia:Votes for deletion/IeSpell}})
- 04:50, 14 Dec 2004 Francs2000 deleted Middlefield Collegiate Institute (content was: 'http://weeno.250free.com/TMP/no.JPG')
- 04:50, 14 Dec 2004 Francs2000 deleted Haverford School (content was: 'www.haverfordschool.org for more information')
- 04:48, 14 Dec 2004 Francs2000 deleted Ferdinand of Styria (content was: '{{delete}}he was a homosexual')
- 04:47, 14 Dec 2004 Francs2000 deleted Cures/treatments for colorblind (content was: '{{delete}}For color blind people there are no cures because the inherite from their parents.')
- 04:40, 14 Dec 2004 Francs2000 deleted Randy dobson (content before blanking was: '==Randy Dobson==A boy with a very small or non-existant penis. He is attracted to other men, but some how has a girlfriend. He likes to rub other ...')
- 04:32, 14 Dec 2004 Flockmeal deleted Quarrydale School (content was: 'Hi my name is Trevor Roberts I am looking for anyone who attended Stoney ford road school in 1965 my e.mail is skba@powerup.com.au')
- 04:32, 14 Dec 2004 Gamaliel deleted Premafrost (content was: 'luhkihujkiuhi')
- 04:31, 14 Dec 2004 Fennec deleted Juan Cole ([[WP:CP]] since Nov 24. Incompetents^Wuninformed people moved content from /temp here, but it appears they didn't change it, so I'll be deleting this PROPERLY, ok? =b)
- 04:29, 14 Dec 2004 Fennec deleted Peace of paris ([[WP:CP]] since November 24)
- 04:28, 14 Dec 2004 Gamaliel deleted Jared Landry (content was: 'Jared Landry is an undercover gay-rights activist, working in Mississauga, Ontario. As part of his operation, he poses as a student at Port Credit Se...')
- 04:28, 14 Dec 2004 TUF-KAT deleted How many feminists does it take to screw in a light bulb? (content was: '{{delete}}Q: How many feminists does it take to screw in a light bulb?A: Two. One to screw in the light bulb and one more to SUCK MY FUCKING DICK!')
- 04:27, 14 Dec 2004 Mikkalai deleted Image:Karaliu-pasaka.JPG
- 04:25, 14 Dec 2004 Francs2000 deleted It's Great to Be an Engine (content was: '{{delete}}Stories:Too Hot For Thomas,Emily's Adventure,You Can Do It, Toby!,Gordon Takes Charge,Edward The Great,James Goes Too Far,Percy An...')
- 04:24, 14 Dec 2004 Francs2000 deleted Thomas and the Jet Engine & Other Adventures (content was: '{{delete}}Stories:Thomas And The Jet Engine,Percy And The Haunted Mine,Scaredy Engines,Harold And The Flying Horse,Bulgy Rides Again,Salty's S...')
- 04:24, 14 Dec 2004 Francs2000 deleted Steamies vs. Diesels & Other Thomas Adventures (content was: '{{delete}}Stories:Thomas To The Rescue,Henry And The Wishing Tree,Squeak, Rattle And Roll,Percy's New Whistle')
- 04:23, 14 Dec 2004 Francs2000 deleted New Friends For Thomas & Other Adventures (content was: '{{delete}}Stories:Gordon And Spencer,Emily's New Coaches,The Spotless Record,Peace And Quiet,Jack Jumps In,A Friend In Need')
- 04:23, 14 Dec 2004 Mikkalai deleted Image:Tkachev-wedding.JPG
- 04:22, 14 Dec 2004 Fennec deleted Spöring Island ([[WP:CP]] since November 24)
- 04:21, 14 Dec 2004 Fennec deleted Herman Spöring ([[WP:CP]] since November 24)
- 04:19, 14 Dec 2004 Niteowlneils deleted Talk:Tritik (content was: '{{db|test page; talk for non-existent article}}')
- 04:18, 14 Dec 2004 Francs2000 deleted Strain theory (content was: '{{delete}}Strain theory consists of having too many roles prescribed.')
- 04:18, 14 Dec 2004 Neutrality deleted Image talk:Michelle Wie.jpg (content was: 'Wow, pretty.')
- 04:18, 14 Dec 2004 Denni deleted Image:Dwimage.jpg (by request of creator)
- 04:17, 14 Dec 2004 Francs2000 deleted Rod 'Burger' Mcleod (content was: '{{delete}}Raw agression can best describe the vocal stylings of this onstage dynamo.')
- 04:17, 14 Dec 2004 Fennec deleted Cd manufacturing ([[WP:CP]] since November 15.)
- 04:16, 14 Dec 2004 Fennec deleted Centipede Game ([[WP:CP]] since November 15.)
- 04:16, 14 Dec 2004 Francs2000 deleted Warcraft3 (content was: 'This is a RTS game created by www.blizzard.com Please refer to that website for all future reference.')
- 04:16, 14 Dec 2004 Francs2000 deleted September 21, 1983 (rubbish)
- 04:14, 14 Dec 2004 Flockmeal deleted Nguyen Thu Trieu (content was: '== Nguyen Thu Trieu's opened projects ==This page is the container of my opened projects which can be built up by everyone free!!')
- 04:13, 14 Dec 2004 Niteowlneils deleted Erica Block (content was: '{{delete}}Born Erica Dale Block on April 20, 1988')
- 04:13, 14 Dec 2004 Niteowlneils deleted Culture of Guatemala (content was: '{{delete}}This country located in Central America is extremely rich in culture')
- 04:10, 14 Dec 2004 Francs2000 deleted Todd and Rod (content was: '{{delete}}Two characters from the simpsons. A source of comedic relief.')
- 04:09, 14 Dec 2004 Niteowlneils deleted Tagzapper/Temp (re-copyvio)
- 04:08, 14 Dec 2004 Francs2000 deleted Bigpeeler (content was: '{{delete}}The greatest poster in the history of the Something Awful Forums.5, sirs, just 5.')
- 04:07, 14 Dec 2004 Francs2000 deleted Ascending cellulitis (content was: 'ascending cellulitis')
- 04:06, 14 Dec 2004 Francs2000 deleted After death of mao zedong (content was: '{{delete}}Mao Zedong-After Death')
- 04:03, 14 Dec 2004 Francs2000 deleted Joe Joe, becomes a dead man (b. 1700 (content was: '{{nonsense}}Joe Joe was a man of many dreams the first to kill Leo the boy. He beame a man in never never land.')
- 04:02, 14 Dec 2004 Francs2000 deleted Aaron Miles (content was: '{{delete}}best person ever')
- 04:01, 14 Dec 2004 Francs2000 deleted Schlenther v. Florida Department of State (content was: '{{delete}}Send request to The Florida Department of Records.')
- 04:01, 14 Dec 2004 Francs2000 deleted Eliot Javdan (content was: 'http://binaryreport.com/')
- 04:00, 14 Dec 2004 Francs2000 deleted Withitness (content was: '== WITHITNESS ==Withitness is a term coined by Jacob Kounin to describe the teacher's ability to be aware of everything that is happening in the cla...')
- 03:58, 14 Dec 2004 Francs2000 deleted Rob smadella (content was: 'Rob Smadella is a famous ottawa citizen.He likes playing pool, drinking beer and eating burgers.')
- 03:57, 14 Dec 2004 Francs2000 deleted Kirk storla (nonsense)
- 03:56, 14 Dec 2004 Francs2000 deleted Smiley Lewis (content was: ' ,')
- 03:56, 14 Dec 2004 Francs2000 deleted Bakhtiyar Sadigli (content was: 'Bakhtiyar Sadigliwww.GAGASH.com')
- 03:49, 14 Dec 2004 Jrdioko deleted Niceto Alcalá-Zamora (content before blanking was: 'oooh yes! harder..HARDER')
- 03:48, 14 Dec 2004 Jrdioko deleted The puritans (content was: '{{delete}}----<nowiki><math>[[Image:[[[[fghbea:ihdfdhf]]]]]]</math></nowiki>')
- 03:47, 14 Dec 2004 Jrdioko deleted Paris mob (content was: '{{delete}}Ý')
- 03:47, 14 Dec 2004 Jrdioko deleted Emilie Trambusch (content was: '{{delete}}uhiuhiuhi')
- 03:45, 14 Dec 2004 Jrdioko deleted U.S. presidential election, 2012 (content was: '{{delete}}Jeb Bush - 99.8%<br>Hillary Clinton - 0.2%')
- 03:44, 14 Dec 2004 Jrdioko deleted Lindau Gospels (content was: '{{delete}}hell no')
- 03:44, 14 Dec 2004 Jrdioko deleted Iam Retep (content was: '{{delete}}')
- 03:43, 14 Dec 2004 Jdforrester deleted Template:Succession box two to o (Mis-created just now by my after bungled page move.)
- 03:43, 14 Dec 2004 Fennec deleted Quanyin (Redirect page history contains copyvio listed at [[WP:CP]]; deleting and will immediately restore #REDIRECT [[Kuan Yin]])
- 03:43, 14 Dec 2004 Jrdioko deleted H. Ellsworth Vines (content was: ' Fuck you bitches')
- 03:42, 14 Dec 2004 Adam Bishop deleted Bulk carrier (content was: 'BULK CARRIER')
- 03:42, 14 Dec 2004 Fennec deleted Alameda county sheriff (Listed on [[WP:CP]] since November 6)
- 03:39, 14 Dec 2004 Jrdioko deleted Guitar god (content was: 'Johnny Winter, dude.')
- 03:38, 14 Dec 2004 Jdforrester restored "Template:Succession_box_three_to_three"
- 03:38, 14 Dec 2004 Jdforrester deleted Template:Succession box three to three (Deleting for page-merge.)
- 03:35, 14 Dec 2004 Jrdioko deleted Greenoch (content was: 'yes')
- 03:34, 14 Dec 2004 Adam Bishop deleted Ban Vinai (content was: 'ban vinai camp')
- 03:31, 14 Dec 2004 Gwalla deleted User:Gwalla/Language table (user subpage was moved into main article namespace; redirect is useless)
- 03:23, 14 Dec 2004 Johnleemk deleted Iam Retep (content was: 'This kid is gay')
- 03:22, 14 Dec 2004 Cyrius deleted Yuzhong (content was: 'My friend lives there. The whole of chongqing is covered in apartment buildings (楼房 - lou fang). It's amazing!!{{substub}}')
- 03:18, 14 Dec 2004 Cyrius deleted RFC 822 (redirect with no real history.)
