Jump to content

File:Figure3bN.png

Page contents not supported in other languages.
This is a file from the Wikimedia Commons
From Wikipedia, the free encyclopedia

Original file (960 × 720 pixels, file size: 394 KB, MIME type: image/png)

Summary

Description
English: Three G-quadruplexes stack to form four stranded telomere with different topologies for d(GGGATTGGGATTGGGATTGGG) sequence.
Date
Source Own work
Author Bhattasinp

Licensing

I, the copyright holder of this work, hereby publish it under the following license:
w:en:Creative Commons
attribution share alike
This file is licensed under the Creative Commons Attribution-Share Alike 4.0 International license.
You are free:
  • to share – to copy, distribute and transmit the work
  • to remix – to adapt the work
Under the following conditions:
  • attribution – You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.
  • share alike – If you remix, transform, or build upon the material, you must distribute your contributions under the same or compatible license as the original.

Captions

Add a one-line explanation of what this file represents

Items portrayed in this file

depicts

12 December 2019

image/png

File history

Click on a date/time to view the file as it appeared at that time.

Date/TimeThumbnailDimensionsUserComment
current06:18, 26 December 2019Thumbnail for version as of 06:18, 26 December 2019960 × 720 (394 KB)BhattasinpCross-wiki upload from en.wikiversity.org

The following page uses this file:

Global file usage

The following other wikis use this file:

Metadata