- 03:15, 14 Dec 2004 WhisperToMe restored "Junko_Furuta"
- 03:15, 14 Dec 2004 WhisperToMe restored "Jo_Kamisaku"
- 03:08, 14 Dec 2004 Cyrius deleted Aphaenogaster (lack of context/definition.)
- 03:04, 14 Dec 2004 WhisperToMe deleted Junko Furuta (Moving "Furuta Junko" here)
- 02:59, 14 Dec 2004 WhisperToMe deleted Jo Kamisaku (Moving "Kamisaku Jo" here)
- 02:58, 14 Dec 2004 Cyrius restored "Alor_Star"
- 02:58, 14 Dec 2004 Cyrius deleted Alor Star (page history merge)
- 02:57, 14 Dec 2004 Cyrius deleted Alor Star (page history merge)
- 02:51, 14 Dec 2004 Cyrius deleted Alkanna (CSD - no context/definition)
- 02:47, 14 Dec 2004 Cyrius deleted Aletris (CSD - no context/definition)
- 02:36, 14 Dec 2004 Cyrius deleted Agrostemna (CSD - no definition/context)
- 02:30, 14 Dec 2004 Cyrius deleted Agropyrum (CSD - no definition/context)
- 02:30, 14 Dec 2004 Cyrius deleted Agrimonia (CSD - no definition/context)
- 02:26, 14 Dec 2004 Cyrius deleted Age of ballyhoo (CSD - lack of definition/context)
- 02:20, 14 Dec 2004 Evercat deleted Eric cho (junk)
- 02:17, 14 Dec 2004 Tkinias deleted Grayling (redirect with trivial history)
- 02:15, 14 Dec 2004 Ævar Arnfjörð Bjarmason deleted Image:Latin letter AE.png (Replaced by commons:Image:Latin letter Æ.png)
- 02:13, 14 Dec 2004 Rossami restored "JUSTIN_RUDDY"
- 02:12, 14 Dec 2004 Evercat deleted Speak & Read (content was: 'oh!yes')
- 02:11, 14 Dec 2004 Ævar Arnfjörð Bjarmason deleted Image:ArabLeague-Map.png (Replaced by commons:Image:Map of League of Arab States countries.png)
- 02:06, 14 Dec 2004 Adam Bishop deleted Kevinfangs (content was: 'The combination of the words 'Kevin, Fang, and the letter 's''')
- 02:02, 14 Dec 2004 Jrdioko deleted Warcraft3 (content was: '{{delete}}The simple, best game ever. Warcraft 3 The Frozen Throne (TFT) is a great game. You must buy it now. [[Www.blizzard.com]] A gosu is a r...')
- 02:01, 14 Dec 2004 Quadell deleted Image:Seagate-ST-412-s.jpg (Scaled-down copy of existing image)
- 02:01, 14 Dec 2004 Jrdioko deleted Wsrf (copy of main page)
- 01:58, 14 Dec 2004 Jrdioko deleted Princes Town (content was: '{{nonsense}}My grandparents live in princes town that's were I was all summer long it was a small little town not alot of nosie there only tye doogs...')
- 01:56, 14 Dec 2004 Jrdioko deleted Fortified milk (content was: '{{nonsense}}')
- 01:54, 14 Dec 2004 Joy Stovall deleted The Video Game Theory Reader (content was: 'the people of america are stupid people')
- 01:52, 14 Dec 2004 Adam Bishop deleted Fortified milk (content was: 'Come to Yahoo')
- 01:51, 14 Dec 2004 Jrdioko deleted Telepictures (content was: '{{delete}}anna nicole smith')
- 01:50, 14 Dec 2004 Joy Stovall deleted Naveen rasiah (content was: '{{delete}}Naveen Rasiah....some say the greatest man to every live. He is compared to those such as Hercules, Achillies, Alexander the Great, Einste...')
- 01:49, 14 Dec 2004 Jrdioko deleted New York Weekly Journal (content was: '{{delete}}this is kimm')
- 01:49, 14 Dec 2004 Jrdioko deleted Needle-felt (content was: '{{delete}}Needle-Felt')
- 01:49, 14 Dec 2004 Jrdioko deleted J. H. Mueller (content was: '{{delete}}he sucks his big fat hairy cock with his mama.')
- 01:45, 14 Dec 2004 Jrdioko deleted Impeachment proceedings of a US president (content was: '{{delete}}what are the impeachment proceedings of a US president?')
- 01:44, 14 Dec 2004 Jrdioko deleted Eddie Gerrarro (content was: '{{delete}}hjkkkkkkkkkkkkkkkkkkkkkkkjjjjjjkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkjjjjjjjjjjjjjjjjjjjjjjjjkkkkkkkkkkkkkkkkkkkkkkkkkkkkkf')
- 01:43, 14 Dec 2004 Jrdioko deleted Quangxi Influence (content was: 'LIZ AND ROB HAVE HAPPY SEX{{delete}}')
- 01:43, 14 Dec 2004 Infrogmation deleted Kreutzer Strad (content was: '{{delete}}fgsdfgsdfgadfafgadfgadfgfadfgafgadfgwedcsdweefwefsdfawefdsfw')
- 01:43, 14 Dec 2004 Adam Bishop deleted Tejal Naik (content was: 'A famous delawarean known for his homosexual antics, and one of the first self proclaimed gay leaders. He was tragically shot in 2004 when some 'hater...')
- 01:43, 14 Dec 2004 Infrogmation deleted M. S. Krieger (unhelpful substub; content was: ''''M. S. Krieger''' (Mark Krieger) maintained the Whitesmith C compilers.{{deletebecause|Lack of content}}')
- 01:42, 14 Dec 2004 Infrogmation deleted Pictures on smallpox (content was: '{{delete}}smallpox')
- 01:42, 14 Dec 2004 Jrdioko deleted Page Act of 1875 (newbie test)
- 01:41, 14 Dec 2004 Infrogmation deleted Carlos Rickshaw (junk)
- 01:41, 14 Dec 2004 Infrogmation deleted Corea Cotto (content was: '{{delete}}f')
- 01:40, 14 Dec 2004 Infrogmation deleted Communication in anceint rome (profanity)
- 01:39, 14 Dec 2004 Infrogmation deleted Rika Nashimura (uninformative substub; content was: ''''Rika Nashimura''' is a [[Japanese]] [[pornography]] star.{{delete}}')
- 01:39, 14 Dec 2004 Infrogmation deleted Philip tabah (content was: '{{db|no content}}'; was junk)
- 01:38, 14 Dec 2004 Infrogmation deleted Communication in ancient rome (content was: '{{delete}} profanity)
- 01:38, 14 Dec 2004 Infrogmation deleted Ouca (content was: '{{delete}}HOla')
- 01:38, 14 Dec 2004 Infrogmation deleted Melba Pattillo Beals (junk)
- 01:37, 14 Dec 2004 Infrogmation deleted Cliff Baxter (content was: '{{nonsense}}Cliff em all...')
- 01:36, 14 Dec 2004 Jrdioko deleted Kreutzer Strad (content was: 'fgsdfgsdfgadfafgadfgadfgfadfgafgadfgwedcsdweefwefsdfawefdsfw')
- 01:33, 14 Dec 2004 Niteowlneils deleted Arc tube (content was: '{{delete}}My shlong.')
- 01:28, 14 Dec 2004 Niteowlneils deleted Talk:Zakusage (content was: '{{delete}}')
- 01:25, 14 Dec 2004 Rlandmann deleted Execution by pressing (content was: 'To have ones flesh eaten by wolves.')
- 01:21, 14 Dec 2004 Jnc deleted Code examples 1 (xspace redir to User:)
- 01:20, 14 Dec 2004 Jnc deleted Chuck Smith/Pedagogical evidence for Esperanto (xspace redir to User:)
- 01:14, 14 Dec 2004 Niteowlneils deleted User:Wyatts/Failure rate test (content was: '{{delete}}#REDIRECT [[User:Wyatts/Draft article B]]')
- 01:14, 14 Dec 2004 Niteowlneils deleted User:Wyatts/Reliability engineering test (content was: '{{delete}}#REDIRECT [[User:Wyatts/Draft article C]]')
- 01:14, 14 Dec 2004 Niteowlneils deleted User:Wyatts/TRL test (content was: '{{delete}}#REDIRECT [[User:Wyatts/Draft article A]]')
- 01:12, 14 Dec 2004 Mackensen deleted Talk:Carlos I. Pesquera (content was: 'no he's not you mother f***er i love this mofo')
- 01:12, 14 Dec 2004 Mackensen deleted Carlos I. Pesquera (content was: '{{delete}}he is a cool dude that loves his country and is a sick ass mofo that wants to become part of the f***ing United States')
- 01:05, 14 Dec 2004 Flockmeal deleted Siege of Ruby Ridge (content was: '{{delete}}the seige of ruby ridge was a great seige. it happened on a day in august i believe...well thats all for now on the seige of ruby ridge.....')
- 00:59, 14 Dec 2004 Jnc deleted Chato/Wikipedia Usability Report (xspace redir to User:)
- 00:59, 14 Dec 2004 Niteowlneils deleted Temp link (oops--wrong namespace--content was: '#REDIRECT [[User:Niteowlneils/Temp link]]')
- 00:57, 14 Dec 2004 UtherSRG deleted Category:Genera (content was: 'A '''genus''' (plural '''genera''') is one of the levels of [[scientific classification]].[[Category:Scientific classification]]')
- 00:55, 14 Dec 2004 TUF-KAT deleted Pete Paisley (content was: 'Pete Paisley is a famous person that few people have heard of{{del}}')
- 00:55, 14 Dec 2004 TUF-KAT restored "Up_in_Smoke"
- 00:54, 14 Dec 2004 TUF-KAT deleted Up in Smoke (content was: '#REDIRECT [[Cheech and Chong]]' making way for a move)
- 00:53, 14 Dec 2004 TUF-KAT deleted Migration rights for whites (rant)
- 00:53, 14 Dec 2004 TUF-KAT deleted Maluf (long nonsense)
- 00:47, 14 Dec 2004 Jnc restored "Talk:Dark-sky_movement"
- 00:45, 14 Dec 2004 Jnc deleted Talk:Dark-sky movement (Deleting to merge histories, back in 'arf a mo')
- 00:44, 14 Dec 2004 Davidcannon deleted José Manuel Durão Barroso (moving a page here)
- 00:34, 14 Dec 2004 Joy Stovall deleted Karl Brand (content was: '{{delete}}Karl is a poophead')
- 00:34, 14 Dec 2004 Joy Stovall deleted Ames room illusion (content was: '{{delete}}How are you all doing today')
- 00:29, 14 Dec 2004 Joy Stovall deleted Boiling to death (content was: '{{del}}Boiling is awful.')
- 00:25, 14 Dec 2004 Jmabel restored "Apothecary"
- 00:24, 14 Dec 2004 Flockmeal deleted Hunter Nelson (content was: 'Hunter Nelson was born on February 12, 1989 in Oregon, OH. Good for him.')
- 00:22, 14 Dec 2004 UtherSRG deleted 2015, Inc. (prep for movecontent was: '#REDIRECT [[2015 (game developer)]]')
- 00:21, 14 Dec 2004 Mirv deleted The Precepts of Kato Kiyomasa (re-deleting; now properly transwikied)
- 00:18, 14 Dec 2004 UtherSRG deleted Talk:Modern Satanism (content was: 'This information was moved from [[LaVeyan Satanism]]. LaVeyan Satanism is a misnomer and used only by fringe Satanists to differentate themselves from...')
- 00:17, 14 Dec 2004 UtherSRG deleted Modern Satanism (prep for move)
- 00:14, 14 Dec 2004 UtherSRG restored "November_2004_in_sports"
- 00:09, 14 Dec 2004 UtherSRG deleted November 2004 in sports (histroy fix)
- 00:05, 14 Dec 2004 UtherSRG deleted Talk:Contredanse
- 00:04, 14 Dec 2004 UtherSRG deleted Contredanse (content before blanking was: '{{mergefrom}} [[contradance]]''For the American dance, see [[contradance]]''The '''contredanse''' is a [[France|French]] [[dance]] very popular in...')
- 00:02, 14 Dec 2004 RedWordSmith deleted Cascading (content was: 'LIKAMA JAMAL')
- 23:47, 13 Dec 2004 Infrogmation deleted Al-Hillah (content was: '{{delete}}}[[Link title]][[Link title]][[Media:Example.ogg]][[Image:Example.jpg]]')
- 23:47, 13 Dec 2004 Infrogmation deleted Wraparound mortgage (content was: '{{delete}}wrwap around mortgage')
- 23:45, 13 Dec 2004 Infrogmation deleted Cross-reference (rant; content was: '{{delete}}How do you make a difinition using one word that has no definition. Its like saying the definition of fantastic is fantasticallomatic. Tha...')
- 23:44, 13 Dec 2004 Infrogmation deleted Intrinsic Motivation in the Classroom Through Music (redir to nonexitstant article; content was: '#REDIRECT [[Motivation Through music]]')
- 23:44, 13 Dec 2004 Mirv deleted CARLO BENAVIDEZ (content was: '{{delete}}What a dumb guy he is, sleeping on his bed whilst the world turns round.')
- 23:43, 13 Dec 2004 Infrogmation deleted Motivation Through music (content was: '{{delete}}')
- 23:41, 13 Dec 2004 Infrogmation deleted Planet of Faith (content was: '{{delete}}'; before was blanked by original editor)
- 23:29, 13 Dec 2004 Deb deleted Schnook (content was: 'Schnook: An idiot, a sucker, Henry Hill having given up his life as a gangster for that of someone in a witness protection program.')
- 23:23, 13 Dec 2004 Deb deleted Granite School District (content was: 'http://www.granite.k12.ut.us/{{db|just a link}}')
- 23:21, 13 Dec 2004 Deb deleted Zakusage (content was: '==ZakuSage==A username for Ben Matthews on several message boards, email services, websites, and here at Wikipedia.')
- 23:20, 13 Dec 2004 Deb deleted Carmer (content was: 'ME')
- 23:20, 13 Dec 2004 Deb deleted No duh (content was: '{{delete}}see '[[duh]]'')
- 23:19, 13 Dec 2004 Deb deleted Duh (content was: '{{delete}}see '[[no duh]]'')
- 23:08, 13 Dec 2004 Neutrality deleted North Korea/Military (content was: '#REDIRECT [[Military_of_North_Korea]]' (obselete))
- 23:05, 13 Dec 2004 Infrogmation deleted TeenOpenDiary (content was: 'weeeeeeeeeeeee')
- 23:02, 13 Dec 2004 Infrogmation deleted Bill Stewart (musician) (inadiquate substub; content was: 'Born circa 1970.Magnificent jazz drummer.')
- 22:57, 13 Dec 2004 Niteowlneils deleted Military radio (content was: 'EAT ANUS YOU FAGGOT{{delete}}')
- 22:54, 13 Dec 2004 Infrogmation deleted Image:Abtwkmn.JPG (image WP:PUI listed & tagged for deletion)
- 22:53, 13 Dec 2004 Neutrality deleted How did the united states prepare for world war 2 (content was: '{{vfd}}How did the United States prepare for World War 2?')
- 22:53, 13 Dec 2004 Infrogmation deleted Image:Coronation seat.JPG (remove image WP:PUI listed & tagged for deletion)
- 22:51, 13 Dec 2004 DavidWBrooks deleted DHEC (content was: 'Acronym for the [[South Carolina Department of Health and Environmental Control]]. For more information: [http://www.scdhec.net SC DHEC Website]')
- 22:49, 13 Dec 2004 Infrogmation deleted Image:Magdalen park oxford.JPG (remove image WP:PUI listed & tagged for deletion since 7 Oct)
- 22:49, 13 Dec 2004 DavidWBrooks deleted Comic sound (content was: 'The sound of bodily functions usually raise a laugh, as do sounds that are out of context and therefore ridiculous, e.g. a snail that meiows (see spon...')
- 22:49, 13 Dec 2004 Infrogmation deleted Image:Clarendon bldg oxford.JPG (remove image WP:PUI listed & tagged for deletion)
- 22:47, 13 Dec 2004 Infrogmation deleted Image:Sheldonian theatre oxford.JPG ( WP:PUI listed & tagged for deletion since Oct, and we already have a GFDL image for article)
- 22:47, 13 Dec 2004 DavidWBrooks deleted Denzium (content was: '{{delete}}A fictional mineral. Please, please, PLEASE delete this page!!!!!!!!!')
- 22:47, 13 Dec 2004 DavidWBrooks deleted Data Base Task Group (content was: 'asfasdfasdf')
- 22:46, 13 Dec 2004 DavidWBrooks deleted Hunter Junior High (content was: a junior high school! "not really famous for anything")
- 22:45, 13 Dec 2004 DavidWBrooks deleted GotTheCrack
- 22:35, 13 Dec 2004 Infrogmation deleted SSTAR (content was: '{{sstar}}')
- 22:33, 13 Dec 2004 DavidWBrooks deleted Dark-sky movement (content was: '#REDIRECT[[Dark-Sky Movement]]')
- 22:33, 13 Dec 2004 Infrogmation deleted Image:Bougainville Island.gif (WP:PUi lsited and tagged for deletion in September; no reply to status inquiries made 7 Oct)
- 22:27, 13 Dec 2004 Ike9898 deleted O O (content was: '{{delete}}O_O')
- 22:26, 13 Dec 2004 Ike9898 deleted Oddjobs (content was: '== Headline text ==BEEP BEEP')
- 22:24, 13 Dec 2004 Ahoerstemeier deleted General William Westmoreland (content was: '--[[User:207.165.35.157|207.165.35.157]] 18:18, 13 Dec 2004 (UTC)----Á----== Headline text ==[[Link title]]<nowiki>Insert non-formatted text her...')
- 22:18, 13 Dec 2004 Infrogmation deleted Image:Taus4.jpg (copyvio requested for delete; PD image now used in place)
- 22:10, 13 Dec 2004 Infrogmation deleted Image:Stgeogs.JPG (WP:PUI listed and tagged for deletion since October )
- 22:10, 13 Dec 2004 Infrogmation deleted Image:Edincast.JPG (WP:PUI listed and tagged for deletion since October )
- 22:07, 13 Dec 2004 Infrogmation deleted Image:Edward1.JPG (WP:PUI listed and tagged for deletion since October )
- 22:04, 13 Dec 2004 Infrogmation deleted Image:John1.JPG (WP:PUI listed and tagged for deletion since October )
- 22:03, 13 Dec 2004 Infrogmation deleted Image:Louis7.JPG (WP:PUI listed and tagged for deletion since October )
- 22:03, 13 Dec 2004 Quadell deleted Image:Wing.slat.250pix.jpg (scaled-down version of duplicate image)
- 21:59, 13 Dec 2004 Thue deleted Catagory:TV channels of Greece (misspelled title)
- 21:58, 13 Dec 2004 Thue deleted Template:MelbourneStationFacilities (deletion requested by creator, unused)
- 21:57, 13 Dec 2004 Thue deleted Image:Polska kontur bialy.png (Moved to commons under same name)
- 21:56, 13 Dec 2004 Ilyanep deleted Talk:GotTheCrack (coresponding article has been deleted.)
- 21:56, 13 Dec 2004 Ilyanep deleted GotTheCrack (what we in the wiki community call "patent nonsense")
- 21:53, 13 Dec 2004 Thue deleted Image:Socks.jpg (Moved to commons under same name)
- 21:52, 13 Dec 2004 Infrogmation deleted Image:Brngaria.JPG (WP:PUI listed and tagged for deletion since October )
- 21:52, 13 Dec 2004 Thue deleted Crystian Olarte (Copy of [[Zinedine Zidane]])
- 21:51, 13 Dec 2004 Infrogmation deleted Image:Henry2.JPG (WP:PUI listed and tagged for deletion since October )
- 21:49, 13 Dec 2004 Mirv deleted Joseph Broadhurst (someone's self-description and favorite books. more suited to a user page)
- 21:48, 13 Dec 2004 Ike9898 deleted Simply fish (content was: '{{deletebecause|advertising}}Simply Fish is a popular chain of Fish and Chip Shops that could be found across the South-West of England.Quality and...')
- 21:47, 13 Dec 2004 Thue deleted Image:Texas state capitol.jpg (thumb of [[:Image:Texas state capitol 1.jpg]])
- 21:47, 13 Dec 2004 Infrogmation deleted Image:Audreygown01.jpg (WP:PUI listed and tagged for deletion since October (and no longer used in article))
- 21:46, 13 Dec 2004 Ike9898 deleted Prevention of disease (content was: 'fuck fuck fuck mother mother fuck mother mother fuck fuck mother fuck mother fuck noise noise noise1 2 1 2 3 4 noise noise noise smokin weed smokin we...')
- 21:46, 13 Dec 2004 Infrogmation deleted Image:Nat002.jpg (WP:PUI listed and tagged for deletion since October (and other images illustrate the article now))
- 21:44, 13 Dec 2004 Ike9898 deleted Iron (III) Chloride (content was: '<nowiki>'''''[[i need help finding out wut this is]]'''''</nowiki>{{delete}}')
- 21:44, 13 Dec 2004 Ike9898 deleted Myokimia (nonsense)
- 21:43, 13 Dec 2004 Mirv deleted Talk:The Watsons (content was: 'the watsons are nice and NEVER will be snobs')
- 21:43, 13 Dec 2004 Mirv deleted The Watsons (content was: 'thewatsons')
- 21:42, 13 Dec 2004 Mirv deleted Almanac of World History (content was: '--[[User:67.70.99.21|67.70.99.21]] 21:18, 13 Dec 2004 (UTC)--------<nowiki>Insert non-formatted text here</nowiki>[[Media:Example.ogg]]<math>Inser...')
- 21:42, 13 Dec 2004 Mirv deleted Talk:Nguyen Thu Trieu (content was: 'This page is opened project container, It should be developed in Wikipedia enviroment, why it must be deleted ?:Wikipedia is an online encyclopedia. ...')
- 21:38, 13 Dec 2004 Mirv deleted TheBestLinks.com (content was: '{{delete}}== The Best Links.com ==The Best Links is a stupid mirror site of the brilliance that is Wikipedia. It doesn't refer to the GNU Free Do...')
- 21:38, 13 Dec 2004 Mirv deleted Swimming with Sharks (content was: '{{delete}}You should watch it if you like Kevin spacey.')
- 21:37, 13 Dec 2004 Mirv deleted Type 15A Bangalore Class Destroyers (content was: '{{delete}}These destroyers are going to be the best bloody destroyers that India will posses.The first will be called the INS Bangalore. These will c...')
- 21:37, 13 Dec 2004 Mirv deleted Universism (content was: '{{deleteagain}}'''Universism''' is a [[freethought]] [[religion]] movement that began in [[Birmingham, Alabama]] (USA) in 2003. United Universists d...')
- 21:37, 13 Dec 2004 Infrogmation deleted Image:Oldhaths.JPG (WP:PUI listed and tagged for deletion since October )
- 21:37, 13 Dec 2004 Mirv deleted Nguyen Thu Trieu (Wikipedia is not a free wiki host)
- 21:36, 13 Dec 2004 Mirv deleted House(TV Show) (content was: '{{db|moved to proper name, all links fixed up}}#REDIRECT [[House (TV series)]]')
- 21:36, 13 Dec 2004 Mirv deleted Christopher Maw (content was: '{{delete}}Chris Maw of St. Thomas' House in Ampleforth College is known for his wry humour and dark dress sense. Chris is generally seen as a lad ar...')
- 21:34, 13 Dec 2004 Mirv deleted 'expectancy theory' (content was: 'expectancy theory')
- 21:34, 13 Dec 2004 Mirv deleted Peggy McMartin Buckey (nonsense)
- 21:33, 13 Dec 2004 Mirv deleted The Watsons (content was: 'the watsons are really nice people and are kind and genourous,they are not snobs just because there daughter is making millions.also if say they were ...')
- 21:32, 13 Dec 2004 Mirv deleted Kansai University (content was: ''''Bold text'''taik enqire{{nonsense}}')
- 21:30, 13 Dec 2004 Mirv deleted The Watsons (content was: '{{speedy}}the watsons are really nice people and are kind and genourous,they are not snobs just because there daughter is making millions.')
- 21:30, 13 Dec 2004 Mirv deleted Evan Chung (hoax/nonsense again)
- 21:29, 13 Dec 2004 Mirv deleted Wewtopia (content was: 'Under construction.')
- 21:29, 13 Dec 2004 Mirv deleted Anomaloscope (content before blanking was: 'hello')
- 21:29, 13 Dec 2004 Mirv deleted Oodinium (content before blanking was: 'test')
- 21:29, 13 Dec 2004 Mirv deleted Evan Chung (hoax/nonsense)
- 21:26, 13 Dec 2004 Mirv deleted The Watsons (content was: 'the watsons are horrible')
- 21:26, 13 Dec 2004 Mirv deleted Free Willy 3: The Rescue (content was: 'Hallol!i don't know what I can write!Sorry!My name is Nina and I am a great Fan from Jason james Richter and Keiko!And I think it was not so good, wh...')
- 21:26, 13 Dec 2004 Mirv deleted Sonicultra (content was: 'Sonicultra.com was a website created by Neosonix, ET6S, and Shadowmech. It is about the video game character sonic. It is cool. :)')
- 21:16, 13 Dec 2004 Charles Matthews deleted Phaestos disk (rambling nonsense about PD as time capsule)
- 21:12, 13 Dec 2004 Infrogmation deleted Image:Ross tartan.JPG (Listed on WP:PUI since 1 Oct, tagged for deletion)
- 21:12, 13 Dec 2004 Infrogmation deleted Image:Ross plant.JPG (Listed on WP:PUI since 1 Oct, tagged for deletion)
- 21:11, 13 Dec 2004 Infrogmation deleted Image:Ross hunting tartan.jpg (Listed on WP:PUI since 1 Oct, tagged for deletion)
- 21:09, 13 Dec 2004 Infrogmation deleted Image:Tat shuttle.JPG (Listed on WP:PUI since 1 Oct, tagged for deletion)
- 21:06, 13 Dec 2004 Infrogmation deleted "Image:Fertility buddha.JPG" (Listed on WP:PUI since 1 Oct, tagged for deletion)
- 21:05, 13 Dec 2004 Niteowlneils deleted "The Ballad of Chasey Lain" (nonsense)
- 21:05, 13 Dec 2004 Niteowlneils deleted "The Civilized World" (content was: '{{delete}}hkjhkjhkhkjb hjkhjk,hkjhjkbkj')
- 21:04, 13 Dec 2004 Niteowlneils deleted "The Manual of the Warrior of Light" (content was: '{{delete}}hello')
- 21:04, 13 Dec 2004 Niteowlneils deleted "Tyler Williamson" (content was: '{{delete}}He is so fat that when he wears a yellow trash bag people yell 'Taxi, Taxi!'')
- 21:04, 13 Dec 2004 Niteowlneils deleted "The Organic Act of the Department of Labor" (content was: '{{del}}the Department of Labor')
- 21:02, 13 Dec 2004 Niteowlneils deleted "Xaodi wu" (content was: '{{delete}}'Xaodi is like so smart.'-Tariq Esmail')
- 21:02, 13 Dec 2004 Niteowlneils deleted "Taisuke" (content was: '{{del}}I'm teh 1337 pwn yo.Noob pwn. Lol't.tariq = FAT')
- 21:02, 13 Dec 2004 Niteowlneils deleted "Yokoi and His Twenty-Eight Years of Secret Life on Guam" (content was: '{{del}}This seems unusualBut the story of Yokoi-san is very interesting--[[User:155.94.62.221|155.94.62.221]] 19:51, 13 Dec 2004 (UTC)')
- 21:00, 13 Dec 2004 Niteowlneils deleted "Robin Chan" (content was: '{{db|[[Wikipedia is not a wedding chapel]]}}I love Joanne.Joanne, will you marry me?YYYEEEAAAHHHH.')
- 21:00, 13 Dec 2004 Niteowlneils deleted "Song of Summer" (content was: 'IT'S GAY{{delete}}')
- 21:00, 13 Dec 2004 Niteowlneils deleted "Ralph Crane" (content was: '{{delete}}lolol')
- 20:59, 13 Dec 2004 Niteowlneils deleted "Maritime Rights movement" (content was: 'The Maritime Rights movement was a great thing.{{delete}}')
- 20:59, 13 Dec 2004 Niteowlneils deleted "Voice quality" (content was: '{{delete}}kuinka aari te')
- 20:59, 13 Dec 2004 Niteowlneils deleted "Medea, Algeria" (content was: '{{del}}medea')
- 20:58, 13 Dec 2004 Niteowlneils deleted "Kayla Lidstrom" (content was: '{{delete}}Kayla is a fat whore in my french class By Cory')
- 20:58, 13 Dec 2004 Niteowlneils deleted Khurram (content was: '{{delete}}I AM GAY AND I LIKE SmALL COCK LIKE MY OWNn00bie kHuRrAm sOmJeE')
- 20:58, 13 Dec 2004 Infrogmation deleted Image:Snake handle.JPG (Listed on WP:PUI since 1 Oct, tagged for deletion)
- 20:57, 13 Dec 2004 Infrogmation deleted Image:Twinkie.jpg (Listed on WP:PUI since 1 Oct, tagged for deletion)
- 20:57, 13 Dec 2004 Niteowlneils deleted Geography of Asia (content was: '{{delete}}balls')
- 20:57, 13 Dec 2004 Niteowlneils deleted GNOBIAN (content was: '{{deletebecause|orphan redirect to empty page}}#REDIRECT [[Gnobian]]')
- 20:57, 13 Dec 2004 Niteowlneils deleted Female sexuality (content was: '{{delete}}a discussion page')
- 20:56, 13 Dec 2004 Niteowlneils deleted Burning Sky (content was: '{{del}}you can go to whistlingwind.com for imfomation on Burning Sky.')
- 20:56, 13 Dec 2004 Niteowlneils deleted Bruce Friesen (content was: '{{delete}}Bruce is a gay fucker who keeps screwing us all over cause hes a dumb nazi')
- 20:56, 13 Dec 2004 Niteowlneils deleted Bohemian Summer 2000 (Utada Hikaru) (content was: '{{delete}}I'm looking for this picture for my slide show for World History.')
- 20:56, 13 Dec 2004 Niteowlneils deleted 1951 in radio (content was: '{{delete}}== [[Media:Example.ogg]]')
- 20:37, 13 Dec 2004 Quadell deleted Image:Tam.a330-223.pt-mve.250pix.jpg (scaled-down version of existing image)
- 20:33, 13 Dec 2004 Mirv deleted Blog.com (content was: ''''''''5yt'''''''')
- 20:31, 13 Dec 2004 Ike9898 deleted Masters at Work (content was: '{{db|In heav'n the bells are ringing}}ding dong merrily on high')
- 20:30, 13 Dec 2004 Ike9898 deleted NewsIsFree (content was: 'Hello My Name is Fred------[[User:209.78.182.26|209.78.182.26]] 20:05, 13 Dec 2004 (UTC)<nowiki>Insert non-formatted text here</nowiki>')
- 20:29, 13 Dec 2004 Jwrosenzweig deleted Vitinimous (content was: 'Full of or consisting of vitamins.' (No dictionary contains the term, google search is zero, obviously fake definition))
- 20:29, 13 Dec 2004 Rbrwr deleted Morg (Repost of previously deleted copyvio; content was: '{{copyvio|url=http://marvelite.prohosting.com/surfer/gallery/nexus/morg3.html}}')
- 20:29, 13 Dec 2004 Ike9898 deleted Isser Harel (content was: 'he is science dude he is cool i think he might have been a nerd or a homo.By [['''''Alex''''']]')
- 20:27, 13 Dec 2004 Ike9898 deleted Alex Hogoveen (content was: '{{delete}}is a loooooooooooooooooooser o my god he is so gay')
- 20:26, 13 Dec 2004 Ike9898 deleted C6 (graffiti artist) (content was: ''''{{delete}}''''''Bold text'''')
- 20:25, 13 Dec 2004 Ike9898 deleted Corey proulx (content was: '{{delete}}is sexy')
- 20:25, 13 Dec 2004 Ike9898 deleted Taylor Garretson (content was: '{{delete}}Likes Ryan V')
- 20:24, 13 Dec 2004 Ike9898 deleted Phaestos disk (nonsense)
- 20:22, 13 Dec 2004 Ike9898 deleted Start symbol (content was: 'Testando esse negócio')
- 20:21, 13 Dec 2004 Ike9898 deleted Crashware (content was: ''''Crashware''' is a word for operating systems and prorammes from [[Microsoft]], because these software often lets your PC crash.')
- 20:15, 13 Dec 2004 ChrisO deleted Air-Walker (Speedy deletion of previously deleted copyvio)
- 20:13, 13 Dec 2004 ChrisO deleted Dreaming Celestial (Speedy deletion of previously deleted copyvio)
- 20:13, 13 Dec 2004 ChrisO deleted Arishem the Judge (Speedy deletion of previously deleted copyvio)
- 20:13, 13 Dec 2004 ChrisO deleted Gammenon the Gatherer (Speedy deletion of previously deleted copyvio)
- 20:12, 13 Dec 2004 ChrisO deleted Tefral the Surveyor (Speedy deletion of previously deleted copyvio)
- 20:12, 13 Dec 2004 ChrisO deleted One Above All (Speedy deletion of previously deleted copyvio)
- 20:12, 13 Dec 2004 ChrisO deleted Oneg the Prober (Speedy deletion of previously deleted copyvio)
- 20:11, 13 Dec 2004 Quadell deleted Image:Swiss.a319.300pix.jpg (scaled-down version of existing image )
- 20:11, 13 Dec 2004 Quadell deleted Image:Swiss.a321-112.hb-ioh.250pix.jpg (scaled-down version of existing image)
- 20:10, 13 Dec 2004 Quadell deleted Image:Swiss.hb-isx.300pix.jpg (scaled-down version of existing image)
- 20:09, 13 Dec 2004 Quadell deleted Image:Swan.goose.arp.250pix.jpg (scaled-down version of existing image)
- 20:03, 13 Dec 2004 Quadell deleted Image:Surfing manu bay 250px.jpg (scaled-down version of existing image)
- 20:02, 13 Dec 2004 Quadell deleted Image:Surprise Pool at Fountain Paint Pot in Yellowstone-300px.JPG (Scaled-down version of existing image)
- 19:59, 13 Dec 2004 ChrisO deleted Ziran the Tester (Speedy deletion of previously deleted copyvio)
- 19:58, 13 Dec 2004 Taxman deleted User:Taxman/Test list of admins (my own page and it has accomplished it's purpose)
- 19:58, 13 Dec 2004 ALoan restored "Canis_Major_Dwarf_Galaxy"
- 19:57, 13 Dec 2004 Quadell deleted Image:Paddington station thumbnail.jpg (Image contains errors and cannot be displayed)
- 19:57, 13 Dec 2004 Quadell deleted "Image:Padmasana.jpg" (Image contains errors and cannot be displayed.)
- 19:56, 13 Dec 2004 Quadell deleted Image:Mycomp.PNG (Listed on IfD since Dec 5)
- 19:55, 13 Dec 2004 Ahoerstemeier deleted "Template:Bookmarkthis" (content were editing experiments, template not used on any page)
- 19:54, 13 Dec 2004 Quadell deleted Image:Oprahwinfrey.BMP (Listed on IfD since Dec 5)
- 19:53, 13 Dec 2004 Quadell deleted Image:Commonwealth flag.png (Listed on IfD since Dec 5)
- 19:53, 13 Dec 2004 Quadell deleted Image:Commonwealth-flag.png (Listed on IfD since Dec 5)
- 19:52, 13 Dec 2004 Quadell deleted Image:UPS azoto.gif (Listed on IfD since Dec 5)
- 19:52, 13 Dec 2004 Quadell deleted Image:Spc.gif (Listed on IfD since Dec 5)
- 19:51, 13 Dec 2004 Quadell deleted Image:HMS Vidette (D78).jpg (Listed on IfD since Dec 5)
- 19:51, 13 Dec 2004 Quadell deleted Image:HMS Javelin (F61).jpg (Listed on IfD since Dec 5)
- 19:50, 13 Dec 2004 Quadell deleted Image:IsisAndHorus20BC.gif (Listed on IfD since Dec 5)
- 19:46, 13 Dec 2004 ALoan deleted Canis Major Dwarf Galaxy (content was: '#redirect:[[Canis Major (dwarf galaxy)]]' - delete for page move)
- 19:44, 13 Dec 2004 Taxman deleted Wikipedia:Peer review to be deleted/Before October, 2004 (content was: '#REDIRECT [[Wikipedia:Peer review/Archive 1]]' moved. no need for redirect)
- 19:41, 13 Dec 2004 Taxman deleted Wikipedia:Peer review (to be deleted) (content was: '#REDIRECT [[Wikipedia:Peer review/Archive 2]]' no special need for it or its history now)
- 19:38, 13 Dec 2004 Charles Matthews deleted Owen crookston (content was: '{{delete}}what a noob.')
- 19:35, 13 Dec 2004 OldakQuill deleted James Lindsay Almond Jr. (content was: ''''James Lindsay Jr. Almond''' ([[1898]] - [[1986]]) was a [[United States of America|U.S.]] [[political figure]]. He served as the [[governor of Virg...')
- 19:11, 13 Dec 2004 ALoan deleted Eicosane (content was: '#REDIRECT [[Icosane]]' - for page move)
- 19:10, 13 Dec 2004 ALoan deleted Seo Taiji (content was: '#REDIRECT [[Jeong Hyun Cheol]][[Category:Korean musicians]]' - for page move)
- 19:00, 13 Dec 2004 Rmhermen deleted Anderson Road (content was: 'Anderson Road{{delete}}')
- 19:00, 13 Dec 2004 Rmhermen deleted Yasmin Parveneh (content was: 'my butt hurts. LOL!!!{{delete}}')
- 19:00, 13 Dec 2004 SimonP deleted Loser (content was: '{{del}}OWEN' SMOTHER')
- 18:59, 13 Dec 2004 Rmhermen deleted AlexanderLaplume (content was: 'He is a faggot.{{delete}}')
- 18:59, 13 Dec 2004 ALoan deleted Avebury (content was: ''''Avebury''' may refer to:* [[Avebury, Wiltshire|Avebury]], a village in the county of [[Wiltshire]], [[England]].* [[Avebury_Henge]], a neolithic...' - deleting dab page to move [[Avebury Henge]] back here)
- 18:56, 13 Dec 2004 Rmhermen deleted Hailie Jade (content was: 'RAwR?!?{{delete}}')
- 18:53, 13 Dec 2004 Rmhermen deleted Loomis Dean (content was: '{{del}}pooned')
- 18:53, 13 Dec 2004 Rmhermen deleted Tom dyhr (content was: '== TOM DYHR IS COOL ==== he is look how cool he is =={{delete}}')
- 18:52, 13 Dec 2004 Rmhermen deleted Jemiah the Analyzer (content was: '{{delete}}Jemiah the Analyzer Member of the 1st, 2nd, 3rd and 4th Celestial Hosts on Earth. Jemiah operates the Receiver, and accepts all samples th...')
- 18:51, 13 Dec 2004 Rmhermen deleted Eson the Searcher
- 18:51, 13 Dec 2004 Dante Alighieri deleted Talk:Raei (content was: '{{del}}Ian you are right thanks')
- 18:47, 13 Dec 2004 Jpgordon deleted What else could you tell me about artificial selection (content was: 'artififcial selection waas bouht upon by Darwin amd')
- 18:46, 13 Dec 2004 Jpgordon deleted Erasmus Smith High School (content was: '{{delete}}----'''Bold text'''''Italic text''[[Link title]][http://www.example.com link title]== Headline text ==[[Image:Example.jpg]][[Media:Exam...')
- 18:44, 13 Dec 2004 Adam Bishop deleted Tariq (content was: 'I'm so cool. NOOB.')
- 18:43, 13 Dec 2004 Rmhermen deleted Nezarr the Calculator
- 18:43, 13 Dec 2004 Rmhermen deleted Hargen the Measurer (content was: '{{delete}}Hargen the Measurer Member of the 1st, 2nd, 3rd and 4th Celestial Hosts. During the 4th Host, Hargen examined the Swiss Alps and confronte...')
- 18:41, 13 Dec 2004 Zanimum deleted Wikijunior PR test (content was: '{{db|Something that didn't belong in main, moved into user's own space}}#REDIRECT [[User:Zanimum/Wikijunior PR test]]')
- 18:40, 13 Dec 2004 ALoan restored "Surrey_Hills,_Victoria"
- 18:38, 13 Dec 2004 Jpgordon deleted Cool Cat (content was: '{{delete}}I am a COOL CAT YOU are not Why don't you blow up No one likes youNOt even meOr T.J.Or Peter')
- 18:38, 13 Dec 2004 Jpgordon deleted Butt Face (content was: '{{delete}}You have a butt Face and you are one. You are ugly. So is your mom. For further information to lower our self esteem do a search for Cool ...')
- 18:37, 13 Dec 2004 Ed g2s deleted Image:Crest.gif (orphaned, copyright)
- 18:34, 13 Dec 2004 Adam Bishop deleted Battle of Bory Tucholskie (content was: 'Hitler was a very bad man.')
- 18:30, 13 Dec 2004 Dante Alighieri deleted Raei (content was: '{{del}}Raei is an energy that exisits only on other planets. Such planets only exisist in the raeio galaxy. Raei energy is found splurting out of v...')
- 18:25, 13 Dec 2004 ALoan deleted Surrey Hills, Victoria (content was: '#REDIRECT [[Surrey Hills]]' - fixing cut and paste page move)
- 18:22, 13 Dec 2004 Rmhermen deleted Talk:Mouseman11713 (content was: '#REDIRECT [[Talk:148844]]')
- 18:20, 13 Dec 2004 Rmhermen deleted Talk:148844 (content was: '#REDIRECT [[Boys4mom]]')
- 18:19, 13 Dec 2004 Adam Bishop deleted Talk:Circus Maximus (content was: 'i didnt know pooping was an event')
- 18:19, 13 Dec 2004 Rmhermen deleted Mouseman11713 (content was: '{{delete}}#REDIRECT [[148844]]')
- 18:19, 13 Dec 2004 Niteowlneils deleted JUSE (content was: '{{delete}}h')
- 18:19, 13 Dec 2004 Rmhermen deleted 148844 (content was: '{{delete}} ********REMINDER******** 12/09 math 12/19 math 12/25 math anytime away from en...')
- 18:18, 13 Dec 2004 Niteowlneils deleted Web Based Enterprise Management Standard (content was: '{{db|no real content}}wbem')
- 18:17, 13 Dec 2004 Jpgordon deleted Subproantirepreadeungloriuslynessmentumologisteretmas (content was: 'The celebration of the better most person who is below another person who studies the state of the state of being for being against the state of being...')
- 18:15, 13 Dec 2004 Jpgordon deleted Khmer people (screed)
- 18:14, 13 Dec 2004 Woggly deleted /me (content was: ''''/me''' is a comman common in [[IRC]] and various other [[Instant Messenger]] programs such as [[Trillian]] or [[Adium]]. It shows the recipients th...')
- 18:12, 13 Dec 2004 Niteowlneils deleted Image talk:Mustard gas.png (content was: 'You can suck my penis{{delete}}')
- 18:12, 13 Dec 2004 Niteowlneils deleted Image:LocationZimbabwe.png (moved to commons under same name)
- 18:12, 13 Dec 2004 Niteowlneils deleted Image:LocationZambia.png (moved to commons under same name)
- 18:11, 13 Dec 2004 Niteowlneils deleted Image:LocationTunisia.png (moved to commons under same name)
- 18:10, 13 Dec 2004 Niteowlneils deleted Image:LocationTanzania.png (moved to commons under same name)
- 18:10, 13 Dec 2004 Niteowlneils deleted Image:LocationTogo.png (moved to commons under same name)
- 18:10, 13 Dec 2004 Niteowlneils deleted Image:LocationSwaziland.png (moved to commons under same name)
- 18:09, 13 Dec 2004 Niteowlneils deleted Image:LocationSudan.png (moved to commons under same name)
- 18:09, 13 Dec 2004 Niteowlneils deleted "Image:LocationSouthAfrica.png" (moved to commons under same name)
- 18:09, 13 Dec 2004 Niteowlneils deleted Image:LocationSomalia.png (moved to commons under same name)
- 18:07, 13 Dec 2004 Niteowlneils deleted Centralised data processing (content was: '{{delete}}Centralised data proceesing is the study of your ma and da in bed 2gether, have you ever noticed this?')
- 18:07, 13 Dec 2004 Niteowlneils deleted Congenital malformation (content was: '{{delete}}wtf')
- 18:06, 13 Dec 2004 SimonP deleted Quantum lingvodynamics (content was: '#REDIRECT [[Quantum linguodynamics]]')
- 18:05, 13 Dec 2004 DavidWBrooks deleted NAUI Tec (content was: '{{delete}}[http://www.nauitec.com/ NAUI Technical Training Operations] codified tec community training practices resulting in a higher standard of t...')
- 18:05, 13 Dec 2004 DavidWBrooks deleted Phaestos disk (nonsense, vandalism, who knows ... )
- 18:03, 13 Dec 2004 DavidWBrooks deleted "UKTFCL"
- 18:03, 13 Dec 2004 SimonP deleted Quantum linguodynamics (listed on VfD, no objections to deletion)
- 18:02, 13 Dec 2004 SimonP deleted MC Oral B (listed on VfD, no objections to deletion)
- 18:02, 13 Dec 2004 SimonP deleted Kelly-Ann Evans (listed on VfD, votes 5-1 in favour of deletion)
- 18:00, 13 Dec 2004 Rmhermen deleted Rational Rose / Rational RoseRT / Rational Architect (content was: 'the{{delete}}')
- 17:57, 13 Dec 2004 SimonP deleted "The Enemy Within Campaign" (listed on VfD, no objections to deletion)
- 17:56, 13 Dec 2004 SimonP deleted John-Christian Sands Eirikssen (listed on VfD, no objections to deletion)
- 17:56, 13 Dec 2004 Rmhermen deleted John Charles Martin Nash (content was: 'camille{{delete}}')
- 17:54, 13 Dec 2004 DavidWBrooks deleted Valley crossing (content was: '{{db|no content}}Valley Crossing is a term that I have come across while looking at the trecking and mountain climbing related stuff. I am not sure ...')
- 17:53, 13 Dec 2004 DavidWBrooks deleted Cavan scott
- 17:52, 13 Dec 2004 Rmhermen deleted Louis Conway (content was: 'Louis Conway was born on the 20th of March 1988. He sadly died in a [[freak accident]] involving dropping [[cats]] from [[five]] story tall buildings ...')
- 17:51, 13 Dec 2004 DavidWBrooks deleted Three suns
- 17:51, 13 Dec 2004 DavidWBrooks deleted Andrew chumbley (content was: 'Andrew D. Chumbley (September 15th 1967-September 15th 2004)Andrew Chumbley was an occultist of reknown; amongst his many accomplishments he was an ...')
- 17:50, 13 Dec 2004 SimonP deleted Helena-artworks (listed on VfD, no objections to deletion)
- 17:50, 13 Dec 2004 SimonP deleted Himizu Ryu (listed on VfD, no objections to deletion)
- 17:49, 13 Dec 2004 Rmhermen deleted Han Dynasty 2003 (content was: '{{db|no content}}The han dynasty was ruled by Jim.')
- 17:48, 13 Dec 2004 DavidWBrooks deleted Lolman (content was: ''''LOLMAN''' is the alias of a prolific [[team killer]] who joins [[multiplayer]] games of [[Unreal Tournament]] with the sole aim of 'maeking your ga...')
- 17:47, 13 Dec 2004 DavidWBrooks deleted Craters of Israel (content was: '[[Category:Craters on Earth|Israel]][[Category:Israel geography]]')
- 17:45, 13 Dec 2004 DavidWBrooks deleted Tomoki (content was: '{{delete}}Tomoki is a dipstick that everyone hates. He is so smart and everyone despises his intelligence. Especially Miss Z, who does not like Tomok...')
- 17:44, 13 Dec 2004 DavidWBrooks deleted My Toney Award Gone Bad Part II
- 17:44, 13 Dec 2004 DavidWBrooks deleted Alexey Brodovitch (content was: '<nowiki>booya</nowiki>')
- 17:44, 13 Dec 2004 DavidWBrooks deleted Tamborito (content was: 'hello baby')
- 17:44, 13 Dec 2004 DavidWBrooks deleted Dana Nastase (content was: 'the big man's bitch')
- 17:43, 13 Dec 2004 Charles Matthews deleted Fuzzles the Snugly Little Puppy and Grumpy the Cat (content was: '{{deletebecause|harmless vanity insertion and dead web link}}'''Fuzzles the Snugly Little Puppy and Grumpy the Cat''' is a weekly web-based [[comic ...')
- 17:42, 13 Dec 2004 DavidWBrooks deleted Mister Monster (content was: '{{delete}}'''Bold text'FUCKYEAH BITCHES WHOOOO''')
- 17:40, 13 Dec 2004 DavidWBrooks deleted My Toney Award Gone Bad (content was: '{{delete}}My Toney Award Gone BadI left the stage blankA man without a heartShot dead down done goneThe world is a cruel placeWith all this gl...')
- 17:40, 13 Dec 2004 DavidWBrooks deleted Wikijunior PR test (content was: '* She should preferably be Hawaiian.* She should be a proper weight; not anorexic, not obese. Not to rule out something design well like Violet Incre...')
- 17:40, 13 Dec 2004 DavidWBrooks deleted Merox (content was: '{{delete}}merox')
- 17:34, 13 Dec 2004 Rmhermen deleted Peyman (content was: '{{deletebecause|dicdef}}Peyman is a Persian first name for males. Peyman means 'vow' in English.')
- 17:32, 13 Dec 2004 DavidWBrooks deleted Armando Valladares (content was: '{{delete}}SAL')
- 17:32, 13 Dec 2004 DavidWBrooks deleted Hasee (content was: 'The Hasees are petpet of Neopets. They feature the game [http://www.neopets.com/games/haseebounce.phtml Hasee Bounce]')
- 17:31, 13 Dec 2004 DavidWBrooks deleted Michel Colin (content was: '{{delete}}MICHEL COLIN')
- 17:31, 13 Dec 2004 DavidWBrooks deleted Nanotransistor (content was: '{{delete}}mr bragg is cool')
- 17:30, 13 Dec 2004 Jnc deleted Legacy MSW (pr request, redir, non-existent target)
- 17:29, 13 Dec 2004 DavidWBrooks deleted Car Bingo (content was: ' hello i want to paly car race game == Headline text == hello i want paly car race game')
- 17:29, 13 Dec 2004 Rmhermen deleted Aiden (content was: '{{delete}}Aiden of irish gaelic origin (if i spelt that correctly) meaning little fire or fieryOther spellings include Aidan Aidynther were tw...')
- 17:28, 13 Dec 2004 SimonP deleted Stack-Based Memory Allocation (content was: '[[Static memory allocation]]{{stub}}')
- 17:28, 13 Dec 2004 Jnc deleted Legacy windows (pr request, redir, non-existent target)
- 17:26, 13 Dec 2004 Rmhermen deleted Alyson lynn priolo
- 17:25, 13 Dec 2004 DavidWBrooks deleted CIM (content was: 'Computer Integrated Manufacturing (CIM)')
- 17:24, 13 Dec 2004 DavidWBrooks deleted NBA fifty greatest players list (content was: 'George Gervin enducted on 1997 to NBA's Hall of Fame.')
- 17:24, 13 Dec 2004 Rmhermen deleted Boys4mom (content was: '{{delete}} DIRECTIONS TO HOMEWORKWWW.WFSD.K12.NY.USEBOARD FLOYD MIDDLE6TH GRADE TEAM 1')
- 17:24, 13 Dec 2004 Jnc deleted User:Ben Finney/Wikipedia markup (x-space redir to User: target moved to wrong location)
- 17:22, 13 Dec 2004 Rmhermen deleted Sam taylor (content was: '{{delete}}Sam taylor is a homosexual ignoramus, with a brain the size of a pea, he is also in a long lasting relationship with tim foster')
- 17:21, 13 Dec 2004 Jnc deleted Ben Finney/Wikipedia markup (xspace redir to User:)
- 17:04, 13 Dec 2004 DavidWBrooks deleted Black african kingdoms (content was: 'eat dick you cock sucker')
- 17:03, 13 Dec 2004 DavidWBrooks deleted Gordon Griffiths (content before blanking was: ''''Bold text'''He got slapped up many at time and was always on his arse. When he was not on his arse someone else was.')
- 17:03, 13 Dec 2004 DavidWBrooks deleted Chris Phoenix (content was: '{{delete}}fuck my butt hole')
- 17:03, 13 Dec 2004 DavidWBrooks deleted Oberaufseherin (content was: 'See: Aufseherin')
- 17:03, 13 Dec 2004 DavidWBrooks deleted JUSE (content was: 'h')
- 16:58, 13 Dec 2004 SimonP deleted Fairmont San Francisco (content was: 'jkl;lkjkl;kj jkld;alskdjfk jfkdsla;sdkj jfdksla;')
- 16:57, 13 Dec 2004 SimonP deleted United States Greenback Labor Party (content was: 'The Greenback Labor Party was a third party.')
- 16:54, 13 Dec 2004 SimonP deleted Climate in Poland (content was: 'the climate in Poland is quite moderate.')
- 16:51, 13 Dec 2004 Denni deleted Image:Dresdenneustadtquarter.jpg (request of creator)
- 16:49, 13 Dec 2004 SimonP deleted "Foyer" (redirect to nowhere)
- 16:48, 13 Dec 2004 SimonP deleted London SE22 (content was: 'London SE22 9 50 The Gardens')
- 16:47, 13 Dec 2004 SimonP deleted "First Congo War" (content was: '{{History of the DRC}}')
- 16:46, 13 Dec 2004 SimonP deleted Novell, Inc. v. CPU Distrib., Inc. (2000) (content was: 'it is not sufficient')
- 16:44, 13 Dec 2004 SimonP deleted UCLA School of the Arts and Architecture (content was: 'geography')
- 16:38, 13 Dec 2004 SimonP deleted Fairmont The Queen Elizabeth/Temp (copy of the copyvio)
- 16:37, 13 Dec 2004 SimonP deleted "List of banks in Greece" (content was: 'Ó')
- 16:34, 13 Dec 2004 SimonP deleted 1923 in France (content before blanking was: '----I have no idea what went on in France in 1923. I just want to see if this will work.')
- 16:34, 13 Dec 2004 SimonP deleted Budapest University of Technology and Economics (content before blanking was: '[[Image:Budapest_University.jpg]]')
- 16:29, 13 Dec 2004 Jnc deleted BenBaker/Monitor (xspace redir to User:)
- 16:11, 13 Dec 2004 Ahoerstemeier deleted Homelands of south africa (content was: 'eat dick')
- 16:02, 13 Dec 2004 Ahoerstemeier deleted James T. Fields (content was: 'JAmes T. Fields was a relative of Annie Fields, who was in a relationship with Sarah Orne Jewett.')
- 16:02, 13 Dec 2004 Ahoerstemeier deleted Intangibility (content was: 'INTANGIBILITY: THE ABILITY TO MOVE THOUGH OBJECTS OR IMPOSIBLE TO TOUCH!')
- 16:02, 13 Dec 2004 Ahoerstemeier deleted "BMAA" (content was: 'A neurotoxin.')
- 16:01, 13 Dec 2004 Ahoerstemeier deleted Basilica of Guadalupe (content was: '123')
- 15:58, 13 Dec 2004 Ahoerstemeier deleted Kriss kringle (content was: 'Santa Claus')
- 15:58, 13 Dec 2004 Ahoerstemeier deleted YUV 4:1:1 (content was: '<nowiki>Insert non-formatted text here</nowiki>[[Image:Example.jpg]][http://www.example.com link title]')
- 15:56, 13 Dec 2004 Ahoerstemeier deleted "Juan Velez aka K-Cling" (content was incomprehensible glibberish: 'K-Cling is a former hWo superstar and current D$W superstar.*More info coming soon*')
- 15:54, 13 Dec 2004 Ahoerstemeier deleted Yotaro Isawaki (content was: '''Italic text''[[Link title]]--[[User:64.18.36.4|64.18.36.4]] 15:46, 13 Dec 2004 (UTC)Pshaw '''Bold text'''yo yo yo holmes[[Image:Exampl...')
- 15:54, 13 Dec 2004 Ahoerstemeier deleted Garrett Hardin (content was: 'created idea of tragedy of the commons.')
- 15:53, 13 Dec 2004 Ahoerstemeier deleted "Charles Town" (content before blanking was: '#REDIRECT [[Charleston, South Carolina]]')
- 15:53, 13 Dec 2004 Ahoerstemeier deleted "Guy Marzorati" (content was: 'Guy Marzorati is an annoying kid who is sadistically and moraly impared.')
- 15:46, 13 Dec 2004 Jpgordon deleted Council of Sirmium (No content)
- 15:43, 13 Dec 2004 Hemanshu deleted "Musi of newzealand" (content was: 'If you are looking at this go to www.steakandcheese.com')
- 15:27, 13 Dec 2004 Ahoerstemeier deleted Ellis-van Creveld syndrome (content was no contents: '[[Genetic Disorder]](Reminder for when I have the time to put a page together){{substub}}')
- 15:25, 13 Dec 2004 Topbanana deleted Human relations (content was: 'Human relations are when people get along well and do not fight it out like old irish dukers in a bar. What we could call 'skrappardds' in old Gaelic...')
- 15:24, 13 Dec 2004 Topbanana deleted Virginia Davis (content was: '1918[[Kansas City]], [[Missouri]], [[USA]]')
- 15:23, 13 Dec 2004 Ahoerstemeier deleted Ellis-van Creveld syndrome (content was no contents: '[[Genetic Disease]](Reminder for when I have the time to put a page together){{substub}}')
- 15:19, 13 Dec 2004 Topbanana deleted Hwo (Advert. Content was: 'hWo- Hardcore Wrestling Organization (c)1999-2005Founders- Thomas 'Nash' Sanchez and Juan 'K-Cling' Velez*More info coming soon!*')
- 15:19, 13 Dec 2004 Ahoerstemeier deleted "Gundam Models" (content was: 'plastic models of gundams')
- 15:18, 13 Dec 2004 UtherSRG deleted TWIZTID (dead redirect link. content was: '#REDIRECT [[TWiZTiD]]')
- 15:18, 13 Dec 2004 Ahoerstemeier deleted Peter Huang (content was: '==IS GAY==')
- 15:18, 13 Dec 2004 UtherSRG deleted "TWiZTiD" (dead redirect link. content was: '#REDIRECT [[Twiztid]]')
- 15:17, 13 Dec 2004 Ahoerstemeier deleted Jewel tetra (content was: 'they are beautiful and they are full of jewels...... i like them!')
- 15:16, 13 Dec 2004 Ahoerstemeier deleted Spreadeagle (sex) (content was: 'nbcv')
- 15:16, 13 Dec 2004 Ahoerstemeier deleted Chin language (content was: 'This is a test.')
- 14:20, 13 Dec 2004 Jnc deleted Asa Winstanley Todo (xspace redir to User:)
- 14:10, 13 Dec 2004 Jnc deleted Anthere/links (xspace redir to User:)
- 14:05, 13 Dec 2004 Jnc deleted Anarres/Interlingua (xspace redir to User:)
- 13:53, 13 Dec 2004 Jnc deleted /Discussion language non sexiste (xspace redir to User:)
- 13:50, 13 Dec 2004 Ahoerstemeier deleted "Supergraphics" (content was: 'grant')
- 13:50, 13 Dec 2004 Ahoerstemeier deleted "Numerical linear algebra" (content was: 'ftytfh')
- 13:50, 13 Dec 2004 Ahoerstemeier deleted "Mantle (clothing)" (content was: 'mantle')
- 13:50, 13 Dec 2004 Ahoerstemeier deleted "Aaron miles" (content was: 'Aaron Miles - Best point guard in the history of Kansas Basketball!')
- 13:49, 13 Dec 2004 Ahoerstemeier deleted "Sid Rosenberg" (content was: 'sid is a fucking idiot.')
- 13:49, 13 Dec 2004 UtherSRG deleted Vasil tole (dead redirect link. content was: '#REDIRECT [[Vasil Tole]]')
- 13:49, 13 Dec 2004 UtherSRG deleted Vasil S. Tole (dead redirect link. content was: '#redirect [[Vasil Tole]]')
- 13:48, 13 Dec 2004 UtherSRG deleted Vasil s. tole (dead redirect link. content was: '#redirect [[Vasil Tole]]')
- 13:39, 13 Dec 2004 Geogre deleted Xin Beitou Branch (#4: No content, no potential: content was: '{{vfd}}{{cleanup}}==Stations==*[[Beitou]]*Xinbeitou')
- 13:29, 13 Dec 2004 Joy Stovall deleted Matt Justice (content was: '{{delete}}[[Image:carrot.jpg|frame|right|Karl Marx]]Matt Justice is a dancer. The end.')
- 13:27, 13 Dec 2004 Joy Stovall deleted Methner (content was: 'Chris was a world famous tap dancing porn star until the fire of 1920 when he saved 324983 children while tap dancing and sacrificed his own life.')
- 13:17, 13 Dec 2004 Ahoerstemeier deleted /me (content was: 'Common in IRC or various IM programs such as Trillian or Adium,Example: '/me is tired' returns;<nowiki>** Dan is tired</nowiki> {{st...')
- 13:12, 13 Dec 2004 Ferkelparade deleted Matt Justice (content was: 'Matt Justice is a dancer. His sister is doing Dan. The end.')
- 13:09, 13 Dec 2004 Ahoerstemeier deleted Telugu languages (content was: 'satish')
- 13:09, 13 Dec 2004 Ferkelparade deleted Dan Charnow (patent nonsense)
- 12:52, 13 Dec 2004 Deb deleted New Page (duplicate "Race" article incorrectly created by novice user)
- 12:50, 13 Dec 2004 Deb deleted Jason morgan (duplicate article)
- 12:42, 13 Dec 2004 Deb deleted Joonas lappalainen (content was: '{{db|vanity}}he is a guy from finland in espoo his hairs are blods and he has glasses (BTW he is school in espoonlahden yläkoulu)')
- 12:42, 13 Dec 2004 Deb deleted Fat boy (patent nonsense)
- 12:29, 13 Dec 2004 Ferkelparade deleted NameBase (content was: 'falcoff')
- 12:24, 13 Dec 2004 Ferkelparade deleted The Blessed Gerard (content was: 'very blessed.')
- 12:10, 13 Dec 2004 Ahoerstemeier deleted Outreach (content was: 'the act of reaching out')
- 12:10, 13 Dec 2004 MacGyverMagic deleted Moeder (content was: ''''[[''Ivan MInchenko.'']]'''' (no useful history))
- 12:09, 13 Dec 2004 Ahoerstemeier deleted KAROLOS G. PAPOULIAS (content was: '#REDIRECT [[KAROLOS PAPOULIAS]]' - redirected to an editing experiment article)
- 12:08, 13 Dec 2004 Ahoerstemeier deleted KAROLOS PAPOULIAS (content was: '[[Image:Example.jpg]]')
- 12:08, 13 Dec 2004 Ahoerstemeier deleted Karolos Papoulias (content was: '[[Image:Example.jpg]]')
- 12:04, 13 Dec 2004 MacGyverMagic deleted David Sole (content was: 'davi')
- 12:01, 13 Dec 2004 Jfdwolff deleted Tender buttons: objects, food, rooms (content was: '{{nonesense}}i am sitting here for a whole day searching for imformation about the influence of cubism on Gertrude stein')
- 12:00, 13 Dec 2004 Thue deleted Image:Halibutt.JPG (Moved to commons under same name)
- 12:00, 13 Dec 2004 MacGyverMagic deleted Aero Lloyd (content was: '{{delete}}vbnnn')
- 11:59, 13 Dec 2004 MacGyverMagic deleted Voting lever (content was: '{{delete}}fuckin lever')
- 11:58, 13 Dec 2004 Thue deleted Image:Delaware river at new hope small.jpg (Thumb of [[:Image:Delaware river at new hope.jpg]])
- 11:57, 13 Dec 2004 Thue deleted Image:Gypsy.engine.300pix.jpg (Thumb of [[:Image:Gypsy.engine.750pix.jpg]])
- 11:57, 13 Dec 2004 Thue deleted Nokia WAP Microbrowser (content was: '{{delete}}this is bullshit!!! by Faisal')
- 11:55, 13 Dec 2004 Thue deleted Image:DelphiantinousSmall.jpg (Thumb of [[:Image:Delphiantinous.jpg]])
- 11:55, 13 Dec 2004 Thue deleted Image:Delphi small.jpg (Thumb of [[:Image:Delphi.jpg]])
- 11:54, 13 Dec 2004 Thue deleted Image:Cranberry harvest.jpg (Moved to commons under same name)
- 11:53, 13 Dec 2004 Zoney restored "Briquet"
- 11:53, 13 Dec 2004 Thue deleted Image:Delphi temple-250px.jpg (Thumb of [[:Image:Delphi temple-650px.jpg]])
- 11:52, 13 Dec 2004 Thue deleted Image:Test picture 2.bmp (test upload)
- 11:51, 13 Dec 2004 Thue deleted Image:Winnemucca, NV-300px.JPG (Thumb of [[:Image:Winnemucca, NV-750px.JPG]])
- 11:51, 13 Dec 2004 Ferkelparade deleted Angle of deviation (patent nonsense, was already speedy deleted before)
- 11:51, 13 Dec 2004 Thue deleted Image:UTill.group.thumb250.1.jpg (Thumb of [[:Image:Tillandsia..log.800pix.jpg]])
- 11:50, 13 Dec 2004 Thue deleted Image:Junk-test-file.png (test upload)
- 11:48, 13 Dec 2004 Thue deleted Romanian presidential election, 2009 (content was: '{{delete}}Basescu again ?(fingers crossed)')
- 11:45, 13 Dec 2004 Thue deleted America's idiot (nonsense)
- 11:44, 13 Dec 2004 Thue deleted Enantiomeric (content was: '{{delete}}Enantiomeric')
- 11:44, 13 Dec 2004 Thue deleted Lauric acid (content was: '{{delete}} lauric acid')
- 11:44, 13 Dec 2004 Thue deleted Jklklhlhjkkkkkkkkkkkkkkkkkkkkkkkkkkkk (Guess :))
- 11:43, 13 Dec 2004 Thue deleted European culture (content was: '{{delete}}Culture of Europe is called European culture.{{Substub}}')
- 11:42, 13 Dec 2004 Charles Matthews deleted Angle of deviation (nonsense)
- 11:42, 13 Dec 2004 Charles Matthews deleted Ivan b. minchenko (content before blanking was: 'THe B. stands for:- bread -broodje but no one really knows what itreally stands for...')
- 11:21, 13 Dec 2004 Ferkelparade deleted Office of inspector general (content was: 'when and how was the treasury OIG started?')
- 10:44, 13 Dec 2004 SWAdair deleted Organizers (content was: ''''Organizers''' 'Most people these days have organizers. Some swear by them while others swear at them. Personally I think that some people are so ...')
- 10:38, 13 Dec 2004 Ahoerstemeier deleted Releve (content was: 'Walking around a site and making observations about percent of land cover.')
- 10:37, 13 Dec 2004 Ahoerstemeier deleted Space physics (content was: ' A physics area that is concerned with space and it's contemperories.')
- 10:25, 13 Dec 2004 Postdlf deleted Tromber (content was: 'The tornados are very dangerous. If you come more than 50 feet near a tornado, you'll be thrown 50 feet up in the air. So be safe. Stay inside and las...')
- 10:21, 13 Dec 2004 The Anome deleted Mind map (content was: '#REDIRECT [[Mind_mapping]]')
- 10:20, 13 Dec 2004 Ahoerstemeier deleted Wireless antena (content was spam: 'see more on http://www.magor.ch.vuorhttp://www.myteron.de/wavehan/index.php')
- 10:11, 13 Dec 2004 Charles Matthews deleted George tadross (nonsense content was: 'George Tadross (1984-2004)Student at Wilfrid Laurier University in Waterloo Ontario Canada. Aspirations to become a federal politician in Canadian P...')
- 10:08, 13 Dec 2004 The Anome deleted Concept map (del prior to merge)
- 10:00, 13 Dec 2004 SWAdair deleted Guide for user documentation (content was: 'what are the guide book available for people who want to make a career into documentation.what are the things they should have and follow for the sam...')
- 09:59, 13 Dec 2004 SWAdair deleted Cisalpinism (content was: 'CISALPINISM: The belief that the Catholic Church should')
- 09:52, 13 Dec 2004 SWAdair deleted La revolution en debat (content was: '{{delete}}remind me later.............................Editor.shaka')
- 09:51, 13 Dec 2004 SWAdair deleted European culture (content was: '{{db|no content}}Culture practiced in Europe.{{Substub}}')
- 09:39, 13 Dec 2004 SWAdair deleted Dawn of humanity (content was: 'The early period of man's existence.')
- 09:23, 13 Dec 2004 Mirv restored "The_Precepts_of_Kato_Kiyomasa"
- 09:14, 13 Dec 2004 Dante Alighieri deleted Susan Block (content was: 'Susan Block')
- 09:13, 13 Dec 2004 SWAdair deleted Bar graph (content before blanking was: '46464641311313131646464646464646464')
- 09:12, 13 Dec 2004 SWAdair deleted Tarouca (content was: 'Tarouca is a small city with a high tax of reproduction.People have the habit of doing sex in every place, whenever they want and in every way we can...')
- 09:11, 13 Dec 2004 SWAdair deleted Basmati (content was: 'THAT SOME MIGHTY GOOD SHIT WE'RE TALKING ABOUT HERE!!!!!!!!!GO BASMATI!!!!!!')
- 09:10, 13 Dec 2004 SWAdair deleted Haqibah (content was: 'Haqibah')
- 09:10, 13 Dec 2004 SWAdair deleted Space physics (content was: 'Space physics is a wonderful things asd ufukasdasdasdad')
- 09:08, 13 Dec 2004 Infrogmation deleted The Ten Commandments (1923 movie) (Bad description of 1950s movie for 1920s onecontent was: 'The Ten Commandments is a movie directed by [[Cecil B. DeMille]] that stars [[Charlton Heston]], [[Yul Brynner]], [[Edward G. Robinson]] and [[Yvonne ...')
- 09:04, 13 Dec 2004 SWAdair deleted Half-sizing (content was: '{{delete}}hi i m naveed')
- 08:59, 13 Dec 2004 Woggly deleted Talk:Nirmal kharel (content was: 'wikipedia has ever been controversial in its decisions not ot include thirld world emergers like nirmal kharel.we strongly condemn this and demand our...')
- 08:55, 13 Dec 2004 SWAdair deleted Data access (content was: 'THIS IS TEST PAGE')
- 08:55, 13 Dec 2004 SWAdair deleted Wikipedia talk:Votes for deletion/Slashdot subculture (Orphan (test?) page -- content was: 'Delete it')
- 08:52, 13 Dec 2004 SWAdair deleted Kazakh - (content was: '{{nonsense}}----<math>Insert formula here</math>----[[Image:Example.jpg]][[Media:Example.ogg]][http://www.example.com link title][[Link title]]''...')
- 08:52, 13 Dec 2004 SWAdair deleted President Sean (content was: '{{delete}}This is the man, who will one day be the President of the World.Born as Sean Allan/Allen Green on [[October 11th]] [[1989]] he will one ...')
- 08:52, 13 Dec 2004 Infrogmation deleted Intestinal lymphangiectasia (WP:CP listed since 3 Dec; content was: '{{copyvio1}}http://www.findarticles.com/p/articles/mi_m0950/is_6_109/ai_87564139{{copyvio2}}- [[User:SimonP|SimonP]] 02:43, Dec 3, 2004 (UTC)')
- 08:51, 13 Dec 2004 SWAdair deleted Talk:Aryan Unity (No article under this title -- rant placed on talk page of non-existent article)
- 08:50, 13 Dec 2004 Infrogmation deleted 18 Wheeler American Pro Trucker (WP:CP listed since 3 Dec; content was: '{{copyvio|url=http://www.planetdreamcast.com/games/reviews/18wheeler/}}')